Survey of Viruses Infecting Tomato, Cucumber and Mung Bean in Tajikistan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Survey and Sample Collection
2.2. Detection and Identification of Plant Viruses
3. Results
3.1. Viral Diseases in Cucumber
3.2. Viral Diseases in Mung Bean
3.3. Viral Diseases in Tomato
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- AQUASTAT. Tajikistan. 2018. Available online: https://www.fao.org/aquastat/statistics/query/results.html (accessed on 25 March 2022).
- Feed the Future FEEDBACK; Feed the Future Tajikistan Zone of Influence Baseline Report; Westat: Rockville, MD, USA, 2014.
- Prasad, A.; Sharma, N.; Hari-Gowthem, G.; Muthamilarasan, M.; Prasad, M. Tomato yellow leaf curl virus: Impact, challenges, and management. Trends Plant Sci. 2020, 25, 897–911. [Google Scholar] [CrossRef]
- Ito, T.; Sharma, P.; Kittipakorn, K.; Ikegami, M. Complete nucleotide sequence of a new isolate of tomato leaf curl New Delhi virus infecting cucumber, bottle gourd and muskmelon in Thailand. Arch. Virol. 2008, 153, 611–613. [Google Scholar] [CrossRef]
- Parrella, G.; Gognalons, P.; Gebre-Selassiè, K.; Vovlas, C.; Marchoux, G. An update of the host range of Tomato spotted wilt virus. J. Plant Pathol. 2003, 85, 227–264. [Google Scholar]
- Blancard, D. (Ed.) 3—Principal characteristics of pathogenic agents and methods of control. In Tomato Diseases, 2nd ed.; Academic Press: San Diego, CA, USA, 2012; pp. 413–650. [Google Scholar]
- Dombrovsky, A.; Tran-Nguyen, L.T.T.; Jones, R.A.C. Cucumber green mottle mosaic virus: Rapidly increasing global distribution, etiology, epidemiology, and management. Annu. Rev. Phytopathol. 2017, 55, 231–256. [Google Scholar] [CrossRef] [PubMed]
- Jacquemond, M. Cucumber mosaic virus. Adv. Virus Res. 2012, 84, 439–504. [Google Scholar]
- Fiallo-Olivé, E.; Navas-Castillo, J. Tomato chlorosis virus, an emergent plant virus still expanding its geographical and host ranges. Mol. Plant Pathol. 2019, 20, 1307–1320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okuda, M.; Okazaki, S.; Yamasaki, S.; Okuda, S.; Sugiyama, M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus Crinivirus. Phytopathology 2010, 100, 560–566. [Google Scholar] [CrossRef] [Green Version]
- Tan, S.T.; Liu, F.; Lv, J.; Liu, Q.L.; Luo, H.M.; Xu, Y.; Ma, Y.; Chen, X.J.; Lan, P.X.; Chen, H.R.; et al. Identification of two novel poleroviruses and the occurrence of Tobacco bushy top disease causal agents in natural plants. Sci. Rep. 2021, 11, 21045. [Google Scholar] [CrossRef] [PubMed]
- Knierim, D.; Deng, T.C.; Tsai, W.S.; Green, S.K.; Kenyon, L. Molecular identification of three distinct Polerovirus species and a recombinant Cucurbit aphid-borne yellows virus strain infecting cucurbit crops in Taiwan. Plant Pathol. 2010, 59, 991–1002. [Google Scholar] [CrossRef]
- Fang, M.; Yu, J.; Kim, K.H. Pepper mottle virus and its host interactions: Current state of knowledge. Viruses. 2021, 13, 1930. [Google Scholar] [CrossRef]
- Cheng, Y.H.; Wang, R.Y.; Chen, C.C.; Chang, C.A.; Jan, F.J. First report of Pepper veinal mottle virus in tomato and pepper in Taiwan. Plant Dis. 2009, 93, 107. [Google Scholar] [CrossRef]
- Torrance, L.; Talianksy, M.E. Potato virus Y emergence and evolution from the Andes of south America to become a major destructive pathogen of potato and other Solanaceous crops worldwide. Viruses 2020, 12, 1430. [Google Scholar] [CrossRef]
- Zhao, F.F.; Xi, D.H.; Liu, J.; Deng, X.G.; Lin, H.H. First report of Chilli veinal mottle virus infecting tomato (Solanum lycopersicum) in China. Plant Dis. 2014, 98, 1589. [Google Scholar] [CrossRef] [PubMed]
- Bateson, M.F.; Lines, R.E.; Revill, P.; Chaleeprom, W.; Ha, C.V.; Gibbs, A.J.; Dale, J.L. On the evolution and molecular epidemiology of the potyvirus Papaya ringspot virus. J. Gen. Virol. 2002, 83, 2575–2585. [Google Scholar] [CrossRef]
- Svoboda, J.; Leisova-Svobodova, L.; Amano, M. Evaluation of selected Cucurbitaceous vegetables for resistance to Zucchini yellow mosaic virus. Plant Dis. 2013, 97, 1316–1321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mishra, G.P.; Dikshit, H.K.; Ramesh, S.V.; Tripathi, K.; Kumar, R.R.; Aski, M.; Singh, A.; Roy, A.; Kumari, N.; Dasgupta, U.; et al. Yellow mosaic disease (YMD) of Mungbean (Vigna radiata (L.) Wilczek): Current status and management opportunities. Front. Plant Sci. 2020, 11, 918. [Google Scholar] [CrossRef]
- Deng, T.C.; Tsai, C.H.; Tsai, H.L.; Liao, J.Y.; Huang, W.C. First report of Cucumber mosaic virus on Vigna marina in Taiwan. Plant Dis. 2010, 94, 1267. [Google Scholar] [CrossRef]
- Makkouk, K.M.; Kumari, S.G. Epidemiology and integrated management of persistently transmitted aphid-borne viruses of legume and cereal crops in West Asia and North Africa. Virus Res. 2009, 141, 209–218. [Google Scholar] [CrossRef]
- Worrall, E.A.; Wamonje, F.O.; Mukeshimana, G.; Harvey, J.J.; Carr, J.P.; Mitter, N. Bean common mosaic virus and Bean common mosaic necrosis virus: Relationships, biology, and prospects for control. Adv. Virus Res. 2015, 93, 1–46. [Google Scholar] [PubMed]
- Alabi, O.J.; Crosslin, J.M.; Saidov, N.; Naidu, R.A. First Report of Potato virus Y in Potato in Tajikistan. Plant Dis. 2012, 96, 1074. [Google Scholar] [CrossRef]
- Alabi, O.J.; Saidov, N.; Muniappan, R.; Naidu, R.A. First report of Iris yellow spot virus in onion in Tajikistan. New Dis. Rep. 2012, 26, 28. [Google Scholar] [CrossRef] [Green Version]
- Tsai, W.S.; Shih, S.L.; Kenyon, L.; Green, S.K.; Jan, F.J. Temporal distribution and pathogenicity of the predominant tomato-infecting begomoviruses in Taiwan. Plant Pathol. 2011, 60, 787–799. [Google Scholar] [CrossRef]
- Menzel, W.; Knierim, D.; Winter, S.; Hamacher, J.; Heupel, M. First report of tomato brown rugose fruit virus infecting tomato in Germany. New Dis. Rep. 2019, 39, 1. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.C.; Li, J.T.; Lin, Y.P.; Yeh, Y.C.; Kang, Y.C.; Huang, L.H.; Yeh, S.D. Genomic characterization of Calla lily chlorotic spot virus and design of broad-spectrum primers for detection of tospoviruses. Plant Pathol. 2012, 61, 183–194. [Google Scholar] [CrossRef]
- Ha, C.; Coombs, S.; Revill, P.A.; Harding, R.M.; Vu, M.; Dale, J.L. Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Arch. Virol. 2008, 153, 25–36. [Google Scholar] [CrossRef]
- Melgarejo, T.A.; Lehtonen, M.T.; Fribourg, C.E.; Rännäli, M.; Valkonen, J.P.T. Strains of BCMV and BCMNV characterized from lima bean plants affected by deforming mosaic disease in Peru. Arch. Virol. 2007, 152, 1941–1949. [Google Scholar] [CrossRef] [PubMed]
- Chikh-Ali, M.; Naidu, R.A.; Karasev, A.V. First report of Potato virus Y (PVY) strain PVYC associated with a tomato disease in Kenya. Plant Dis. 2016, 100, 864–865. [Google Scholar] [CrossRef]
- Golnaz, N.; Jafarpour, B.; Rastegar, M.F.; Sabokkhiz, M.A. Detection of Cucumber mosaic virus and typing using serological and molecular methods in Razavi Khorasan Province. Pak. J. Biol. Sci. 2009, 12, 657–659. [Google Scholar] [CrossRef] [Green Version]
- Brault, V.; Uzest, M.; Monsion, B.; Jacquot, E.; Blanc, S. Aphids as transport devices for plant viruses. C. R. Biol. 2010, 333, 524–538. [Google Scholar] [CrossRef] [PubMed]
- Ho, T.; Tzanetakis, I.E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology 2014, 471–473, 54–60. [Google Scholar] [CrossRef] [Green Version]
- Maree, H.J.; Fox, A.; Rwahnih, M.A.; Boonham, N.; Candresse, T. Application of HTS for routine plant virus diagnostics: State of the art and challenges. Front. Plant Sci. 2018, 9, 1082. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Virus | Forward | Reverse | Reference |
---|---|---|---|
Begomovirus | GCATCTGCAGGCCCACATBGTYTTHCCNGT | GATTTCTGCAGTTDATRTTHTCRTCCATCCA | [25] |
Crinivirus | GCWGGNTTDGATTTTGGTAC | TADAYHGCDGCNGCNGAHGGYTC | New design |
Polerovirus | GAYTGCTCYGGYTTYGACTGGAG | GATYTTATAYTCATGGTAGGCCTTGAG | [12] |
Tobamovirus | GGGAATCAGTTTCAAACRCA | GGGGGGATTCGAACCYCT | [26] |
Tospovirus | ATGGGDATNTTTGATTTCATGRTATGC | TCATGCTCATSAGRTAAATYTCTCT | [27] |
Potyvirus | GGIVVIGTIGGIWSIGGIAARTCIAC | ACICCRTTYTCDATDATRTTIGTIGC | [28] |
BCMV | GARRAGCHCCRTAYATAGCAGA | GCTTTGCATTTYCAACCATTGG | [29] |
ChiVMV & PVMV | TATTCYTCAGTGTGGHTYCCACCAT | YCWCWDWAARCCATAAMMATARTYT | [14] |
PepMoV | GCAGCAGCACGGATACACAA | AGTGTCTATTAAGCGACCGCT | New design |
PRSV | AGGGGANAGAGGAAACACTC | AGTGGGACAGRAATTTCCCC | New design |
PVY | ATGCCAACTGYGATGAATGG | CTCTGTGTTYTCCTCTTGTGTAC | [30] |
ZYMV | CCATACATAGCTGAGACAGC | CACCAAACCATGAAACCATT | New design |
CMV | GTTTATTTACAAGAGCGTACGG | GGTTCGAARRWATAACCGGG | [31] |
Crop | Total Samples | No Virus | Virus Detection | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Begomo-Virus | Crini-Virus | Tospo-Virus | Tobamo-Virus | Polero-Virus | Poty-Virus | BCMV | ChiVMV | PepMoV | PRSV | PVMV | PVY | ZYMV | CMV | |||
Cucumber | 7 | 0 | 0 | 1 | 0 | 0 | 7 | 7 | - | - | - | 0 | - | - | 7 | 7 |
Mung bean | 32 | 5 | 0 | - | - | - | 0 | 17 | 17 | - | - | - | - | - | - | 27 |
Tomato | 10 | 0 | 0 | 0 | 0 | 0 | 0 | 6 | - | 0 | 0 | - | 0 | 6 | - | 10 |
Crops | CMV | CMV + BCMV | CMV + PVY | CMV + ZYMV + Polerovirus | CMV + ZYMV + CABYV | CMV + ZYMV + CABYV+ CCYV |
---|---|---|---|---|---|---|
Cucumber | 0 | - | - | 2 | 4 | 1 |
Mung bean | 10 | 17 | - | - | - | - |
Tomato | 4 | - | 6 | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chan, Y.-L.; Saidov, N.; Lee, L.-M.; Kuo, F.-H.; Shih, S.-L.; Kenyon, L. Survey of Viruses Infecting Tomato, Cucumber and Mung Bean in Tajikistan. Horticulturae 2022, 8, 505. https://doi.org/10.3390/horticulturae8060505
Chan Y-L, Saidov N, Lee L-M, Kuo F-H, Shih S-L, Kenyon L. Survey of Viruses Infecting Tomato, Cucumber and Mung Bean in Tajikistan. Horticulturae. 2022; 8(6):505. https://doi.org/10.3390/horticulturae8060505
Chicago/Turabian StyleChan, Yuan-Li, Nurali Saidov, Li-Mei Lee, Fu-Hsun Kuo, Su-Ling Shih, and Lawrence Kenyon. 2022. "Survey of Viruses Infecting Tomato, Cucumber and Mung Bean in Tajikistan" Horticulturae 8, no. 6: 505. https://doi.org/10.3390/horticulturae8060505