Identification and Characterization of Colletotrichum Species Associated with Maize in Sichuan, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Fungal Isolation
2.2. Morphological and Cultural Characterization
2.3. DNA Extraction
2.4. Polymerase Chain Reaction (PCR) Amplification and Sequencing
2.5. Phylogenetic Analyses
2.6. Pathogenicity Test
2.7. Host Specificity Test
2.8. Data Analysis
3. Results
3.1. Morphological and Cultural Characteristics
3.1.1. Colony Characteristics
3.1.2. Growth Rate
3.1.3. Conidial Morphology
3.1.4. Conidial Appressorium Morphology
3.1.5. Mycelial Appressorium Morphology
3.2. Phylogenetic Analysis
3.3. Pathogenicity
3.4. Host Specificity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- National Bureau of Statisties of China. China Statistical Yearbook 2023; China Statistics Press: Beijing, China, 2023; ISBN 978-7-5230-0190-5. [Google Scholar]
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum—Current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [PubMed]
- Uecker, F.A.; Bailey, J.A.; Jegor, M.J. Colletotrichum: Biology, pathology and control. Mycologia 1993, 85, 879. [Google Scholar] [CrossRef]
- Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- Sukno, S.A.; Sanz-Martín, J.M.; González-Fuente, M.; Hiltbrunner, J.; Thon, M.R. First report of anthracnose stalk rot of maize caused by Colletotrichum graminicola in Switzerland. Plant Dis. 2014, 98, 694. [Google Scholar] [CrossRef]
- Vieira, W.A.S.; Michereff, S.J.; De Morais, M.A.; Hyde, K.D.; Câmara, M.P.S. Endophytic species of Colletotrichum associated with mango in northeastern Brazil. Fungal Divers. 2014, 67, 181–202. [Google Scholar] [CrossRef]
- Liu, F.L.; Tang, G.T.; Zheng, X.J.; Li, Y.; Sun, X.F.; Qi, X.B.; Zhou, Y.; Xu, J.; Chen, H.B.; Chang, X.L.; et al. Molecular and phenotypic characterization of Colletotrichum species associated with anthracnose disease in peppers from Sichuan Province, China. Sci. Rep. 2016, 6, 32761. [Google Scholar] [CrossRef]
- Manova, V.; Stoyanova, Z.; Rodeva, R.; Boycheva, I.; Korpelainen, H.; Vesterinen, E.; Wirta, H.; Bonchev, G. Morphological, pathological and genetic diversity of the Colletotrichum species, pathogenic on solanaceous vegetable crops in Bulgaria. J. Fungi 2022, 8, 1123. [Google Scholar] [CrossRef]
- Liu, X.; Zheng, X.J.; Khaskheli, M.I.; Sun, X.F.; Chang, X.L.; Gong, G.S. Identification of Colletotrichum species associated with blueberry anthracnose in Sichuan, China. Pathogens 2020, 9, 718. [Google Scholar] [CrossRef]
- Jian, Y.Q.; Li, Y.; Tang, G.T.; Zheng, X.J.; Khaskheli, M.I.; Gong, G.S. Identification of Colletotrichum species associated with anthracnose disease of strawberry in Sichuan province, China. Plant Dis. 2021, 105, 3025–3036. [Google Scholar] [CrossRef]
- Cao, X.R.; Li, F.; Xu, H.; Li, H.L.; Wang, S.J.; Wang, G.; West, J.S.; Wang, J.B. Characterization of Colletotrichum species infecting litchi in Hainan, China. J. Fungi 2023, 9, 1042. [Google Scholar] [CrossRef] [PubMed]
- Mendes, M.A.S.; da Silva, V.L.; Dianese, J.C.; Ferreira, M.A.S.V.; dos Santos, C.E.N.; Neto, E.G.; Urben, A.F.; Castro, C. Fungos em Plantas No Brasil; Embrapa: Brasília, Brazil, 1998; ISBN 85-7383-031-X. [Google Scholar]
- Mułenko, W.; Majewski, T.; Ruszkiewicz-Michalska, M. (Eds.) A Preliminary Checklist of Micromycetes in Poland; W. Szafer Institute of Botany, Polish Academy of Sciences: Wroclaw, Poland, 2008; ISBN 978-83-89648-75-4. [Google Scholar]
- Jirak-Peterson, J.C.; Esker, P.D. Tillage, crop rotation, and hybrid effects on residue and corn anthracnose occurrence in Wisconsin. Plant Dis. 2011, 95, 601–610. [Google Scholar] [CrossRef] [PubMed]
- Bergstrom, G.C.; Nicholson, R.L. The biology of corn anthracnose: Knowledge to exploit for improved management. Plant Dis. 1999, 83, 596–608. [Google Scholar] [CrossRef] [PubMed]
- Cota, L.V.; Da Costa, R.V.; Silva, D.D.; Casela, C.R.; Parreira, D.F. Quantification of yield losses due to anthracnose stalk rot on corn in Brazilian conditions. J. Phytopathol. 2012, 160, 680–684. [Google Scholar] [CrossRef]
- Sanz-Martín, J.M.; Postigo, V.; Mateos, A.; Albrecht, B.; Munkvold, G.P.; Thon, M.R.; Sukno, S.A. First report of Colletotrichum graminicola causing maize anthracnose stalk rot in the Alentejo Region, Portugal. Plant Dis. 2016, 100, 648. [Google Scholar] [CrossRef]
- Cuevas-Fernández, F.B.; Robledo-Briones, A.M.; Baroncelli, R.; Trkulja, V.; Thon, M.R.; Buhinicek, I.; Sukno, S.A. First report of Colletotrichum graminicola causing maize anthracnose in Bosnia and Herzegovina. Plant Dis. 2019, 103, 3281. [Google Scholar] [CrossRef]
- Duan, C.X.; Guo, C.; Yang, Z.H.; Sun, S.L.; Zhu, Z.D.; Wang, X.M. First report of anthracnose leaf blight of maize caused by Colletotrichum graminicola in China. Plant Dis. 2019, 103, 1770. [Google Scholar] [CrossRef]
- Crouch, J.A.; Clarke, B.B.; White, J.F.; Hillman, B.I. Systematic analysis of the falcate-spored graminicolous Colletotrichum and a description of six new species from warm-season grasses. Mycologia 2009, 101, 717–732. [Google Scholar] [CrossRef]
- Wilson, G.W. The identity of the anthracnose of grasses. Phytopathology 1914, 4, 106–112. [Google Scholar]
- von Arx, J.A. Die Arten der Gattung Colletotrichum Cda; Phytopathologisch Laboratorium Willie Commelin Scholten: Baarn, The Netherlands, 1957. [Google Scholar]
- Sutton, B.C. The Coelomycetes: Fungi Imperfecti with Pycnidia Acervuli and Stromata, Illustrated ed.; CABI Publishing: Wallingford, UK, 1980; ISBN 978-0-85198-446-9. [Google Scholar]
- Sutton, B. The Genus Glomerella and Its Anamorph Colletotrichum. In Colletotrichum: Biology, Pathology and Control; Bailey, J.A., Jegereditors, M.J., Eds.; CABI Publishing: Wallingford, UK, 1992; pp. 1–26. ISBN 978-0-85198-756-9. [Google Scholar]
- Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
- Hyde, K.D.; Cai, L.; Cannon, P.F.; Crouch, J.A.; Crous, P.W.; Damm, U.; Goodwin, P.H.; Chen, H.; Johnston, P.R.; Jones, E.B.G.; et al. Colletotrichum—Names in current use. Fungal Divers. 2009, 39, 147–182. [Google Scholar]
- Crouch, J.A.; Clarke, B.B.; Hillman, B.I. What is the value of ITS sequence data in Colletotrichum systematics and species diagnosis? A case study using the falcate-spored graminicolous Colletotrichum group. Mycologia 2009, 101, 648–656. [Google Scholar] [CrossRef] [PubMed]
- Sherriff, C.; Whelan, M.J.; Arnold, G.M.; Bailey, J.A. rDNA sequence analysis confirms the distinction between Colletotrichum graminicola and C. sublineolum. Mycol. Res. 1995, 99, 475–478. [Google Scholar] [CrossRef]
- Moriwaki, J.; Tsukiboshi, T.; Sato, T. Grouping of Colletotrichum species in Japan based on rDNA Sequences. J. Gen. Plant Pathol. 2002, 68, 307–320. [Google Scholar] [CrossRef]
- Yang, Y.L.; Liu, Z.Y.; Cai, L.; Hyde, K.D.; Yu, Z.N.; Mckenzie, E.H.C. Colletotrichum anthracnose of Amaryllida. Fungal Divers. 2009, 39, 123–146. [Google Scholar]
- Jayawardena, R. Notes on currently accepted species of Colletotrichum. Mycosphere 2016, 7, 1192–1260. [Google Scholar] [CrossRef]
- Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: Employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia 2015, 35, 63–86. [Google Scholar] [CrossRef]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W. The Colletotrichum boninense species complex. Stud. Mycol. 2012, 73, 1–36. [Google Scholar] [CrossRef]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef]
- Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 2015, 71, 247–264. [Google Scholar] [CrossRef]
- Liu, F.; Cai, L.; Crous, P.W.; Damm, U. The Colletotrichum gigasporum species complex. Persoonia 2014, 33, 83–97. [Google Scholar] [CrossRef] [PubMed]
- Damm, U.; Sato, T.; Alizadeh, A.; Groenewald, J.Z.; Crous, P.W. The Colletotrichum dracaenophilum, C. magnum and C. orchidearum species complexes. Stud. Mycol. 2019, 92, 1–46. [Google Scholar] [CrossRef] [PubMed]
- Ye, K.H.; Gong, G.S.; Qi, X.B.; Yuan, J.C.; Jiang, C.X.; Sun, X.F.; Wang, Y.Y.; Yang, J.Z. Effect of cultivation measures on sheath blight and southern leaf blight of corn. Plant Prot. 2015, 41, 154–159. [Google Scholar] [CrossRef]
- Sun, X.F.; Qi, X.B.; Wang, W.; Liu, X.; Zhao, H.N.; Wu, C.P.; Chang, X.L.; Zhang, M.; Chen, H.B.; Gong, G.S. Etiology and symptoms of maize leaf spot caused by Bipolaris spp. in Sichuan, China. Pathogens 2020, 9, 229. [Google Scholar] [CrossRef]
- Zhou, Y.; Gong, G.S.; Cui, Y.L.; Zhang, D.X.; Chang, X.L.; Hu, R.P.; Liu, N.; Sun, X.F. Identification of botryosphaeriaceae species causing kiwifruit rot in Sichuan province, China. Plant Dis. 2015, 99, 699–708. [Google Scholar] [CrossRef]
- Gong, G.S.; Xu, Q.; Zhang, M.; Yang, J.Z.; Chen, H.B.; Shen, S.A.; Tang, T.F. A simple method for single fungal spore isolation. J. Maize Sci. 2010, 18, 126–127, 134. [Google Scholar] [CrossRef]
- Guerber, J.C.; Liu, B.; Correll, J.C.; Johnston, P.R. Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 2003, 95, 872–895. [Google Scholar] [CrossRef] [PubMed]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- O’Donnell, K.; Nirenberg, H.I.; Aoki, T.; Cigelnik, E. A Multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 2000, 41, 61–78. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Elsevier: Amsterdam, The Netherlands, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Chuang, Y.-H.; Huang, N.; Mitch, W.A. Predicting the contribution of chloramines to contaminant decay during ultraviolet/hydrogen peroxide advanced oxidation process treatment for potable reuse. Environ. Sci. Technol. 2019, 53, 4416–4425. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP* Phylogenetic Analysis Using Parsimony, (*and Other Methods); Version 4.0 b10; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
- Jayawardena, R.S.; Bhunjun, C.S.; Hyde, K.D.; Gentekaki, E.; Itthayakorn, P. Colletotrichum: Lifestyles, biology, morpho-species, species complexes and accepted species. Mycosphere 2021, 12, 519–669. [Google Scholar] [CrossRef]
- Dowling, M.; Peres, N.; Villani, S.; Schnabel, G. Managing Colletotrichum on fruit crops: A “complex” challenge. Plant Dis. 2020, 104, 2301–2316. [Google Scholar] [CrossRef]
- Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef] [PubMed]
- Grammen, A.; Wenneker, M.; Van Campenhout, J.; Pham, K.T.K.; Van Hemelrijck, W.; Bylemans, D.; Geeraerd, A.; Keulemans, W. Identification and pathogenicity assessment of Colletotrichum isolates causing bitter rot of apple fruit in Belgium. Eur. J. Plant Pathol. 2019, 153, 47–63. [Google Scholar] [CrossRef]
- Rakotoniriana, E.F.; Scauflaire, J.; Rabemanantsoa, C.; Urveg-Ratsimamanga, S.; Corbisier, A.-M.; Quetin-Leclercq, J.; Declerck, S.; Munaut, F. Colletotrichum gigasporum sp. nov., a new species of Colletotrichum producing long straight conidia. Mycol. Prog. 2013, 12, 403–412. [Google Scholar] [CrossRef]
- Damm, U.; Woudenberg, J.H.C.; Cannon, P.F.; Crous, P.W. Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers. 2009, 39, 45–87. [Google Scholar]
- Noireung, P.; Phoulivong, S.; Liu, F.; Cai, L.; Mckenzie, E.H.C.; Chukeatirote, E.; Jones, E.B.G.; Bahkali, A.H.; Hyde, K.D. Novel species of Colletotrichum revealed by morphology and molecular analysis. Cryptogam. Mycol. 2012, 33, 347–362. [Google Scholar] [CrossRef]
- Penzig, O. Funghi Agrumicoli. Contribuzione Allo Studio Dei Funghi Parassiti Degli Agrumi; P. Fracanzani: Padova, Italy, 1882; ISBN 3-2044-106-408-057. [Google Scholar]
- Waller, J.M.; Bridge, P.D.; Black, R.; Hakiza, G. Characterization of the coffee berry disease pathogen, Colletotrichum kahawae sp. nov. Mycol. Res. 1993, 97, 989–994. [Google Scholar] [CrossRef]
- Echeverrigaray, S.; Scariot, F.J.; Fontanella, G.; Favaron, F.; Sella, L.; Santos, M.C.; Schwambach, J.; Pedrotti, C.; Delamare, A.P.L. Colletotrichum species causing grape ripe rot disease in Vitis labrusca and V. vinifera varieties in the highlands of southern Brazil. Plant Pathol. 2020, 69, 1504–1512. [Google Scholar] [CrossRef]
- Silva, D.N.; Talhinhas, P.; Cai, L.; Manuel, L.; Gichuru, E.K.; Loureiro, A.; Várzea, V.; Paulo, O.S.; Batista, D. Host-jump drives rapid and recent ecological speciation of the emergent fungal pathogen Colletotrichum kahawae. Mol. Ecol. 2012, 21, 2655–2670. [Google Scholar] [CrossRef]
- De Almeida, L.B.; Matos, K.S.; Assis, L.A.G.; Hanada, R.E.; Da Silva, G.F. First report of anthracnose of Capsicum chinense in Brazil caused by Colletotrichum brevisporum. Plant Dis. 2017, 101, 1035. [Google Scholar] [CrossRef]
- Zhang, M.M.; Forte-Perri, V.; Sun, W.X.; Tang, L.H.; Huang, S.P.; Guo, T.X.; Chen, X.L.; Li, Q.L. Identification and observation of infection processes of Colletotrichum species associated with persimmon anthracnose in Guangxi, China. Plant Dis. 2023, 107, 1670–1679. [Google Scholar] [CrossRef]
- Wang, Y.R.; Hu, Z.; Zhong, J.; Chen, Y.; Zhu, J.Z. First report of Colletotrichum cliviicola causing leaf spot on tobacco (Nicotiana tabacum) in Hunan province of China. Plant Dis. 2022, 106, 316. [Google Scholar] [CrossRef] [PubMed]
- Dada, A.O.; Dania, V.O.; Oyatomi, O.A.; Abberton, M.; Ortega-Beltran, A. First report of Colletotrichum cliviicola causing anthracnose disease of cowpea (Vigna unguiculata) in Nigeria. Plant Dis. 2023, 107, 2254. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.L.; Cai, L.; Yu, Z.N.; Liu, Z.Y.; Hyde, K.D. Colletotrichum species on Orchidaceae in southwest China. Cryptogam. Mycol. 2011, 32, 229–253. [Google Scholar] [CrossRef]
- De Silva, D.D.; Groenewald, J.Z.; Crous, P.W.; Ades, P.K.; Nasruddin, A.; Mongkolporn, O.; Taylor, P.W.J. Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia. IMA Fungus 2019, 10, 8. [Google Scholar] [CrossRef]
- Lima, N.B.; De, A.; Batista, M.V.; De Morais, M.A.; Barbosa, M.A.G.; Michereff, S.J.; Hyde, K.D.; Câmara, M.P.S. Five Colletotrichum species are responsible for mango anthracnose in northeastern Brazil. Fungal Divers. 2013, 61, 75–88. [Google Scholar] [CrossRef]
- Auyong, A.S. The role of cutinase and its impact on pathogenicity of Colletotrichum truncatum. J. Plant Pathol. Microbiol. 2015, 6, 259. [Google Scholar] [CrossRef]
- De Silva, D.D.; Crous, P.W.; Ades, P.K.; Hyde, K.D.; Taylor, P.W.J. Life styles of Colletotrichum species and implications for plant biosecurity. Fungal Biol. Rev. 2017, 31, 155–168. [Google Scholar] [CrossRef]
- Lu, Q.H.; Wang, Y.C.; Li, N.N.; Ni, D.J.; Yang, Y.J.; Wang, X.C. Differences in the characteristics and pathogenicity of Colletotrichum camelliae and C. fructicola isolated from the tea plant [Camellia sinensis (L.) O. Kuntze]. Front. Microbiol. 2018, 9, 3060. [Google Scholar] [CrossRef]
- Liu, Y.Y.; Tan, X.Q.; Zhao, J.; Niu, Y.J.; Hsiang, T.; Yu, Z.H.; Qin, W.T. Diversity of Colletotrichum species associated with anthracnose on euonymus japonicus and their sensitivity to fungicides. Front. Plant Sci. 2024, 15, 1411625. [Google Scholar] [CrossRef]
- O’Connell, R.J.; Thon, M.R.; Hacquard, S.; Amyotte, S.G.; Kleemann, J.; Torres, M.F.; Damm, U.; Buiate, E.A.; Epstein, L.; Alkan, N.; et al. Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nat. Genet. 2012, 44, 1060–1065. [Google Scholar] [CrossRef]
- Delaye, L.; García-Guzmán, G.; Heil, M. Endophytes versus biotrophic and necrotrophic pathogens—Are fungal lifestyles evolutionarily stable traits? Fungal Divers. 2013, 60, 125–135. [Google Scholar] [CrossRef]
Gene | Product Name | Primer | Primer Sequence (5′-3′) | Length (bp) | References |
---|---|---|---|---|---|
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | GDF | GCCGTCAACGACCCCTTCATTGA | 200 | [43] |
GDR | GGGTGGAGTCGTACTTGAGCATGT | ||||
ITS | Internal transcribed spacer | ITS1 | TCCGTAGGTGAACCTGCGG | 550 | [47,48] |
ITS4 | TCCTCCGCTTATTGATATGC | ||||
TUB2 | β-tubulin | BT2a | GGTAACCAAATCGGTGCTGCTTTC | 500 | [45] |
BT2b | ACCCTCAGTGTAGTGACCCTTGGC | ||||
ACT | Actin | ACT512F | ATGTGCAAGGCCGGTTTCGC | 300 | [44] |
ACT783R | TACGAGTCCTTCTGGCCCAT | ||||
CAL | Calmodulin | CL1 | GARTWCAAGGAGGCCTTCTC | 688 | [46] |
CL2 | TTTTTGCATCATGAGTTGGAC |
Group x | Species | Colonies’ Appearance | Growth Rate (mm/d) y | Conidia | Conidial Appressorium | Mycelial Appressorium | ||||
---|---|---|---|---|---|---|---|---|---|---|
Length (μm) | Width (μm) | Shape | Width (μm) | Length (μm) | Characteristic | |||||
1(32) | C. gloeosporioides C. simense C. fructicola | Sparse, white hyphae | 5.9 ± 0.3 a z | 14.5 ± 1.5 f | 5.0 ± 0.6 f | cylindrical | 7.2 ± 0.6 f | 5.9 ± 0.4 e | dark brown, oval to round | ovoid, light brown to dark brown, smooth edges |
2(24) | C. cliviicola | Dense, pale gray with dark gray edge hyphae | 5.5 ± 0.2 b | 16.5 ± 1.0 e | 5.6 ± 0.3 e | fusiform | 9.1 ± 1.1 d | 8.1 ± 0.8 b | dark brown, irregular with crenate edge | ovoid, light brown to brown with lobed |
3(5) | C. truncatum | Sparse, white with yellowish hyphae | 4.5 ± 0.4 e | 26.6 ± 1.4 a | 3.2 ± 0.2 g | falcate | 8.6 ± 1.1 d | 5.6 ± 0.6 e | brown, ovoid with smooth edge | ovoid, brown to dark brown, smooth edges |
4(7) | C. boninense | Sparse, pale yellowish with white hyphae | 4.9 ± 0.2 c | 19.2 ± 1.4 d | 8.4 ± 0.5 b | taper | 9.3 ± 1.0 e | 6.9 ± 1.3 d | dark brown, irregular with crenate edge | ovoid, brown with lobed or smooth edges |
5(16) | C. karstii | Sparse, white hyphae | 4.6 ± 0.2 de | 14.4 ± 0.6 f | 6.9 ± 0.2 c | cylindrical | 11.1 ± 0.4 c | 7.7 ± 1.1 bc | brown, ovoid with crenate edge | ovoid to irregular, light brown to dark brown, smooth edge |
6(2) | C. gigasporum | Dense, white hyphae | 4.7 ± 0.2 cd | 25.0 ± 1.4 b | 8.6 ± 0.4 a | long cylindrical | 14.1 ± 0.6 a | 8.7 ± 0.7 a | brown, ovoid with smooth edge | irregular ovoid brown to dark brown with slightly lobed edges |
7(7) | C. kahawae | Dense, black hyphae with white edge hyphae | 4.6 ± 0.4 de | 14.3 ± 0.7 f | 5.6 ± 0.3 e | cylindrical | 11.9 ± 0.6 b | 7.4 ± 1.4 c | brown, ovoid with crenate edge | ovoid, brown to dark brown with slightly lobed edges |
8(6) | C. brevisporum | Sparse, gray to black with gray hyphae | 4.8 ± 0.1 c | 20.1 ± 1.4 c | 5.8 ± 0.3 d | long cylindrical | 8.6 ± 0.4 e | 7.3 ± 0.5 c | dark brown, oval to round | ovoid to irregular, light to dark brown with smooth edges |
Species | Potted Maize Seedling b | Maize Grown in the Field d | |
---|---|---|---|
Wound b | Non-Wound c | ||
C. cliviicola | 57.1 | 38.9 | 33.3 |
C. fructicola | 68.0 | 0.0 | 40.0 |
C. karstii | 54.2 | 0.0 | 16.7 |
C. siamense | 86.4 | 72.2 | 53.3 |
C. truncatum | 60.9 | 50.0 | 0 |
C. boninense | 0 | 0 | 0 |
C. kahawae | 0 | 0 | 0 |
C. gigasporum | 0 | 0 | 0 |
C. brevisporum | 0 | 0 | 0 |
C. gloeosporioides | 0 | 0 | 0 |
Species | Isolate | Mean Lesion Diameter (cm) | |
---|---|---|---|
Crown Pear | Red Fuji Apple | ||
Colletotrichum cliviicola | YMTJ110 | 2.9 ± 0.5 b y | 1.3 ± 0.1 c |
C. fructicola | YMTJ120 | 2.8 ± 0.7 b | 2.4 ± 0.5 b |
C. karstii | YMTJ118 | 0.7 ± 0.3 d | 0.6 ± 0.1 d |
C. siamense | YMTJ117 | 4.4 ± 0.7 a | 3.5 ± 0.3 a |
C. truncatum | YMTJ1 | 1.8 ± 0.9 c | 0.5 ± 0.1 d |
C. boninense | YMTJ116 | 0 e | 0 e |
C. kahawae | YMTJ27 | 0.8 ± 0.3 d | 0 e |
C. brevisporum | YMTJ58 | 2.5 ± 0.4 b | 0 e |
C. gigasporum | YMTJ12 | 2.2 ± 0.1 bc | 0 e |
C. gloeosporioides | YMTJ55 | 2.8 ± 0.3 b | 0.8 ± 0.1 d |
CK | 0 e | 0 e |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, R.; Li, Y.; Zhao, H.; Sun, X.; Chen, W.; Li, P.; Li, X.; Wu, C.; Ma, M.; Gong, G. Identification and Characterization of Colletotrichum Species Associated with Maize in Sichuan, China. J. Fungi 2024, 10, 799. https://doi.org/10.3390/jof10110799
Yang R, Li Y, Zhao H, Sun X, Chen W, Li P, Li X, Wu C, Ma M, Gong G. Identification and Characterization of Colletotrichum Species Associated with Maize in Sichuan, China. Journal of Fungi. 2024; 10(11):799. https://doi.org/10.3390/jof10110799
Chicago/Turabian StyleYang, Rui, Ying Li, Henan Zhao, Xiaofang Sun, Wen Chen, Pan Li, Xuehu Li, Cuiping Wu, Miaomiao Ma, and Guoshu Gong. 2024. "Identification and Characterization of Colletotrichum Species Associated with Maize in Sichuan, China" Journal of Fungi 10, no. 11: 799. https://doi.org/10.3390/jof10110799
APA StyleYang, R., Li, Y., Zhao, H., Sun, X., Chen, W., Li, P., Li, X., Wu, C., Ma, M., & Gong, G. (2024). Identification and Characterization of Colletotrichum Species Associated with Maize in Sichuan, China. Journal of Fungi, 10(11), 799. https://doi.org/10.3390/jof10110799