Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling, Fungal Isolation, and Morphology
2.2. DNA Extraction and PCR Amplification
2.3. Sequence Alignment and Phylogenetic Analyses
2.4. Divergence Time Estimation
2.5. Inferring Historical Biogeography
3. Results
3.1. Phylogenetic Analyses
3.2. Dating and Evolutionary Analyses of Akanthomyces s.l. in Cordycipitaceae
3.3. The Historical Biogeography of Akanthomyces s.l.
3.4. Taxonomy
3.4.1. Akanthomyces baishanensis sp. nov., Pu, H.L. and Qiu, J.Z., Figure 4c
3.4.2. Samsoniella sanmingense sp. nov., Pu, H.L. and Qiu, J.Z. Figure 5
3.4.3. Blackwellomyces lateris Xiao, Y.P.; Wen, T.C.; Hyde, K.D. Fungal Diversity 2019, 96, 1–242 [47]; Figure 6
3.4.4. Liangia sinensis, Yu, H.; Wang, Y.B.; Wang, Y.; Fan, Q.; Yang, Z.L. Fungal Diversity 2020, 103, 1–46 [2]; Figure 7
3.4.5. Niveomyces multisynnematus Tasanathai, Noisripoom and Kobmoo, Fungal Systematics and Evolution 2023, 12, 91–110 [7]; Figure 8
4. Discussion
4.1. Taxonomy and Phylogeny of Cordycipitaceae
4.2. Possible Origin of Akanthomyces Sensu Lato
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, G.H.; Hywel-Jones, N.L.; Sung, J.M.; Luangsa-Ard, J.J.; Shrestha, B.; Spatafora, J.W. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 2007, 57, 5–59. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.B.; Wang, Y.; Fan, Q.; Duan, D.E.; Zhang, G.D.; Dai, R.Q.; Dai, Y.C.; Zeng, W.B.; Chen, Z.H.; Li, D.; et al. Multigene phylogeny of the family Cordycipitaceae (Hypocreales): New taxa and the new systematic position of the Chinese cordycipitoid fungus Paecilomyces hepiali. Fungal Divers. 2020, 103, 1–46. [Google Scholar] [CrossRef]
- Dong, Q.Y.; Wang, Y.; Wang, Z.Q.; Tang, D.X.; Zhao, Z.Y.; Wu, H.J.; Yu, H. Morphology and phylogeny reveal five novel species in the genus Cordyceps (Cordycipitaceae, Hypocreales) from Yunnan, China. Front. Microbiol. 2022, 13, 846909. [Google Scholar] [CrossRef] [PubMed]
- Khonsanit, A.; Thanakitpipattana, D.; Mongkolsamrit, S.; Kobmoo, N.; Phosrithong, N.; Samson, R.A.; Crous, P.W.; Luangsa-ard, J.J. A phylogenetic assessment of Akanthomyces sensu lato in Cordycipitaceae (Hypocreales, Sordariomycetes): Introduction of new genera, and the resurrection of Lecanicillium. Fungal Syst. Evol. 2024, 14, 271–305. [Google Scholar] [CrossRef]
- Mongkolsamrit, S.; Sandargo, B.; Ebada, S.S.; Noisripoom, W.; Jaiyen, S.; Luangsa-ard, J.J.; Stadler, M. Bhushaniella gen. nov. (Cordycipitaceae) on spider eggs sac: A new genus from Thailand and its bioactive secondary metabolites. Mycol. Prog. 2023, 22, 64. [Google Scholar] [CrossRef]
- Mongkolsamrit, S.; Noisripoom, W.; Tasanathai, K.; Noppol Kobmoo, N.; Thanakitpipattana, D.; Khonsanit, A.; Petcharad, B.; Baramee Sakolrak, B.; Himaman, W. Comprehensive treatise of Hevansia and three new genera Jenniferia, Parahevansia and Polystromomyces on spiders in Cordycipitaceae from Thailand. MycoKeys 2022, 91, 113–149. [Google Scholar] [CrossRef]
- Kobmoo, N.; Tasanathai, K.; Araújo, J.P.M.; Noisripoom, W.; Thanakitpipattana, D.; Mongkolsamrit, S.; Himaman, W.; Houbraken, J.; Luangsa-ard, J.J. New mycoparasitic species in the genera Niveomyces and Pseudoniveomyces gen. nov. (Hypocreales: Cordycipitaceae), with sporothrix-like asexual morphs, from Thailand. Fungal Syst. Evol. 2023, 12, 91–110. [Google Scholar] [CrossRef]
- Kuephadungphan, W.; Petcharad, B.; Tasanathai, K.; Thanakitpipattana, D.; Kobmoo, N.; Khonsanit, A.; Samson, R.A.; Luangsa-ard, J.J. Multi–locus phylogeny unmasks hidden species within the specialised spider-parasitic fungus, Gibellula (Hypocreales, Cordycipitaceae) in Thailand. Stud. Mycol. 2022, 101, 245–286. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, Y.; Dong, Q.; Fan, Q.; Dao, V.M.; Yu, H. Morphological and phylogenetic characterization reveals five new species of Samsoniella (Cordycipitaceae, Hypocreales). J. Fungi 2022, 8, 747. [Google Scholar] [CrossRef]
- Ng, T.B.; Wang, H.X. Pharmacological actions of Cordyceps, a prized folk medicine. J. Pharm. Pharmacol. 2005, 57, 1509–1519. [Google Scholar] [CrossRef] [PubMed]
- Zha, L.S.; Huang, S.K.; Xiao, Y.P.; Boonmee, S.; Eungwanichayapant, P.D.; McKenzie, E.H.C.; Kryukov, V.Y.; Liang, W.X.; Hyde, K.D.; Wen, T.-C. An evaluation of common Cordyceps (Ascomycetes) species found in Chinese Markets. Int. J. Med. Mushrooms 2018, 20, 1149–1162. [Google Scholar] [CrossRef]
- Marsup, P.; Yeerong, K.; Neimkhum, W.; Sirithunyalug, J.; Anuchapreeda, S.; To-anun, C.; Chaiyana, W. Enhancement of chemical stability and dermal delivery of Cordyceps militaris extracts by nanoemulsion. Nanomaterials 2020, 10, 1565. [Google Scholar] [CrossRef]
- Zimmermann, G. Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Sci. Technol. 2007, 17, 553–596. [Google Scholar] [CrossRef]
- Rehner, S.A.; Minnis, A.M.; Sung, G.H.; Luangsa-ard, J.J.; Devotto, L.; Humber, R.A. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycol. 2011, 103, 1055–1073. [Google Scholar] [CrossRef] [PubMed]
- Mascarin, G.M.; Kobori, N.N.; Quintela, E.D.; Delalibera, I.J. The virulence of entomopathogenic fungi against Bemisia tabaci biotype B (Hemiptera: Aleyrodidae) and their conidial production using solid substrate fermentation. Biol. Control 2013, 66, 209–218. [Google Scholar] [CrossRef]
- Rojas, V.M.A.; Iwanicki, N.S.A.; Alessandro, C.P.; Fatoretto, M.B.; Demétrio, C.G.B.; Delalibera, I. Characterization of Brazilian Cordyceps fumosorosea isolates: Conidial production, tolerance to ultraviolet-B radiation, and elevated temperature. J. Invertebr. Pathol. 2023, 197, 107888. [Google Scholar] [CrossRef]
- Mongkolsamrit, S.; Noisripoom, W.; Thanakitpipattana, D.; Wutikhun, T.; Spatafora, J.W.; Luangsa-ard, J.J. Disentangling cryptic species with Isaria-like morphs in Cordycipitaceae. Mycologia 2018, 110, 230–257. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, Z.Q.; Luo, R.; Souvanhnachit, S.; Thanarut, C.; Dao, V.M.; Yu, H. Species diversity and major host/substrate associations of the genus Akanthomyces (Hypocreales, Cordycipitaceae). MycoKeys 2024, 101, 113–141. [Google Scholar] [CrossRef]
- Liang, Y.J.; Ariyawansa, H.A.; Becker, J.O.; Yang, J.I. The evaluation of egg-parasitic fungi Paraboeremia taiwanensis and Samsoniella sp. for the biological control of Meloidogyne enterolobii on Chinese cabbage. Microorganisms 2020, 8, 828. [Google Scholar] [CrossRef]
- Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y.; Liang, Z.Q. Cryptic diversity of Isaria-like species in Guizhou, China. Life 2021, 11, 1093. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y.; Liang, Z.Q. Species diversity of Cordyceps–like fungi in the Tiankeng karst region of China. Microbiol. Spectr. 2022, 5, e0197522. [Google Scholar] [CrossRef]
- Kepler, R.M.; Luangsa–ard, J.J.; Hywel–Jones, N.L.; Quandt, C.A.; Sung, G.H.; Rehner, S.A.; Aime, M.C.; Henkel, T.W.; Sanjuan, T.; Zare, R.; et al. A phylogenetically–based nomenclature for Cordycipitaceae (Hypocreales). IMA Fungus 2017, 8, 335–353. [Google Scholar] [CrossRef]
- Araújo, J.P.M.; Lebert, B.M.; Vermeulen, S.; Brachmann, A.; Ohm, R.A.; Evans, H.C.; de Bekker, C. Masters of the manipulator: Two new hypocrealean genera, Niveomyces (Cordycipitaceae) and Torrubiellomyces (Ophiocordycipitaceae), parasitic on the zombie ant fungus Ophiocordyceps camponoti-floridani. Persoonia 2022, 49, 171–194. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.B.; Yu, H.; Dai, Y.D.; Wu, C.K.; Zeng, W.B.; Yuan, F.; Liang, Z.Q. Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China. Mycol. Prog. 2015, 14, 70. [Google Scholar] [CrossRef]
- Vilgalys, R.; Hester, M. Rapid genetic identifcation and mapping of enzymatically amplifed ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
- Rehner, S.A.; Samuels, G.J. Taxonomy and phylogeny of gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol. Res. 1994, 98, 625–634. [Google Scholar] [CrossRef]
- Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef]
- Castlebury, L.; Rossman, A.; Sung, G.; Hyten, A.; Spatafora, J. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004, 108, 864–872. [Google Scholar] [CrossRef] [PubMed]
- Matheny, P.B.; Liu, Y.J.; Ammirati, J.F.; Hall, B.D. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J. Bot. 2002, 89, 688–698. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Mongkolsamrit, S.; Noisripoom, W.; Tasanathai, K.; Khonsanit, A.; Thanakitpipattana, D.; Himaman, W.; Kobmoo, N.; Luangsa-ard, J.J. Molecular phylogeny and morphology reveal cryptic species in Blackwellomyces and Cordyceps (Cordycipitaceae) from Thailand. Mycol. Prog. 2020, 19, 957–983. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Z.Q.; Thanarut, C.; Dao, V.M.; Wsng, Y.B.; Yu, H. Phylogeny and species delimitations in the economically, medically, and ecologically important genus Samsoniella (Cordycipitaceae, Hypocreales). MycoKeys 2023, 99, 227–250. [Google Scholar] [CrossRef] [PubMed]
- Chuang, W.Y.; Lin, Y.C.; Shrestha, B.; Luangsa-ard, J.J.; Stadler, M.; Tzean, S.S.; Wu, S.; Ko, C.C.; Hsieh, S.Y.; Wu, M.L.; et al. Phylogenetic diversity and morphological characterization of cordycipitaceous species in Taiwan. Stud. Mycol. 2024, 109, 6–61. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-Tree: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, W242–W245. [Google Scholar] [CrossRef]
- Sung, G.H.; Poinar, G.O.; Spatafora, J.W. The oldest fossil evidence of animal parasitism by fungi supports a Cretaceous diversification of fungal–arthropod symbioses. Mol. Phylogenet Evol. 2008, 49, 495–502. [Google Scholar] [CrossRef]
- Zhou, Y.M.; Zhi, J.R.; Qu, J.J.; Zou, X. Estimated divergence times of Lecanicillium in the family Cordycipitaceae provide insights into the attribution of Lecanicillium. Front. Microbiol. 2022, 13, 859886. [Google Scholar] [CrossRef] [PubMed]
- Drummond, A.J.; Ho, S.Y.W.; Phillips, M.J.; Rambaut, A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006, 4, e88. [Google Scholar] [CrossRef]
- Lepage, T.; Bryant, D.; Philippe, H. A general comparison of relaxed molecular clock models. Mol. Biol. Evol. 2007, 24, 2669–2680. [Google Scholar] [CrossRef]
- Gernhard, T. The conditioned reconstrued process. J. Theor. Biol. 2008, 253, 769–778. [Google Scholar] [CrossRef]
- Berbee, M.L.; Taylor, J.W. Dating the molecular clock in fungi–how close are we? Fungal Biol. Rev. 2010, 24, 1–16. [Google Scholar] [CrossRef]
- Xie, J.; Chen, Y.; Cai, G.; Cai, R.; Hu, Z.; Wang, H. Tree Visualization By One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef]
- Yu, Y.; Harris, A.J.; Blair, C.; He, X. RASP (Reconstruct Ancestral State in Phylogenies): A tool for historical biogeography. Mol. Phylogenet. Evol. 2015, 87, 46–49. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Blair, C.; He, X. RASP 4: Ancestral state reconstruction tool for multiple genes and characters. Mol. Biol. Evol. 2019, 37, 604–606. [Google Scholar] [CrossRef]
- Yu, Y.; Blair, C.; He, X.J. RASP 4: Ancestral State Reconstruction Tool for Multiple. Mol. Biol. Evol. 2020, 37, 604–606. [Google Scholar] [CrossRef] [PubMed]
- Hyde, K.D.; Tennakoon, D.S.; Jeewon, R.; Bhat, D.J.; Maharachchikumbura, S.S.N.; Rossi, W.; Leonardi, M.; Lee, H.B.; Mun, H.; Houbraken, J.; et al. Fungal diversity notes 1036–1150: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers. 2019, 96, 1–242. [Google Scholar] [CrossRef]
- Chen, W.H.; Han, Y.F.; Liang, J.D.; Tian, W.Y.; Liang, Z.Q. Morphological and phylogenetic characterisations reveal three new species of Samsoniella (Cordycipitaceae, Hypocreales) from Guizhou, China. MycoKeys 2020, 74, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.H.; Liang, J.D.; Ren, X.X.; Zhao, J.H.; Han, F.Y. Two new species of Samsoniella (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. MycoKeys 2023, 99, 209–226. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Zhu, M.; Keyhani, N.O.; Wu, Z.; Lv, H.; Heng, Z.; Chen, R.; Dang, Y.; Yang, C.; Chen, J.; et al. Three new species of Russulaceae (Russulales, Basidiomycota) from southern China. J. Fungi 2024, 10, 70. [Google Scholar] [CrossRef]
- Zhao, Z.; Mu, T.; Keyhani, N.O.; Pu, H.; Lin, Y.; Lv, Z.; Xiong, J.; Chen, X.; Zhan, X.; Lv, H.; et al. Diversity and new species of Ascomycota from Bamboo in China. J. Fungi 2024, 10, 454. [Google Scholar] [CrossRef]
- Zhang, X.; Fu, Z.; Lu, F.; Song, J.; Zhao, C. Morphological characteristics and phylogenetic analyses revealed a new invertebrate-pathogenic fungus Akanthomyces bannaensis (Cordycipitaceae, Ascomycota), in China. Phytotaxa 2024, 666, 26. [Google Scholar] [CrossRef]
- Zhu, G.; Chen, Y.; Wu, W.; Liu, R.; Tang, Y.; Li, P.; Xu, A. Coupling relationships between urban block spatial morphology and microclimate in severe cold regions. iScience 2023, 26, 108313. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Liu, X.; Tao, M.; Liu, X.; Xia, J.; Zhang, X.; Meng, Z. Taxonomy, phylogeny, divergence time estimation, and biogeography of the family Pseudoplagiostomataceae (Ascomycota, Diaporthales). J. Fungi 2023, 9, 82. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Liu, H.G.; Papp, V.; Zhou, M.; Dai, Y.; Yuan, Y. New insights into the classification and evolution of Favolaschia (Agaricales, Basidiomycota) and its potential distribution, with descriptions of eight new species. Mycosphere 2023, 14, 777–814. [Google Scholar] [CrossRef]
- Mu, T.; Lin, Y.; Pu, H.; Keyhani, N.O.; Danga, Y.; Lv, H.; Zhao, Z.; Heng, Z.; Wu, Z.; Xiong, C.; et al. Molecular phylogenetic and estimation of evolutionary divergence and biogeography of the family Schizoparmaceae and allied families (Diaporthales, Ascomycota). Mol. Phylogenet Evol. 2024, 201, 108211. [Google Scholar] [CrossRef]
- Schulte, P.; Alegret, L.; Arenillas, I.; Arz, J.A.; Barton, P.J.; Bown, P.R.; Bralower, T.J.; Christeson, G.L.; Claeys, P.; Cockell, C.S. The Chicxulub asteroid impact and mass extinction at the Cretaceous–Paleogene boundary. Science 2010, 327, 1214–1218. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.J.; Cui, B.K.; Zhou, L.W.; Korhonen, K.; Dai, Y.C. Phylogeny, divergence time estimation, and biogeography of the genus Heterobasidion (Basidiomycota, Russulales). Fungal Divers. 2015, 71, 185–200. [Google Scholar] [CrossRef]
- Qiu, Y.X.; Fu, C.X.; Comes, H.P. Plant molecular phylogeography in China and adjacent regions: Tracing the genetic imprints of Quaternary climate and environmental change in the world’s most diverse temperate flora. Mol. Phylogenet. Evol. 2011, 59, 225–244. [Google Scholar] [CrossRef] [PubMed]
- Feng, B.; Xu, J.; Wu, G.; Hosen, M.I.; Zeng, N.K.; Li, Y.C.; Tolgor, B.; Kost, G.W.; Yang, Z.L. DNA sequence analyses reveal abundant diversity, endemism and evidence for Asian origin of the Porcini mushrooms. PLoS ONE 2012, 7, e37567. [Google Scholar] [CrossRef]
- Golan, J.J.; Pringle, A. Long–distance dispersal of fungi. Microbiol. Spectr. 2017, 5, 1–24. [Google Scholar] [CrossRef] [PubMed]
Gene | Primers | Sequence (5′-3′) | Annealing Temperature | References |
---|---|---|---|---|
SSU | nrSSU-CoF | TCTCAAAGATTAAGCCATGC | 55 °C | [24] |
nrSSU-CoR | TCACCAACGGAGACCTTG | |||
LSU | LR0R | GTACCCGCTGAACTTAAGC | 52 °C | [25,26] |
LR5 | TCCTGAGGGAAACTTCG | |||
tef-1α | EF1α-EF | GCTCCYGGHCAYCGTGAYTTYAT | 60 °C | [27] |
EF1α-ER | ATGACACCRACRGCRACRGTYTG | |||
rpb1 | RPB1-Ac | CAYCCWGGYTTYATCAAGAA | From 57 °C to 72 °C at 0.2 °C/s | [28,29] |
RPB1-Cr | CCNGCDATNTCRTTRTCCATRTA | |||
rpb2 | fRPB2-5F | GAYGAYMGWGATCAYTTYGG | 56 °C | [30] |
fRPB2-7cR | CCCATRGCTTGTYYRCCCAT |
Species | Strain No. | Host/Substrate | GenBank Accession Numbers | ||||
---|---|---|---|---|---|---|---|
SSU | LSU | tef-1α | rpb1 | rpb2 | |||
Akanthomyces aculeatus | HUA 186145 | Lepidoptera | MF416572 | MF416520 | MF416465 | - | - |
Akanthomyces baishanensis | CGMCC3.25673 | Lepidoptera; Noctuidae | PP177381 | PP179404 | PP464678 | PP464641 | PP464655 |
Akanthomyces baishanensis | CGMCC3.25674 | Lepidoptera; Noctuidae | PP177382 | PP179405 | PP464679 | PP464642 | PP464656 |
Akanthomyces bannaensis | CL Zhao 34016 | Lepidoptera; Dudusa sphingiformis | - | PP571897 | - | - | PP588774 |
Akanthomyces buriramensis | BCC 45158 | Lepidoptera; Noctuidae | - | ON008543 | ON013546 | ON013561 | - |
Akanthomyces buriramensis | BCC 45166 | Lepidoptera; Noctuidae | - | ON008544 | ON013547 | ON013562 | - |
Akanthomyces buriramensis | BCC 47939 | Lepidoptera; Noctuidae | - | ON008545 | ON013548 | ON013563 | - |
Akanthomyces fusiformis | BCC 40756 | Lepidoptera; Pyralidae | - | ON008549 | ON013552 | ON013567 | ON013576 |
Akanthomyces laosensis | YFCC 1910941 | Lepidoptera; Noctuidae | - | OQ509510 | OQ506286 | OQ511535 | OQ511549 |
Akanthomyces laosensis | YFCC 1910942 | Lepidoptera; Noctuidae | - | OQ509511 | OQ506287 | OQ511536 | OQ511550 |
Akanthomyces niveus | BCC 40747 | Lepidoptera | - | ON008550 | ON013553 | ON013568 | ON013577 |
Akanthomyces niveus | BCC 79887 | Lepidoptera | - | ON008551 | ON013554 | - | ON013578 |
Akanthomyces noctuidarum | BCC36265 | Lepidoptera; Noctuidae | - | MT356084 | MT477978 | MT477994 | MT477987 |
Akanthomyces noctuidarum | BCC47498 | Lepidoptera; Noctuidae | - | MT356086 | MT477980 | MT477996 | MT477988 |
Akanthomyces phariformis | BCC 45148 | Lepidoptera; Erebidae | - | ON008556 | ON013559 | - | ON013583 |
Akanthomyces phariformis | BCC 76537 | Lepidoptera; Noctuidae | - | ON008557 | ON013560 | - | ON013584 |
Akanthomyces pseudonoctuidarum | YFCC 1808943 | Lepidoptera; Noctuidae | OQ509512 | OQ506288 | OQ511537 | OQ511551 | |
Akanthomyces pseudonoctuidarum | YFCC 1808944 | Lepidoptera; Noctuidae | OQ509513 | OQ506289 | OQ511538 | OQ511552 | |
Akanthomyces pyralidarum | BCC28816 | Lepidoptera; Pyralidac | - | MT356091 | MT477982 | MT478000 | MT478007 |
Akanthomyces pyralidarum | BCC32191 | Lepidoptera; Pyralidac | - | MT356092 | MT477983 | MT478001 | MT477989 |
Akanthomyces taiwanicus | NTUPPMCC 20-060 | Lepidoptera (Agrius convolvuli) | - | MT974356 | MW200213 | MW200221 | MW200230 |
Akanthomyces taiwanicus | NTUPPMCC 20-060-1 | Lepidoptera (Agrius convolvuli) | - | PP190926 | - | - | - |
Akanthomyces tortricidarum | BCC41868 | Lepidoptera; Tortricidae | - | MT356089 | MT477985 | MT477998 | MT478008 |
Akanthomyces tortricidarum | BCC72638 | Lepidoptera; Tortricidae | - | MT356088 | MT478004 | MT477997 | MT477992 |
Akanthomyces tuberculatus | OSC 111002 | Lepidoptera | DQ522553 | DQ518767 | DQ522338 | - | DQ522435 |
Akanthomyces xixiuensis | HKAS 125851 | Lepidoptera | OP693479 | OP693481 | OP838888 | OP838890 | OP838892 |
Akanthomyces xixiuensis | XX21081764 | Lepidoptera | OP693478 | OP693480 | OP838887 | OP838889 | OP838891 |
Arachnidicola araneicola | GY29011 | Araneae; spider | - | - | MK955950 | MK955944 | MK955947 |
Arachnidicola araneicola | GY29012 | Araneae; spider | - | - | MK955951 | MK955945 | MK955948 |
Arachnidicola araneogenus | GZUIFDX1 | Araneus sp. | - | - | - | MH978181 | MH978184 |
Arachnidicola araneogenus | GZUIFSN1 | Araneus sp. | - | - | MH978188 | MH978183 | MH978186 |
Arachnidicola bashanensis | CQ05621 | Araneae; spider | - | OQ300420 | OQ325024 | - | OQ349684 |
Arachnidicola bashanensis | CQ05622 | Araneae; spider | - | OQ300421 | OQ325025 | - | OQ349685 |
Arachnidicola beibeiensis | CQ05921 | Araneae; spider | - | OQ300424 | OQ325028 | - | OQ349688 |
Arachnidicola beibeiensis | CQ05922 | Araneae; spider | - | OQ300427 | OQ325029 | - | OQ349689 |
Arachnidicola kanyawimiae | NHJ 6709 | Araneae; spider | EU369110 | EU369042 | EU369025 | EU369067 | EU369086 |
Arachnidicola kanyawimiae | TBRC 7242 | Araneae; spider | - | MF140718 | MF140838 | MF140784 | MF140808 |
Arachnidicola kanyawimiae | TBRC 7243 | On unidentified insect | - | MF140717 | MF140837 | MF140783 | MF140807 |
Arachnidicola kanyawimiae | TBRC 7244 | Araneae; spider | - | MF140716 | MF140836 | - | - |
Arachnidicola kunmingensis | YFCC 1708939 | Araneae; spider | - | OQ509508 | OQ506284 | OQ511533 | OQ511547 |
Arachnidicola kunmingensis | YFCC 1808940 | Araneae; spider | - | OQ509509 | OQ506285 | OQ511534 | OQ511548 |
Arachnidicola subaraneicola | YFCC 2107937 | Araneae; spider | - | OQ509514 | OQ506290 | OQ511539 | OQ511553 |
Arachnidicola subaraneicola | YFCC 2107938 | Araneae; spider | - | OQ509515 | OQ506291 | OQ511540 | OQ511554 |
Arachnidicola sulphureus | TBRC 7248 | Araneae; spider | - | MF140722 | MF140843 | MF140787 | MF140812 |
Arachnidicola sulphureus | TBRC 7249 | Araneae; spider | - | MF140721 | MF140842 | MF140786 | MF140734 |
Arachnidicola thailandica | TBRC 7245 | Araneae; spider | - | - | MF140839 | - | MF140809 |
Arachnidicola thailandica | TBRC 7246 | Araneae; spider | - | MF140719 | MF140840 | - | MF140810 |
Arachnidicola tiankengensis | KY11571 | Araneae; spider | - | ON502825 | ON525447 | - | ON525446 |
Arachnidicola tiankengensis | KY11572 | Araneae; spider | - | ON502827 | ON525449 | - | ON525448 |
Arachnidicola waltergamsii | TBRC 7251 | Araneae; spider | - | MF140713 | MF140833 | MF140781 | MF140805 |
Arachnidicola waltergamsii | TBRC 7252 | Araneae; spider | - | MF140714 | MF140834 | MF140782 | MF140806 |
Ascopolyporus polychrous | P.C. 546 | Hemiptera | - | DQ118737 | DQ118745 | DQ127236 | - |
Ascopolyporus villosus | ARSEF 6355 | Hemiptera | - | AY886544 | DQ118750 | DQ127241 | - |
Beauveria acridophila | HUA 179219 | Orthoptera; Acrididae | - | JQ895541 | JQ958613 | JX003857 | JX003841 |
Beauveria acridophila | HUA 179220 | Orthoptera; Acrididae | JQ895527 | JQ895536 | JQ958614 | JX003852 | JX003842 |
Beauveria amorpha | ARSEF 2641 | Hymenoptera; Formicidae | - | AB100039 | AY531917 | HQ880880 | HQ880952 |
Beauveria baoshanensis | CCTCC AF2018011 | Coleoptera; Chrysomelidae | MG642882 | MG642840 | MG642897 | MG642854 | MG642867 |
Beauveria bassiana | ARSEF 1564 | Lepidoptera; Arctiidae | EU334676 | - | HQ880974 | HQ880833 | HQ880905 |
Beauveria bassiana | YFCC 3369 | Coleoptera; Scarabaeidae | MN576768 | MN576824 | MN576994 | MN576884 | MN576938 |
Beauveria blattidicola | MCA 1727 | Blattodea; Blattidae | MF416593 | MF416539 | MF416483 | MF416640 | - |
Beauveria brongniartii | ARSEF 617 | Coleoptera; Scarabaeidae | AB027335 | AB027381 | HQ880991 | HQ880854 | HQ880926 |
Beauveria brongniartii | YFCC 3240 | Coleoptera; Scarabaeidae | MN576769 | MN576825 | MN576995 | MN576885 | MN576939 |
Bhushaniella rubra | BCC 47541 | Spider eggs in sac | - | OQ892133 | OQ914428 | OQ914431 | OQ914433 |
Bhushaniella rubra | BCC 47542 | Spider eggs in sac | - | OQ892134 | OQ914429 | OQ914432 | OQ914434 |
Blackwellomyces aurantiacus | BCC 85060 | Lepidoptera (larva) | - | MT003028 | MT017840 | MT017800 | MT017819 |
Blackwellomyces aurantiacus | BCC 85061 | Lepidoptera (larva) | - | MT003029 | MT017841 | MT017801 | MT017820 |
Blackwellomyces calendulinus | BCC 68500 | Coleoptera (larva) | - | MT003030 | MT017842 | MT017802 | MT017821 |
Blackwellomyces calendulinus | BCC 68502 | Coleoptera (larva) | - | MT003031 | MT017843 | MT017803 | MT017822 |
Blackwellomyces cardinalis | OSC 93609 | Lepidoptera; Tineidae | AY184973 | AY184962 | DQ522325 | DQ522370 | DQ522422 |
Blackwellomyces cardinalis | OSC 93610 | Lepidoptera; Tineidae | AY184974 | AY184963 | EF469059 | EF469088 | EF469106 |
Blackwellomyces kaihuaensis | HMAS 285455 | Lepidoptera (larva) | OQ981975 | OQ981968 | OQ980401 | OQ980409 | OQ980408 |
Blackwellomyces kaihuaensis | HMAS 285456 | Lepidoptera (larva) | OQ981976 | OQ981969 | OQ980402 | OQ980410 | - |
Blackwellomyces lateris | MFLU 18-0663 | Coleoptera (larva) | NG_067678 | MK086061 | MK069471 | MK084615 | MK079354 |
Blackwellomyces lateris | HMAS 352953 | Lepidoptera (larva) | PP554483 | PP554184 | PP556330 | PP556331 | PP556332 |
Blackwellomyces minutus | BCC 88269 | Coleoptera (larva) | - | MT003032 | MT017844 | MT017804 | MT017823 |
Blackwellomyces pseudomilitaris | BCC 1919 | Lepidoptera (larva) | MF416588 | MF416534 | MF416478 | - | MF416440 |
Blackwellomyces pseudomilitaris | BCC 2091 | Lepidoptera (larva) | MF416589 | MF416535 | MF416479 | - | MF416441 |
Blackwellomyces roseostromatus | BCC 91358 | Lepidoptera (larva) | - | MT003033 | MT017845 | MT017805 | MT017824 |
Blackwellomyces roseostromatus | BCC 91360 | Lepidoptera (larva) | - | MT003035 | MT017847 | MT017807 | MT017826 |
Blackwellomyces taiwanensis | NTUPPMCC 20-068 | Coleoptera (larva) | - | MT974411 | - | - | MW200251 |
Blackwellomyces taiwanensis | NTUPPMCC 20-071 | Coleoptera (larva) | - | MT974409 | MW200242 | MW200246 | MW200250 |
Cordyceps bifusispora | EFCC 5690 | Lepidoptera (pupa) | EF468952 | EF468806 | EF468746 | EF468854 | EF468909 |
Cordyceps bifusispora | EFCC 8260 | - | EF468953 | EF468807 | EF468747 | EF468855 | EF468910 |
Cordyceps coleopterorum | CBS 110.73 | Coleoptera (larva) | JF415965 | JF415988 | JF416028 | JN049903 | JF416006 |
Cordyceps koratensis | NHJ 2662 | Lepidoptera | - | GQ249982 | GQ250032 | ON470206 | ON470208 |
Cordyceps koratensis | NHJ 666.01 | Arachnida | - | GQ249981 | GQ250031 | - | - |
Cordyceps militaris | ARSEF 5050 | Lepidoptera | - | - | HQ881020 | HQ880901 | HQ880973 |
Cordyceps militaris | OSC 93623 | Lepidoptera (pupa) | AY184977 | AY184966 | DQ522332 | DQ522377 | AY545732 |
Cordyceps nabanheensis | YFCC 8409 | Lepidoptera (larva) | OL468564 | OL468584 | OL473532 | OL739578 | OL473543 |
Cordyceps nabanheensis | YFCC 8410 | Lepidoptera (larva) | OL468565 | OL468585 | OL473533 | OL739579 | OL473544 |
Cordyceps tenuipes | ARSEF 5135 | Lepidoptera (pupa) | MF416612 | JF415980 | JF416020 | JN049896 | JF416000 |
Corniculantispora aphanocladii | CBS 797.84 | Agaricus bisporus | KM283763 | KM283787 | KM283811 | KM283833 | KM283853 |
Corniculantispora psalliotae | CBS 101270 | Soil | AF339607 | EF469081 | EF469066 | EF469095 | EF469113 |
Corniculantispora psalliotae | CBS 532.81 | Soil | AF339609 | AF339560 | EF469067 | EF469096 | EF469112 |
Engyodontium parvisporum | IHEM 22910 | Human bronchoscopy specimen | - | LC092915 | LC425558 | - | - |
Engyodontium rectidentatum | CBS 206.74 | Air | - | LC092912 | LC425553 | - | - |
Engyodontium rectidentatum | CBS 641.74 | Buried keratinous substance | - | LC092914 | LC425540 | - | - |
Flavocillium bifurcatum | YFCC 6101 | Lepidoptera; Noctuidae | - | MN576781 | MN576951 | MN576841 | MN576897 |
Gamszarea humicola | CGMCC3.19303 | Soil | MK311231 | MK328997 | MK336027 | - | MK335979 |
Gamszarea wallacei | CBS 101237 | Lepidoptera | AY184978 | AY184967 | EF469073 | EF469102 | EF469119 |
Gibellula leiopus | BCC16025 | Araneae | MF416602 | MF416548 | MF416492 | MF416649 | - |
Gibellula longispora | NHJ 12014 | Araneae | EU369098 | - | EU369017 | EU369055 | EU369075 |
Gibellula pulchra | NHJ 10808 | Araneae | EU369099 | EU369035 | EU369018 | EU369056 | EU369076 |
Hevansia minuta | BCC 47519 | Araneae, Meotipa sp. | - | MZ684002 | MZ707811 | MZ707826 | MZ707833 |
Hevansia novoguineensis | CBS 610.80 | Araneae | - | MH394646 | MH521885 | - | MH521844 |
Hevansia novoguineensis | NHJ 11923 | Araneae | EU369095 | EU369032 | EU369013 | EU369052 | EU369072 |
Hevansia novoguineensis | NHJ 13161 | Araneae | EU369093 | - | EU369011 | EU369050 | - |
Jenniferia cinerea | NHJ 03510 | Araneae, Amyciaea sp. | EU369091 | GQ249970 | EU369009 | EU369048 | EU369070 |
Jenniferia thomisidarum | BCC 37881 | Araneae, Diaea cf. dorsata | - | MZ684010 | MZ707823 | MZ707830 | MZ707843 |
Jenniferia thomisidarum | BCC 37882 | Araneae, Diaea cf. dorsata | - | MZ684011 | MZ707824 | MZ707831 | MZ707844 |
Kanoksria zaquensis | HMAS 246915 | Ophiocordyceps sinensis | MT789701 | MT789697 | MT797812 | MT797810 | - |
Kanoksria zaquensis | HMAS 246917 | Ophiocordyceps sinensis | MT789700 | MT789696 | MT797811 | MT797809 | - |
Lecanicillium aranearum | CBS 726.73a | Arachnida | AF339586 | AF339537 | EF468781 | EF468887 | EF468934 |
Lecanicillium araneogenum | GZU1031Lea | Araneae; spider | KX845705 | - | KX845697 | KX845699 | KY845701 |
Lecanicillium araneosum | KY11341 | Araneae; spider | - | ON502832 | ON525443 | - | ON525442 |
Lecanicillium araneosum | KY11342 | Araneae; spider | - | ON502837 | ON525445 | - | ON525444 |
Lecanicillium attenuatum | CBS 402.78 | Leaf litter (Acer saccharum) | AF339614 | AF339565 | EF468782 | EF468888 | EF468935 |
Lecanicillium attenuatum | CBS 170.76 | Lepidoptera; Carpocapsa | OP752153 | OP762607 | OP762611 | OP762615 | |
Lecanicillium attenuatum | KACC 42493 | - | KM283756 | KM283780 | KM283804 | KM283826 | KM283846 |
Lecanicillium fusisporum | CBS 164.70 | Coltricia perennis | AF339598 | AF339549 | EF468783 | EF468889 | — |
Lecanicillium lecanii | CBS 101247 | Hemiptera; Coccidae | AF339604 | AF339555 | DQ522359 | DQ522407 | DQ522466 |
Lecanicillium lepidopterorum | GZAC SD05151 | Lepidoptera (pupa) | - | - | - | - | MT727044 |
Lecanicillium longisporum | CBS 102072 | Macrosiphoniella sanborni (Hemiptera) | KM283772 | KM283796 | KM283819 | KM283839 | KM283861 |
Lecanicillium longisporum | CBS 126.27 | Hemiptera; Monophlebidae | KM283773 | KM283797 | KM283820 | KM283840 | KM283862 |
Lecanicillium muscarium | CBS 143.62 | Hemiptera; Aleyrodidae | KM283774 | KM283798 | KM283821 | KM283841 | KM283863 |
Lecanicillium neocoleopterorum | GY11242 | Coleoptera; ladybug | - | - | MN097815 | MN097817 | MN097814 |
Lecanicillium neocoleopterorum | GY11241 | Coleoptera; ladybug | - | - | MN097813 | MN097816 | MN097812 |
Lecanicillium pissodis | BBC7 | Heteroptera (Corythucha arcuata) | MT004819 | MT004835 | MT027503 | MT027506 | MT027509 |
Lecanicillium pissodis | CBS 118231 | Pissodes strobi adult | KM283775 | KM283799 | KM283822 | KM283842 | KM283864 |
Lecanicillium sabanense | ANDES-F 1024 | Hemiptera; Coccidae | KC633251 | KC875225 | KC633266 | - | KC633249 |
Lecanicillium uredinophilum | CEP 054 | Hemiptera (Trialeurodes vaporariorum) | - | OP752150 | MH062184 | OP762608 | OP762612 |
Lecanicillium uredinophilum | CEP 057 | Hemiptera (Trialeurodes vaporariorum) | - | OP752151 | MH062186 | OP762609 | OP762613 |
Lecanicillium uredinophilum | CEP 108 | Hemiptera (Myzus persicae) | - | OP752152 | MH062188 | OP762610 | OP762614 |
Liangia sinensis | YFCC3103 | Fungi | MN576726 | MN576782 | MN576952 | MN576842 | MN576898 |
Liangia sinensis | YFCC3104 | Fungi | MN576727 | MN576783 | MN576953 | MN576843 | MN576899 |
Liangia sinensis | CGMCC3.25667 | Ophiocordycepsglobiceps on Diptera | PP177399 | PP179398 | PP464672 | PP464635 | PP482036 |
Liangia sinensis | CGMCC3.25668 | Ophiocordycepsglobiceps on Diptera | PP177400 | PP179399 | PP464673 | PP464636 | PP482037 |
Neohyperdermium piperis | CBS 116719 | Hemiptera | - | AY466442 | DQ118749 | DQ127240 | EU369083 |
Neohyperdermium pulvinatum | P.C. 602 | Hemiptera | - | DQ118738 | DQ118746 | DQ127237 | - |
Neotorrubiella chinghridicola | BCC 39684 | Orthopterida | - | MK632096 | MK632071 | MK632181 | MK632148 |
Neotorrubiella chinghridicola | BCC 80733 | Orthopterida | - | MK632097 | MK632072 | MK632176 | MK632149 |
Niveomyces albus | BCC 74477 | Ophiocordyceps sp. on Arachnida (Araneae) | - | ON103158 | ON125016 | ON286877 | ON125028 |
Niveomyces albus | BCC 83025 | Ophiocordyceps sp. on Diptera | - | ON103157 | ON125015 | ON286876 | ON125027 |
Niveomyces coronatus | NY 04434800 | Ophiocordyceps camponoti-floridani | ON493547 | ON493606 | ON513397 | ON513399 | ON513400 |
Niveomyces formicidarum | BCC 79346 | Ophiocordyceps sp. on Hymenoptera | - | ON103160 | ON125018 | ON286878 | ON125030 |
Niveomyces formicidarum | BCC 83026 | Ophiocordyceps sp. on Hymenoptera | - | ON103161 | ON125019 | ON286879 | - |
Niveomyces hirsutellae | BCC 36631 | Ophiocordyceps sp. on Hemiptera | - | ON103164 | ON125022 | ON286882 | ON125033 |
Niveomyces hirsutellae | BCC 36632 | Ophiocordyceps sp. on Hemiptera | - | ON103165 | ON125023 | ON286883 | ON125034 |
Niveomyces hirsutellae | BCC 78482 | Ophiocordyceps sp. on Hemiptera | - | ON103166 | ON125024 | ON286884 | ON125035 |
Niveomyces insectorum | CBS 756.73 | Palthothyreus tarsatus in Rubiaceae, associated with Gibellula formicarum | - | ON103169 | ON125026 | ON286887 | ON125038 |
Niveomyces multisynnematus | BCC 90307 | Ophiocordyceps sp. on Hemiptera | - | ON103162 | ON125020 | ON286880 | ON125031 |
Niveomyces multisynnematus | BCC 90308 | Ophiocordyceps sp. on Hemiptera | - | ON103163 | ON125021 | ON286881 | ON125032 |
Niveomyces multisynnematus | CGMCC3.25670 | Ophiocordyceps sp. on Diptera | PP177379 | PP179401 | PP464674 | PP464637 | PP464651 |
Niveomyces multisynnematus | CGMCC3.25672 | Ophiocordyceps sp. on Diptera | PP177380 | PP179403 | PP464675 | PP464638 | PP464652 |
Parengyodontium album | CBS 368.72 | Soil | - | LC092910 | LC382183 | - | - |
Parengyodontium album | CBS 504.83 | Human brain abscess | - | LC092899 | LC382177 | - | - |
Pleurodesmospora lepidopterorum | DY 10501 | Lepidoptera | - | - | MW834317 | MW834315 | MW834316 |
Pleurodesmospora lepidopterorum | DY 10502 | Lepidoptera | - | - | MW834319 | - | MW834318 |
Polystromomyces araneae | BCC 93301 | Arachnida | - | MZ684016 | MZ707825 | MZ707832 | MZ707845 |
Pseudogibellula formicarum | BCC 84257 | Ophiocordyceps flavida | - | MT512653 | MT533480 | MT533473 | - |
Pseudogibellula formicarum | CBS 433.73 | Palthothyreus tarsatus | - | MH872442 | MT533481 | MT533475 | - |
Pseudoniveomyces blattae | BCC 53567 | Blattodea | - | ON103167 | - | ON286885 | ON125036 |
Pseudoniveomyces blattae | BCC 53568 | Blattodea | - | ON103168 | ON125025 | ON286886 | ON125037 |
Samsoniella alboaurantium | CBS 240.32 | Lepidoptera (pupa) | JF415958 | JF415979 | JF416019 | JN049895 | JF415999 |
Samsoniella alboaurantium | CBS 262.58 | Soil | AB080087 | MH869308 | MF416497 | MF416654 | MF416448 |
Samsoniella alpina | YFCC 5818 | Hepialidae (Hepialus baimaensis) | MN576753 | MN576809 | MN576979 | MN576869 | MN576923 |
Samsoniella alpina | YFCC 5831 | Hepialidae (Hepialus baimaensis) | MN576754 | MN576810 | MN576980 | MN576870 | MN576924 |
Samsoniella anhuiensis | RCEF2590 | Araneae; spider | OR978313 | OR978316 | OR966516 | OR989964 | - |
Samsoniella anhuiensis | RCEF2830 | Araneae; spider | OM268843 | OM268848 | OM483864 | OM751889 | - |
Samsoniella antleroides | YFCC 6016 | Noctuidae (larvae) | MN576747 | MN576803 | MN576973 | MN576863 | MN576917 |
Samsoniella antleroides | YFCC 6113 | Noctuidae (larvae) | MN576748 | MN576804 | MN576974 | MN576864 | MN576918 |
Samsoniella aranea | RCEF2831 | Araneae; spider | OM268844 | OM268849 | OM483865 | OM751882 | OM802500 |
Samsoniella aranea | RCEF2868 | Araneae; spider | OM268845 | OM268850 | OM483866 | OM751883 | OM802501 |
Samsoniella aranea | RCEF2870 | Araneae; spider | OR978314 | OR978317 | OR966517 | OR989965 | OR989966 |
Samsoniella aurantia | TBRC 7271 | Lepidoptera | - | MF140728 | MF140846 | MF140791 | MF140818 |
Samsoniella aurantia | TBRC 7273 | Lepidoptera | - | MF140726 | MF140844 | - | MF140816 |
Samsoniella cardinalis | YFCC 5830 | Limacodidae (pupa) | MN576732 | MN576788 | MN576958 | MN576848 | MN576902 |
Samsoniella cardinalis | YFCC 6144 | Limacodidae (pupa) | MN576730 | MN576786 | MN576956 | MN576846 | MN576900 |
Samsoniella cardinalis | YFCC 6320 | Limacodidae (pupa) | MN576731 | MN576787 | MN576957 | MN576847 | MN576901 |
Samsoniella coccinellidicola | YFCC 8772 | Coccinellidae | ON563166 | ON621670 | ON676514 | ON676502 | ON568685 |
Samsoniella coccinellidicola | YFCC 8773 | Coccinellidae | ON563167 | ON621671 | ON676515 | ON676503 | ON568686 |
Samsoniella coleopterorum | A19501 | Curculionidae (Snout beetle) | - | - | MN101586 | MT642600 | MN101585 |
Samsoniella coleopterorum | GY407201 | Lepidoptera (larvae) | - | MZ827010 | MZ855233 | - | MZ855239 |
Samsoniella cristata | YFCC 6023 | Saturniidae (pupa) | MN576736 | MN576792 | MN576962 | MN576852 | MN576906 |
Samsoniella cristata | YFCC 7004 | Saturniidae (pupa) | MN576737 | MN576793 | MN576963 | MN576853 | MN576907 |
Samsoniella duyunensis | DY07501 | Formicidae (Ant) | - | OR263307 | OR282780 | OR282773 | OR282776 |
Samsoniella duyunensis | DY09161 | Lepidoptera (pupa) | - | OQ363112 | OQ398145 | OR296698 | OQ397660 |
Samsoniella erucae | KY11121 | Lepidoptera (Caterpillar) | - | ON502835 | ON525425 | - | ON525424 |
Samsoniella erucae | KY11122 | Lepidoptera (Caterpillar) | - | ON502822 | ON525427 | - | ON525426 |
Samsoniella farinospora | YFCC 8774 | Araneae; spider | ON563168 | ON621672 | ON676516 | ON676504 | ON568687 |
Samsoniella farinospora | YFCC 9051 | Lepidoptera; Hepialus | ON563169 | ON621673 | ON676517 | ON676505 | ON568688 |
Samsoniella fusiformispora | RCEF5406 | Araneae; spider | OM268846 | OM268851 | OM483867 | OM751890 | - |
Samsoniella haniana | YFCC 8769 | Lepidoptera (pupa) | ON563170 | ON621674 | ON676518 | ON676506 | ON568689 |
Samsoniella haniana | YFCC 8770 | Lepidoptera (pupa) | ON563171 | ON621675 | ON676519 | ON676507 | ON568690 |
Samsoniella hepiali | Cor-4 | Fungi (Ophiocordyceps sinensis) | MN576743 | MN576799 | MN576969 | MN576859 | MN576913 |
Samsoniella hepiali | ICMM 82-2 | Fungi (Ophiocordyceps sinensis) | MN576738 | MN576794 | MN576964 | MN576854 | MN576908 |
Samsoniella hepiali | YFCC 7024 | Lepidoptera | MN576741 | MN576797 | MN576967 | MN576857 | MN576911 |
Samsoniella hymenopterorum | A19521 | Vespidae (Bee) | - | - | MN101588 | MT642601 | MT642604 |
Samsoniella hymenopterorum | A19522 | Vespidae (Bee) | - | - | MN101591 | MN101589 | MN101590 |
Samsoniella inthanonensis | TBRC 7915 | Lepidoptera (pupa) | - | MF140725 | MF140849 | MF140790 | MF140815 |
Samsoniella kunmingensis | YHH 16002 | Lepidoptera (pupa) | MN576746 | MN576802 | MN576972 | MN576862 | MN576916 |
Samsoniella lanmaoa | YFCC 6148 | Lepidoptera (pupa) | MN576733 | MN576789 | MN576959 | MN576849 | MN576903 |
Samsoniella lanmaoa | YFCC 6193 | Lepidoptera (pupa) | MN576734 | MN576790 | MN576960 | MN576850 | MN576904 |
Samsoniella lasiocampidarum | NTUPPMCC 20-061 | Lepidoptera (larva) | - | MT974364 | MW200220 | MW200229 | - |
Samsoniella lasiocampidarum | NTUPPMCC 20-062 | Lepidoptera (larva) | - | MT974361 | MW200218 | MW200227 | MW200236 |
Samsoniella neopupicola | KY11321 | Lepidoptera (pupa) | - | ON502839 | ON525433 | - | ON525432 |
Samsoniella neopupicola | KY11322 | Lepidoptera (pupa) | - | ON502833 | ON525435 | - | ON525434 |
Samsoniella pseudotortricidae | YFCC 9052 | Lepidoptera (pupa) | ON563173 | ON621677 | ON676521 | ON676509 | ON568692 |
Samsoniella pseudotortricidae | YFCC 9053 | Lepidoptera (pupa) | ON563174 | ON621678 | ON676522 | ON676510 | ON568693 |
Samsoniella pupicola | DY101681 | Lepidoptera (pupa) | - | MZ827009 | MZ855231 | - | MZ855237 |
Samsoniella pupicola | DY101682 | Lepidoptera (pupa) | - | MZ827635 | MZ855232 | - | MZ855238 |
Samsoniella ramosa | YFCC 6020 | Lepidoptera (pupa) | MN576749 | MN576805 | MN576975 | MN576865 | MN576919 |
Samsoniella sanmingense | CGMCC3.25661 | Lepidoptera (larva) | PP177395 | PP179392 | PP482033 | PP464664 | PP464647 |
Samsoniella sanmingense | CGMCC3.25662 | Lepidoptera (larva) | PP177396 | PP179393 | PP482034 | PP464665 | PP464648 |
Samsoniella sinensis | YFCC 8766 | Lepidoptera (larvae) | ON563175 | ON621679 | ON676523 | ON676511 | ON568694 |
Samsoniella sinensis | YFCC 8767 | Dermaptera | ON563176 | ON621680 | ON676524 | ON676512 | ON568695 |
Samsoniella tiankengensis | KY11741 | Lepidoptera (pupa) | - | ON502838 | ON525437 | - | ON525436 |
Samsoniella tiankengensis | KY11742 | Lepidoptera (pupa) | - | ON502841 | ON525439 | - | ON525438 |
Samsoniella tortricidae | YFCC 6013 | Lepidoptera (pupa) | MN576751 | MN576807 | MN576977 | MN576867 | MN576921 |
Samsoniella tortricidae | YFCC 6131 | Lepidoptera (pupa) | MN576750 | MN576806 | MN576976 | MN576866 | MN576920 |
Samsoniella vallis | DY07241 | Lepidoptera (pupa) | - | OR263306 | OR282778 | OR282772 | OR282774 |
Samsoniella vallis | DY07242 | Lepidoptera (pupa) | - | OR263308 | OR282779 | - | OR282775 |
Samsoniella winandae | TBRC 17511 | Lepidoptera (Cocoon) | - | OM491231 | OM687896 | OM687901 | OM687899 |
Samsoniella winandae | TBRC 17512 | Lepidoptera (pupa) | - | OM491232 | OM687897 | OM687902 | OM687900 |
Samsoniella yuanzuiensis | NTUPPMCC 20-065 | Lepidoptera (pupa) | - | MT974360 | MW200217 | MW200226 | MW200235 |
Samsoniella yunnanensis | YFCC 1527 | Fungi (Cordyceps cicadae) | MN576756 | MN576812 | MN576982 | MN576872 | MN576926 |
Samsoniella yunnanensis | YFCC 1824 | Fungi (Cordyceps cicadae) | MN576757 | MN576813 | MN576983 | MN576873 | MN576927 |
Simplicillium lamellicola | CBS 116.25 | Soil | AF339601 | AF339552 | DQ522356 | DQ522404 | DQ522462 |
Simplicillium lanosoniveum | CBS 101267 | Fungi (Hemileia vastatrix) | AF339603 | AF339554 | DQ522357 | DQ522405 | DQ522463 |
Simplicillium lanosoniveum | CBS 704.86 | Fungi (Hemileia vastatrix) | AF339602 | AF339553 | DQ522358 | DQ522406 | DQ522464 |
Simplicillium obclavatum | CBS 311.74 | Air above sugarcane field | AF339567 | AF339517 | EF468798 | - | - |
Trichoderma deliquescens | ATCC 208838 | On decorticated conifer wood | AF543768 | AF543791 | AF543781 | AY489662 | DQ522446 |
Trichoderma stercorarium | ATCC 62321 | Cow dung | AF543769 | AF543792 | AF543782 | AY489633 | EF469103 |
Zouia cauligalbarum | GZUIFRZHJ01 | Lepidoptera (Stemborer) | MH730665 | MH730667 | MH801920 | MH801922 | MH801924 |
Zouia cauligalbarum | GZUIFRZHJ02 | Lepidoptera (Stemborer) | MH730666 | MH730668 | MH801921 | MH801923 | MH801925 |
Node | Mean (Mya)/95% HPD (Mya)/BYPP | Node | Mean (Mya)/95% HPD (Mya)/BYPP |
---|---|---|---|
1 | 133.64/125.06–142.88/1.00 | 18 | 48.44/44.71–52.18/1.00 |
2 | 103.80/94.70–112.91/1.00 | 19 | 46.32/42.74–50.13/- |
3 | 101.99/100.99–102.95/1.00 | 20 | 45.95/33.86–58.83/1.00 |
4 | 95.25/90.35–99.62/- | 21 | 44.90/39.67–50.59/0.99 |
5 | 88.91/83.36–95.03/1 | 22 | 44.24/42.74–50.13/- |
6 | 81.44/76.23–86.67/1.00 | 23 | 43.17/38.55–47.96/1.00 |
7 | 77.42/72.36–82.89/- | 24 | 43.07/39.90–46.44/0.95 |
8 | 75.82/70.02–81.86/- | 25 | 40.98/36.32–45.92/1.00 |
9 | 73.34/66.20–80.29/- | 26 | 39.56/36.33–42.85/1.00 |
10 | 70.81/64.51–77.00/1.00 | 27 | 34.57/31.41–37.67/1.00 |
11 | 63.57/58.85–68.69/- | 28 | 34.11/25.41–42.93/- |
12 | 61.85/56.28–67.78/1 | 29 | 29.32/26.68–31.97/1.00 |
13 | 60.78/55.31–66.35/1 | 30 | 26.70/21.42–31.96/- |
14 | 59.24/54.54–64.03/- | 31 | 22.46/20.04–24.96/1.00 |
15 | 57.53/51.65–63.41/- | 32 | 20.50/18.40–22.81/0.93 |
16 | 52.26/47.14–57.94/1 | 33 | 16.43/12.76–20.03/0.97 |
17 | 48.64/42.96–54.84/- |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pu, H.; Yang, J.; Keyhani, N.O.; Yang, L.; Zheng, M.; Qiu, C.; Mao, Y.; Shang, J.; Lin, Y.; Xiong, C.; et al. Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). J. Fungi 2025, 11, 28. https://doi.org/10.3390/jof11010028
Pu H, Yang J, Keyhani NO, Yang L, Zheng M, Qiu C, Mao Y, Shang J, Lin Y, Xiong C, et al. Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). Journal of Fungi. 2025; 11(1):28. https://doi.org/10.3390/jof11010028
Chicago/Turabian StylePu, Huili, Jiao Yang, Nemat O. Keyhani, Lixia Yang, Minhai Zheng, Chenghao Qiu, Yuchen Mao, Junya Shang, Yongsheng Lin, Chengjie Xiong, and et al. 2025. "Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales)" Journal of Fungi 11, no. 1: 28. https://doi.org/10.3390/jof11010028
APA StylePu, H., Yang, J., Keyhani, N. O., Yang, L., Zheng, M., Qiu, C., Mao, Y., Shang, J., Lin, Y., Xiong, C., Lin, L., Lai, P., Huang, Y., Yuan, X., Liang, H., Fan, L., Ma, X., Qiu, C., & Qiu, J. (2025). Molecular Phylogenetics and Estimation of Evolutionary Divergence and Biogeography of the Family Cordycipitaceae (Ascomycota, Hypocreales). Journal of Fungi, 11(1), 28. https://doi.org/10.3390/jof11010028