Double-Heading Produces Larger Fruit via Inhibiting EjFWLs Expression and Promoting Cell Division at the Early Stage of Loquat Fruit Development

Abstract

Loquat is an evergreen fruit crop which blooms from autumn–winter, and supports human beings with juicy fruit from late spring to early summer. However, the most traditional cultivars of this crop produce small fruit and bear a much lower yield than its relatives like apple, pear and peach. Large-size cultivars have long been a cherished aim of breeders for improving the production yield of loquat. Agronomic practices like panicle thinning, fruit thinning, growth regulator application, fertilization and so on are easier and more accessible ways for growers to produce large-size loquat fruit on existing production trees. Here, we develop a novel pruning method with an annual double back-cut, which provides vigorous shoot with more leaves and thicker branches for bearing much larger loquat fruit. Cellular observation determined that the vigorous shoot training method motivated cell division to produce larger loquat fruit, and that most of these cell layers were proliferated before the appearance of flower blossoms. Gene expression data of four development stages showed that EjFWL1 and EjFWL2 were notably downregulated in flower buds of the vigorously pruned tree. The data here further confirmed that the cell division capacity during flower development greatly influenced both the flower and fruit size of loquat. More importantly, we developed a novel pruning method to inhibit cell division repressors, promote cell proliferation and enlarge fruit size in loquat.

1. Introduction

Loquat (Eriobotrya japonica) is an evergreen fruit tree from the apple tribe of Rosaceae that provides human beings with succulent and palatable fruit in spring and summer [1,2]. The Eriobotrya genus contains more than 26 species, and most of them, including E. japonia that has been cultivated for fruit production for more than 2300 years, are native to China [3]. In addition to fruit consumption, the leaves of this crop are rich in natural active products like triterpenes, phenolics, sesquiterpene glycosides and flavonoids [4,5]. Loquat plants have been used in both traditional and modern medicine for thousands of years. Consequently, loquat is nowadays popularly accepted by most people around the world and cultivated in about 30 countries [1,5]. However, most commercial cultivars, especially those that belong to the white-flesh group, produce small fruit (the majority of these cultivars weigh approximately 20–30 g) and result in much lower yields as compared to other Rosaceae fruits like apple, pear and peach [6].

In the last decades, researchers and breeders have performed large endeavors in breeding to obtain large fruit cultivars. Among these, seedling selection, variety crossing and ploidy breeding were commonly used. In China, a large size cultivar (‘Jiefangzhong’), with a fruit weight of 61 g, was seedling selected from ‘Dazhong’ in 1949 by a local farmer in Fujian [7]. The crossing of ‘Jiefangzhong’ with ’Moriowase’ in 1981 then selected out the extremely early-ripening ‘Zaozhong-6’ that has a similar size to ‘Jiefangzhong’ [8]. The application of this cultivar greatly promoted loquat industry development from the 1990s to the beginning of this century across China [9]. ‘Zaozhong-6’ was then used in other crossbreeding programs to create large-size cultivars with diverse ripening seasons and flesh colors [10,11]. At the same time, molecular markers (including AFLP, SSR, Indel and SNP) and biotechnologies were also used in the MAS (molecular assisted selection) of loquat [12,13,14,15]. However, the breeding of an elite cultivar with the comprehensive advantages of high fruit weight, good taste quality, high resistance, good adaptability and easy management is extraordinarily hard and time consuming.

Farmers nowadays urgently require researchers to develop methods of improving the production yield of the cultivars that they currently are planting. In addition to the use of a new cultivar, there are a lot of internal and external factors [16,17,18,19] such as tree vigor, seed number, hormone level, days to ripening, fruit loading, temperature and fertilization-influencing fruit enlargement of loquat and other fruits. For a commercial loquat cultivar, flower cluster thinning or flower/fruitlet thinning in each panicle is needed to produce attractive fruit for the consumers [20,21]. In the Fujian province, loquat trees are commonly pruned from April to May after harvest. The strong summer-shoots after this pruning then generate flower buds in late summer or early autumn. Meanwhile, about half of these panicles were thinned for larger-sized fruit production [22]. To save the tree nutrients contained in the thinned panicle as well as produce large-size fruit for the tight spring fresh-fruit market, we invented a vigorous pruning method via double back-cutting. Half of the amount of the abovementioned summer shoots were removed to avoid too much flower generation so that they would develop into vigorous panicle-bearing shoots with more leaves, thicker branches and larger flowers in the following production season. More interestingly, the vigorous shoots were able to produce larger-sized fruit and greatly improve the production yield. FW2.2 (fruit weight 2.2) is the first QTL mapping gene which accounts for about 30% of tomato fruit weight variations [23], and it is believed to regulate fruit growth via repressing the ovary cell division at the early fruit development stage. Its homologues in fruit crops like avocado [24], tomatillo [25] and pear [26] were functionally identified as cell division repressors. Our previous work discovered that EjFWLs are repressors of cell division during early loquat fruit development [27]. Consistent with our former speculation [28], we here also found that the novel pruning method could greatly inhibit the cell repressor gene expression and promote cell division during the flower size development period.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Ten-year-old grafted ‘Guifei’ (GF) and ‘Zaozhong-6’ (ZZ) trees were used in this study. For each pruning method, three trees were selected and trained at the Honggeng Agricultural Development Co., LTD (Putian, Fujian, China). The trees were trained traditionally or under the double-heading system from 2018 on, with some modifications according to former protocols [21,22]. A total of 10 kg (kilograms) of organic fertilizer was applied on each tree during the flower differentiation and panicle development in September or October. Other fertilizer applications were performed in late February to promote fruit expansion [22].

2.2. A Novel Pruning Method for Vigorous Shoot Preparing and Larger Fruit Development

Commonly, adult loquat trees are annually pruned once at the end of each fruit harvest, and they are back-cut after the fruit ripens during the period from May to early June (Figure 1A). The sprouting summer shoots then mature in late summer or early autumn and generated panicles in the apex of the mature shoots (Figure 1B). However, about 40–50% of the panicles need to be removed around fruit setting to confirm that the remaining fruit will be the right size (Figure 1C). During this process, large amounts of tree nutrients are wasted. Therefore, our group tried to develop a new pruning method that could save the abovementioned tree nutrients as well as promote fruit enlargement. In the first year, in addition to the necessary back-cutting after the harvest in May (Figure 1D), another back-cutting was carried out when the panicles of the summer-shoots were just forming in early September (Figure 1E). In this way, the remaining flower-bearing shoots were used for fruit production as is commonly practiced (Figure 1B,C), while the cut shoots could grow more vigorous and act as flower-bearing shoots during the next autumn (Figure 1F) and set more fruit or larger-sized fruits in the same amounts (Figure 1G). In the second production year, all shoots were back-cut after the fruit season, the thinner shoots in each tree were back-cut a second time and the vigorous shoots that were left were able to produce bigger fruit every year, as shown in Figure 1G.

2.3. Tree Vegetative Trait Measurement

Tree vegetative traits around the flower blossoms were measured on 24 November 2021. The chlorophyll index was measured with a handheld chlorophyll meter (SPAD-502PLUS, Konica Minolta, Osaka, Japan). The shoot length and branch thickness were measured with a tapeline and a vernier caliper (Guilin Guanglu Digital Measurement and Control Co., Ltd., Guilin, China), respectively. Three trees under both pruning systems were used for vegetative trait data collection, and data from eight shoots of each tree were measured.

2.4. Fruit Size Measurement

Mature fruit from Zaozhong-6 and Guifei were respectively picked on 15 and 26 April 2021. Three groups of fruit were measured for each pruning system. The fruit weight data were measured with an electronic balance (Shanghai Jingqi Instrument Co., Ltd., Shanghai, China). The fruit diameter and flesh thickness were measured with a Guanglu vernier caliper (Guilin Guanglu Digital Measurement and Control Co., Ltd., Guilin, China).

2.5. Section Preparation and Cell Measurement

The receptacles at the anthesis and flesh of mature fruit from ‘Zaozhong-6’ and ‘Guifei’ were fixed in a Formalin–Aceto–Alcohol mixture. These samples were then cut into 10 μm sections as in our previous study [27]. The images were captured with a Leica DM4 B microscope (Leica, Wetzlar, Germany) with Leica Application Suite X software. The cell number of each receptacle or flesh sample was counted from the epidermis to the endocarp, manually. The cell size of the abovementioned sections was measured via Image-Pro Plus 7.0 software (Media Cybernetics, Rockville, MD, USA).

2.6. Gene Expression Analysis

For the gene expression analysis, the flowers of GF and ZZ from four developmental stages (21, 14, 4 and 0 days before flower blossoming) were collected from 20 October to 15 November in 2023, after the cellular data determined receptacle cell division as a crucial factor affecting loquat fruit size. RNA extraction and cDNA preparation were carried out as previously performed [27]. For quantitative, real-time PCR assays, EjACT (AB710173.1) was used as a housekeeping gene, using iTaq™ universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). The EjFWL1/2 primer pairs were previously developed in our former study [27]. Primers including EjFWL1_F: GGTCCACTATTCTTTGCCACT; EjFWL1_R: CACACTCCTCCTGAAGCACA; EjFWL2_F: TGCTTGGTTCATTGCTTCTG; EjFWL2_R: TCCTTCACGGTTCCTTTCCT; EjACT_F: CTTTCCCTCTATGCCAGTG and EjACT_R: CAAGGTCAAGCCTCAAGAT were synthesized by Sangon Biotech (Shanghai, China) for q-PCR assays. Three biological replicates were measured for each sample with the LightCycler480 PCR system (Roche, Munich, Germany).

2.7. Data Analysis

Data analyses and figure drawing were performed with SigmaPlot 12.5 software, and Student’s t-test and one-way ANOVA were used to identify significant differences among diverse groups.

3. Results

3.1. Double-Heading Promotes Shoot Growth

To understand why shoots under two back cutting can support larger panicles (Figure 2A) and bigger fruit growing, we first focused on the differences in the vegetative growing phases. While the leaves of both ZZ (upper panel) and GF (lower panel) under double-heading had a deeper green color (Figure 2A), the analyzed data showed that these leaves had a much higher chlorophyll index (Figure 2B). Moreover, the shoots of the two cultivars under double back-cut pruning were 16~102% longer (Figure 2C) and 25~35% thicker (Figure 2D) than those that were only pruned once. Meanwhile, the leaf number of each shoot after two back cuttings were 1.4~2.1 times that of the shoots that underwent only one back cutting (Figure 2E). Altogether, these data suggest that better vegetative growth vigor greatly supports subsequent fruit growing.

3.2. Double-Heading Enhances Loquat Fruit Enlargement

As can be seen in Figure 3A, both the ZZ and GF fruit were much larger when grown on vigorous shoots that underwent two back-cuttings every year as compared to control fruit. The single fruit weights of ZZ and GF were enhanced by 45.73% and 35.59% from 37.17 g and from 51.88 g to 54.17 g and 70.34 g under two back-cuttings (Figure 3B). Corresponding to the fruit weight, the equatorial diameter of the fruit also increased by 10.84% and 7.95% in ZZ and GF, respectively, on the trees that underwent two back-cuttings (Figure 3C), and the flesh was much thicker on the fruit from these trees (Figure 3D).

3.3. Double Back-Cutting Promotes Both Cell Division and Cell Expansion

To further understand how the fruit growth on the vigorous shoots was promoted, we then performed flesh sectioning to observe the cytological differences that might confer fruit size enlargement (Figure 4A,B). The cell size of ZZ (Figure 4C) and GF (Figure 4D) from vigorous shoots were 11.45% and 20.43% larger than that of the control fruit, respectively. On the other hand, the cell layers across the flesh from the peels to the endocarps of ZZ (Figure 4E) and GF (Figure 4F) loquats respectively increased by14.65% and 23.70%, from 60.07 and 60.47 to 68.87 and 74.80. The cellular comparison here implies that the cell layer acts as a more important factor than cell size for promoting loquat fruit enlargement.

3.4. Double Back-Cutting Notably Promotes Receptacle Cell Division during Flower Bud Development

In previous research, we first discovered that the most cell layers of loquat flesh were proliferated before the flowers bloomed, and we supposed that the promotion of cell division during flower development would greatly enhance the fruit size. To check whether the vigorous shoots under two back-cuttings would motivate cell division during flower development, receptacle sections of blooming flowers were prepared. The sections showed that the receptacles of both ZZ and GF on the vigorous shoots were also much thicker than those on the control shoots (Figure 5A,B). Further cell number counting data showed that the cell layers of the ZZ (Figure 5C) and GF (Figure 5D) receptacles increased by 18.21% and 28.00%, respectively, from 41.88 and 43.75 to 49.50 and 56.00. Compared to the cell layers of mature fruits, most of the cell layer increments (86.65% and 85.47%) of the ripened fruit on the vigorous shoots happened before the flowers blossomed (Figure 4 and Figure 5).

3.5. Double Back-Cutting Inhibits EjFWL1/2 Expression during Flower Bud Growth Period

To further confirm whether shoot vigor modulates cell-division regulator gene expression to influence cell division during the flower growing season, we then analyzed the EjFWL1/2 gene expression at four flower developmental stages for shoots under both single and double back-cut pruning (Figure 6A). Flowers from the control shoots maintained significantly higher EjFWL1 expression levels during all four stages for both ZZ (Figure 6B) and GF (Figure 6C). Similarly, the higher EjFWL2 expression levels were maintained in the two cultivars during most of the four stages (Figure 6D,E). Additionally, EjFWL1 and EjFWL2 showed diverse expression patterns during the four stages; the control flowers showed continuously elevated EjFWL1 expression levels, while the vigorous ones first downregulated their expressions, then gradually upregulated (Figure 6B,C). On the other hand, the vigorous ZZ flower and both GF flowers significantly decreased in EjFWL2 expression levels at stage 2 and showed sharply elevated levels when the flowers bloomed (Figure 6D,E), while the weaker ZZ flower fluctuated in EjFWL2 expression from stage 1 to 3 and notably increased as the flower opened (Figure 6D).

4. Discussion

Commonly, fruit produced by fruit trees, vegetables and forest plants attract human beings by providing us with enjoyable tastes, fragrances, colors and shapes as well as abundant nutrients [29]. To satisfy consumer demand and farmer income, suitable fruit size and yield capacity are required for fruit production. Generally, loquat fruit ripens in the off-season of most other fresh fruit (from late spring to early summer); the juicy fruit is delicious, enriched in nutritional compositions including carotenoids, triterpenoids, phenolics, amygdalin, vitamins, volatiles, mineral nutrients, fiber and other bioactive compounds [5]. However, most cultivars used for loquat production produce small loquat fruit and result in low yields and slow expansion of this crop. Though the breeding of ‘Zaozhong-6’ and ‘Guifei’ [10] notably improves the fruit size of early- and late-ripening loquat cultivars, the production yield of loquat is still much lower than its relatives, including apple, pear and peach. In addition to new cultivars, farmers still need convenient management protocols to enhance loquat size and yield.

Previous invented agronomic techniques such as fruit/flower thinning [20], branch scoring [18], pruning [30], girdling [31], hormone application [32] and bunch bagging [33] showed diverse fruit enlargement-promoting capacities for loquat. As mentioned above, about half of the panicles should be thinned before the full blossom stage for commercial fruit production under traditional pruning system for loquat [22]. Double-heading removes these shoots soon after they form and saves tree nutrients for the remaining shoots; consequently, the remaining shoots are more vigorous than those that undergo single-heading (Figure 2), and they also produce larger fruit (Figure 3). Consistent with our research, pruning was also found to promote apple [34], citrus [35,36], kiwifruit [37] and guava [38] fruit enlargement. More importantly, here we found that double-heading supports vigorous shoots with deeper green leaves and a higher chlorophyll index (Figure 2), which supports a stronger carbohydrate source for loquat fruit growth. Interestingly, researchers have discovered that an intensive carbohydrate metabolic program during early fruit development results in larger ripened apple fruit [39].

Cell division and expansion are two important cell processes that determine fruit or other organ sizes. Here, we showed that double-heading provides vigorous fruit-bearing shoots and supports more intensive cell division in the flower bud growth stage of two loquat cultivars (Figure 5), which then notably promoted fruit enlargement (Figure 3). Similarly, Zhu et al. [40] discovered that the stronger shoots in Zaozhong-6 loquat trees would always bear larger fruit. All of these confirm our previous discovery that most loquat cortex cells proliferate before the flowers blossom and that the flower bud growth is a vital stage for cell division and fruit size regulation [28]. Consistently, Cuevas et al. [41] and Wang et al. [42] found that fruit size differences at harvest within the same panicle were largely due to the fruit size at the initial fruit set (in other words, fruit size at blossom). Altogether, these studies reveal that promoting cell division before the flower blossom stage is essential for increasing loquat fruit size.

While abundant genes including EjBZR1 [6], EjCYP90 [6] and EjNACL47 [43] have been functionally identified in the cell expansion and fruit size regulation of loquat, EjFWL1/2s, homologs of the tomato fruit size regulator fw2.2 [23], are the only cell division genes yet known to modulate loquat fruit size [27]. Our former works discovered that EjFWL1/2s were predominantly transcribed during the floral bud growth and early fruit development of Zaozhong-6 loquat fruit [27,28]; similar gene expression patterns of EjFWL1/2 were obtained in the floral bud development stage of Guifei loquat (Figure 6). Consistent with tomato [44], avocado [24] and pear [45], which showed higher fw2.2 homologs expression levels in small size varieties, the downregulation of EjFWL1/2 transcription in the flower bud growth stages of Guifei resulted in bigger loquat fruit (Figure 3 and Figure 6). This result agrees with our former conclusion that EjFWLs are cell division repressors during the early fruit development stage and act as crucial loquat fruit size regulators [27].

5. Conclusions

In summary, our findings suggest that double-heading is an essential pruning method for larger loquat fruit production. Shoots under double-heading maintain stronger carbohydrate capacities for supporting fruit growth. Double-heading contributes more to cell division than to cell expansion in loquat fruits. Most of the cell layers increased by double-heading proliferated before the full blossom stage. Double-heading notably inhibits the cell division repressor EjFWL1/2 expression and promotes hypanthium cell proliferation during the flower bud growth stage. This study provides a crucial pruning method to downregulate EjFWL1/2 expression, promote hypanthium cell division and enhance loquat fruit size.