Behavioral Characteristics and Related Physiological and Ecological Indexes of Cultured Scallops (Mizuhopecten yessoensis) in Response to Predation by the Crab Charybdis japonica

Abstract

To investigate the effects of predation by the paddle crab Charybdis japonica on the culture and survival of scallops (Mizuhopecten yessoensis) during bottom culture, we investigated the behavioral characteristics of three sizes (small, medium, and large) of scallops in response to exposure to crabs. We found that scallops escaped from crab predation by continuous shell closure or movement. Shell closure force increased with scallop size, and scallops of the same size that were stimulated by the presence of crabs closed their shell more frequently than control scallops. We also measured the activities of superoxide dismutase, catalase, arginine kinase, and octopine dehydrogenase in the gill, adductor muscle, and mantle of scallops before and after exposure to predation. Tissues that showed significant differences between control and test specimens were selected for deep sequencing of the transcriptome to identify and validate the key genes that were sensitive to predation. We found that when M. yessoensis is stimulated by the presence of predators, its behavioral characteristics and related physiological and ecological indexes undergo significant changes. The results are relevant for developing specifications for M. yessoensis seedling casting during bottom culture.

1. Introduction

The scallop Mizuhopecten yessoensis is a large cold-water filter-feeding bivalve with a fan-shaped shell [1]. It is native to Japan and Korea and mostly inhabits inner gulf regions with high salinity and no freshwater injection. Due to its high nutritional value, delicious flavor, large size, and high economic importance, M. yessoensis is popular among consumers. Scallops are important benthic marine organisms. They not only can purify the water quality of the sea [2,3] but also create new habitats for other benthic organisms [4]. M. yessoensis possesses significant ecological functions and commercial value. This species grows at a relatively fast rate, and the shell height of a 5-year-old scallop can reach 100 mm [5]. M. yessoensis was introduced into China in the 1980s and has become one of the most important farmed shellfish species in the northern part of China through large-scale aquaculture [6]. The cultivation of scallops includes hatching juvenile scallops, intermediate culture of juvenile scallops, and finally growing in the seabed or in hanging cages for artificial cultivation. In recent years, the scallop farming industry has developed rapidly. Currently, the annual catch can exceed 16,000 tons [5].

M. yessoensis is currently cultured in two main modes: raft culture and bottom culture, and the latter is the most common mode [7]. As the scale of scallop bottom culture increased, problems such as low recapture rate and high mortality rate emerged, which have seriously affected the development of the industry [8]. The cultivation of scallops is affected by multiple factors. For example, changes in water temperature and lack of food [9,10]. Changes in the marine environment may also be the cause of the death of M. yessoensis. Factors such as sea level rise [11], ocean acidification, and the input of freshwater rivers [12] will all affect the living environment of scallops and lead to their death. Consumption by predatory organisms is one of the main causes of high mortality of scallops. In natural waters, predators of scallops are mainly sea stars, snails, and crabs. Their study of sea scallops (Placopecten magellanicus) in the Atlantic Ocean Bay found that the predatory effects of sea stars (Astro pecten americanus) and crabs (Cancer irroratus) predation on (P. magellanicus) larvae affected scallop aggregation and that this predation affected scallop survival and varied with age [13]. Scallops with shell heights less than 5.0 cm are particularly vulnerable to predation and attacks by Charybdis japonica. The predatory behavior of Charybdis japonica on M. yessoensis also increases rapidly with the increase in water temperature, thus directly affecting the recapture rate of scallops [14]. A study of sea stars (Asterias vulgaris Verrill) and crabs (Cancer irroratus Say) and their predatory behavior toward juvenile scallops at different densities showed that crabs and sea stars have high predation rates on juvenile individuals [15]. The paddle crab Charybdis japonica is a natural predator of shellfish and the main predator of bottom-cultured shellfish in the Yellow Sea and Bohai Sea area. Thus, predation on scallops by C. japonica has caused great economic losses to fishermen [14], as it has very important impacts on scallop culture and survival. Quantifying predator–prey interactions and gaining insight into predator behavior is critical to optimizing recovery strategies. Understanding the dynamics of predator–prey size relationships can improve the success of recovery efforts [16].

Motor behavior is an essential function of animals, as it affects their survival, growth, and reproduction success [17]. The motor behavior of scallops plays a contributing role in their targeted culture, healthy development, and the improvement of economic benefits for farmers. Scallops have a unique natural escape response among bivalve mollusks because they possess excellent swimming ability and can use it when in contact with predators [18]. Strong escape responses should enhance survival in the face of predation [19]. When encountering a predator, scallops can close the shell, swim, and jump to avoid being eaten [20].

It is important to understand whether and how scallops can escape from predators to develop the aquaculture industry and produce healthy scallops, but little is known about the mechanisms involved in the response of M. yessoensis to predatory stimuli. Research has found that artificially cultured scallop seedlings are more easily preyed upon compared to wild scallops [21]. Since the size specification of scallops sown for mariculture is of crucial importance for scallop production, it is necessary to conduct in-depth research on the escape and evasion behaviors of scallops of different sizes in the face of harmful organisms so as to more comprehensively understand the adaptation mechanism of scallops when facing the threat of predators and determine the optimal stocking specification to obtain the maximum catch. In this laboratory study, we assessed the motor behavior and ability of different-sized scallops to avoid predation by crabs. We also compared the enzyme activities of tissues between control scallops and those exposed to continuous predatory stimulation. Finally, we conducted transcriptome sequencing of adductor muscle samples of M. yessoensis to identify genes involved in the physiological and biochemical response of scallops to stimulation by predators. We aim to provide data support and theoretical references for seedling size, density, and habitat selection in the cultivation of scallops by studying the escape behaviors and physiological responses of scallops at different developmental stages in response to predators.

2. Materials and Methods

2.1. Experimental Materials

M. yessoensis were captured from Longwangtang Bay (Figure 1) (38°48′ N 121°23′ E, Lvshunkou District, Dalian, China) in November 2022, placed in a holding tank under humid conditions, and returned to the Key Laboratory of Mariculture & Stock Enhancement in North China’s Sea (Ministry of Agriculture, Dalian Ocean University, Dalian, China). After being thoroughly rinsed, the scallops were temporarily raised in tanks. During the culture period, spirulina powder was fed regularly twice a day at a rate of 3–5 mg/L per feeding. The water temperature was maintained at 15 ± 0.5 °C, with a salinity of 30. Continuous aeration was provided, and filtered seawater was replaced daily with a water exchange volume of 50%. Following a 7-day culture period, scallops that were able to close naturally and in a healthy state without damage were selected for subsequent experiments.

C. japonica were also captured in the same time period. Healthy crabs with complete appendages and a cephalothorax width of 89.81–111.21 mm were raised for 7 days with no food provided. Then, the crabs showing no apparent trauma, intact chelicerae, and normal feeding capability were chosen for subsequent experiments.

The Yellow Sea and Bohai Sea are the breeding and habitat areas for many important economic fishery organisms. The biological resources are abundant. The main economic species include Chinese prawn, Spanish mackerel, jellyfish, swimming crab, flatfish, etc. In May 2022, the relative resource density of fishery resources was 48.86 kg/h. Among them, the relative resource density of invertebrates was 1.79 kg/h (1.42 kg/h for shrimps, 0.30 kg/h for cephalopods, and 0.07 kg/h for crabs).

Vernier calipers (accuracy: 0.01 mm, Marr Precision Measuring Instruments Co., Ltd., Suzhou, China) were employed to measure the length, height, and width of scallop shells. Electronic scales (accuracy: 0.01 g, Changshu Shuangjie Testing Instrument Factory, Jiangsu, China) were utilized to determine the wet weight of every scallop. On the basis of shell length, height, and width, three size groups were set up for scallop classification. The basic biological indicators of the specimens are listed in

Table 1. Specifications of the three size classes of M. yessoensis.

	Large Size (l)	Middle Size (m)	Small Size (s)
Shell length/mm	119.85 ± 3.23	89.24 ± 3.77	60.10 ± 3.23
Shell height/mm	116.92 ± 6.02	87.46 ± 3.55	61.39 ± 6.02
Shell width/mm	26.98 ± 2.98	26.98 ± 2.98	16.21 ± 2.63
Total wet weight/g	176.50 ± 28.57	83.70 ± 13.97	30.16 ± 5.29

All data are expressed as mean ± SD.

.

2.2. Experimental Methods

2.2.1. Observation of Scallops’ Behaviors

A webcam (Model: KS-X6-QG4, Police Vision Guard, Guangdong, China) was used to film the experiments described below for 72 h each. The camera was fixed at a height of 2 m directly above the tank. The experiment was conducted in the absence of external light, and the camera itself did not emit light. The equipment minimized vibrations and noise to ensure that the observed behavior was natural and not influenced by external factors. The number of swimming events (defined as the shell opening and closing consecutively more than three times) and jumping events (defined as the shell opening and closing consecutively three times or fewer) in each group was recorded within a randomly selected one-hour window.

2.2.2. Crab–Scallop Experiments

In order to gain insight into the motor behavior and escape mechanism of scallops in response to crab predation, a series of experiments were conducted, testing three different sizes of scallops. In the crab–scallop experiment, the experimental groups consisted of five small (X-sB), five medium (X-mB), or five large (X-1B) scallops in a tank, to which a crab was added for predation stimulation. The control groups for each scallop size group (sB, mB, and lB) were devoid of the presence of a crab. Each group was replicated three times.

2.2.3. Observation of Scallop Behavior

• Experimental Design

The force gauge method described in previous studies was adopted for the measurement of scallop shell closure force [17,22]. The devices for the experiment consisted of a stand, a digital force gauge (Nscing SH-III-100N, Suce, Nanjing, Jiangsu, China), and a water tank (Figure 2). A scallop was placed in the water tank, with the lower valve fixed on the experimental table and the upper valve opening and closing freely. The force gauge was installed on the stand, one end of which had a hooked rod fastened between the lower and upper valves, allowing for precise capture when the scallop closed its valve every time. Additionally, a data port was equipped on the other end, which was connected to a personal computer through a USB port.

• Force Recordings

With a force-measuring device installed, the test bench was used for scallop fixation so as to evaluate the movement state of scallops in varying sizes under natural conditions or continuous stimulation by a crab being present. In the whole experiment, the force-measuring device was connected to a personal computer via a USB interface through a data transmission line, and the data was output and stored through Soft-SH software (version 20.20200731). Then, Excel 2019 and SPSS 25.0 were used for the statistical analysis of the data. The adductor muscles mainly contract in two stages. First of all, phasic contractions result from the transverse striated muscle contraction in the adductor muscles, which refer to rapid shell opening and closing. Every peak value in the diagram for force output indicates one scallop clap (one cycle of opening and closing). In this process, the force generated stands for the force of clap (F_clap), and the shell contraction is defined by tense contraction (lasting for >0.5 s). Secondly, tonic contractions (namely, maintained for >0.5 s) cause slow shell opening and closing, attributable to smooth muscle contraction in the adductor muscles. In the force measurement output diagram, the contractions are presented as obvious and continual values. The force obtained from this process denotes the tonic contraction force (F_tonic). Normally, the motion cycle of a scallop includes n times of rapid clapping in a short time period and then slow contractions, which are more constant. In this process, the force obtained indicates the phasic contractile force (F_phasic), calculated as the sum of F_clap.

As revealed by Zhang et al. [17] in a pre-test, the movement of M. yessoensis discontinues after a predator is added for 3 min of continuous stimulation, and it needs a recovery period before being able to try evasion again. In this experiment, therefore, a measurement time of 180.2 ± 0.2 s was determined for each scallop. First, each size group of scallops was measured for movement under natural conditions in the absence of crabs. Then, the shell closure of these scallops was measured under continuous stimulation by existing C. japonica 48 h later. The data indexes involved the number of tonic contractions (T_tonic), maximum force of clap (F_max), frequency of shell closure (the number of times for closing the shell by the scallop per minute), and number of phasic contractions (T_phasic).

Considering the importance of the initial response to a predator and its strength for the survival of scallops, the ratio of shell closure counts in the initial 30 s to the total shell closure counts (P_30s) was calculated as well. For the purpose of minimizing inter-individual errors, each set of experiments was configured with 15 parallels.

2.2.4. Enzyme Activity Assay

Scallops were taken from the control group without stimulation and the three size groups after exposure to crabs to isolate the gills, mantle tissues, and adductor muscles, which were frozen in liquid nitrogen and cryopreserved (−80 °C) for subsequent assays on enzyme activity. The FANKEW ELISA kit (Bio-Techne China Co., Ltd., Shanghai, China) was used to examine arginine kinase (AK), catalase (CAT), octopine dehydrogenase (ODH), and superoxide dismutase (SOD) for their activities in each scallop tissue.

2.3. Transcriptomic Analyses

2.3.1. RNA Extraction and Transcriptome Sequencing

TruSeq Stranded mRNA LTSample Prep Kit (Illumina, California, CA, USA) was employed to extract total RNA in accordance with the manufacturer’s protocol. Then, all RNA samples were digested using RNase-free DNase I (Promega, Madison, WI, USA) to prevent contamination by genomic DNA.

Agarose gel electrophoresis, together with UV absorption, was performed to measure the purity of the acquired RNA. High-purity RNA was considered with OD260/OD280 at 1.8–2.1, as well as bright and clear 28S and 18S bands, which was applicable to subsequent experiments. First- and second-strand cDNAs were synthesized with the template determined as interrupted mRNA fragments, followed by purification by virtue of a kit (Agencourt AMPure XP, Beverly, MA, USA). Next, adapter ligation plus end repair was conducted on the short cDNA fragments. After that, the eligible fragments were screened out for enrichment via PCR amplification. Libraries were constructed using 4 μg of RNA from each sample by means of the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) as per the manufacturer’s instructions. Then, an Agilent 2100 Bioanalyzer (Agilent Technologies, California, CA, USA) was utilized to evaluate the quality of these libraries. Subsequently, an Illumina sequencing platform (HiSeq™ 2500, Illumina Trading (Shanghai) Co., Ltd. (Illumina)) was used for library sequencing to produce 125/150-bp paired-end reads. Beijing Novozymes Technology Co., Ltd. (Tianjin, China) was responsible for RNA preparation, library construction, and sequencing.

2.3.2. Bioinformatics Analysis

Raw data (raw reads) were assessed for quality and then processed through Trimmomatic23 [23] to acquire clean reads by deleting reads with ploy-N, low-quality reads, and adapters. Next, HISAT2 24 [24] was used for mapping the clean reads on the M. yessoensis genome (https://www.ncbi.nlm.nih.gov/genome/12193, accessed on 30 January 2023). For every gene, cufflinks [25] were applied to calculate the Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) value, and htseq-count [26] was employed to obtain the read counts. Regarding the mBJ group and the X-mBJ group, comparison of RNA-seq data was accomplished by DESeq [27], and DESeq functions (i.e., estimateSizeFactors and nbinom Test) were adopted to identify the differentially expressed genes (DEGs). For calculating the significance of differences, the p-value threshold in multiple tests was determined through the false discovery rate (FDR) control method. p < 0.05 and fold change >2 were set as threshold values. Kyoto Encyclopedia of Genes and Genomes (KEGG) [28] pathway enrichment analysis was carried out in addition to gene ontology (GO) enrichment analysis. KEGG is a comprehensive database that integrates genomic, chemical, and systemic–functional information, and KEGG analysis improved our understanding of the biological functions of DEGs in scallops stimulated by crab. The stress-associated genes were screened out, and the verification and comparison were accomplished by BLAST on the sequences of annotated genes plus selected DEGs so as to guarantee their similarity. The bioinformatic analysis was conducted by Beijing Novozymes Technology Co., Ltd.

2.3.3. qRT-PCR

qRT-PCR validation was conducted on 9 randomly selected DEGs to inspect the reliability of RNA-Seq results, including KIF13B, CYP2C8, ZCCHC8, TRXL, RAD17, OTOF, C25B8.10, CHRNA2, and PROM1A, combined with the reference gene GAPDH, a housekeeping gene. Primer Premier 6 was employed for primer [18–27 bp in length and GC (ratio of bases guanine and cytosine to the total base): 45–55%] design, and Sangon Biotech Co., Ltd. (Shanghai, China) completed primer synthesis. Later, TIANGEN^® FastKing gDNA Dispelling RT SuperMix (Tiangen Biotech, Beijing, China) was utilized to acquire cDNA through the reverse transcription of RNA. The design and synthesis of appropriate primers were also accomplished by Primer Premier 6 (

Table 2. Primers applied in qRT-PCR validation.

Gene Name	Forward Primer (5′-3′)	Reverse Primer (5′-3′)
Gapdh	TGGTATGGCTTTCCGTGTGC	TCCTCTGTGTAACCAAGGAACC
KIF13B	GCAGCCAACCTCAGTCCTAACAG	TCGTGCTCGTCCTCTACCATCAT
CYP2C8	GTTGCTCCTCTTGGCGTTCCT	GGCGACCGACAGAGAATGCT
ZCCHC8	ACCACCACTGCCAATCAACACTC	CCATCACCTGTAGCTCCACCTCT
TRXL	TGTCTACAACACCCGCCAGAAT	ACACCACGAAGCATGGAAGTC
RAD17	ACGAGTCGGAGTTGTGGTCTG	TGCCTGTGCCTTGAGATGTGT
OTOF	GTTGACGGACTCGGACGACATC	GCCTTCAGCACTCGCACAGT
C25B8.10	GTTGAGCTTGGAGCTGGAACAG	GCCACCACAGTCCTAACAGAGT
CHRNA2	GCCGTGCTCAGAATCCACAACT	TCCCGACGACACGCCACAATA
PROM1A	GGTTTGGCTTGGGATGGTGTCT	GCGTGGCTGACCTTGTTGCT

) and Sangon Biotech Co., Ltd. (Shanghai, China), respectively. A LightCycler^®96 real-time PCR system (Roche Diagnostics, Switzerland), together with TIANGEN^® Talent qPCR PreMix (SYBR Green) (Tiangen Biotech, China), was applied to execute qRT-PCR based on the manufacturer’s protocol. The confirmation experiment was conducted using the samples from the same batch of the RNA-seq experiment. Afterward, qRT-PCR was carried out in triplicate following the protocol of 3 min of 95 °C initial denaturation, as well as 45 cycles of 95 °C for 5 s and 60 °C for 15 s. Dissociation curve analysis for the confirmation of target specificity and the 2^−ΔΔCT method [29] for the calculation of relative gene expression were adopted.

2.4. Statistical Analysis

The format of mean ± standard deviation (mean ± S.D.) was selected to express experimental data. All data passed the normal distribution and variance homogeneity test. One-way ANOVA was completed on SPSS25.0 software to explore the movement indicators in the same state (under normal conditions or crab stimulation) with varied specifications or in different states with identical specifications, and a pairwise comparison of indicators presenting significant differences was achieved by LSD. Moreover, the interactions between specifications and states were exploited via two-way ANOVA, where a significant difference was denoted by p < 0.05, and an extremely significant difference was indicated with p < 0.01. The correlation coefficients within and between groups were calculated and plotted as a heatmap according to the Fragments Per Kilobase per Million mapped fragments (FPKM) values of all of the genes in each sample.

3. Results

3.1. Scallop Behavior

Video recordings showed that it was difficult for crabs to prey on scallops and that scallops avoided crabs through continuous closed-shell behavior or movement behavior. In the crab–scallop experiment, the number of jumping and swimming behaviors of each scallop increased significantly in the presence of the crab. These behaviors differed among scallop sizes, as the number of jumps was greater than the number of swims in medium- and large-sized scallops. The number of swimming episodes of scallops of all sizes in the experimental groups stimulated by the presence of crabs was significantly greater than that of the control group (p < 0.05). Additionally, the number of movement behaviors of small- and medium-sized scallops in the experimental group was significantly higher than that of the control group, but there was little difference in this measurement for large-sized scallops in the treatment and control groups (Figure 3).

3.2. Force of Clap

Continuous stimulation by exposure to crabs resulted in different response patterns in different sizes of scallops. Specifically, T_phasic and T_tonic of small- and medium-sized scallops increased significantly relative to the control (p < 0.05), whereas the increases observed for large-sized scallops were not significant (Figure 4). Pressure transducer–dynamometer recordings showed that in the presence of the predator, scallops alternated between phasic and tonic contractions; for large-sized scallops, the phasic contraction force lasted throughout the 3 min experimental period. Under predation stimulation, the number of claps was intensive, and the phasic contraction force of small- and medium-sized scallops increased (Figure 4). The force measurements showed that the larger scallops had a larger clap force than the smaller scallops. Additionally, within a size class, the force of the clap was greater when the predator was present than when it was absent. Over time, the shell-closing ability of scallops of all sizes decreased (Figure 4 and Figure 5).

Figure 5 shows the F_max value and average shell closure frequency of different sizes of scallops. In the presence of the predator, the Fmax of small-sized scallops was only 7.82 N, whereas that of large-sized scallops was 15.45 N. The one-way analysis of variance (ANOVA) revealed a significant difference among the F_max of different-sized scallops (p < 0.05). Significant differences among small, medium, and large scallops, both with and without the predator, were also detected for the closure frequency (the number of times that the cycle of locomotion was completed within a unit of time). Small- and medium-sized scallops closed their shells more frequently than large-sized scallops in both the control and crab-stimulated states. Compared with the control, crab stimulation resulted in an increased frequency of shell closure of scallops of all sizes, and the increase in frequency of small- and medium-sized scallops was statistically significant (p < 0.05). Additionally, the difference in the frequency of shell closure of scallops before and after stimulation was significant within all size classes, but the value was highest for the medium-sized scallops.

Figure 6 shows the F_total, F_phasic, and F_tonic data. Overall, the F_tonic was larger than F_phasic in the control group for all scallop size classes, and the F_tonic in the control group was significantly different from that in the experimental group when the scallops were stimulated by the presence of the predator. According to the results of one-way ANOVA, the differences in F_phasic and F_tonic were not significant between scallops in small and medium sizes without crabs present, but the F_phasic and F_tonic values of these size groups decreased after exposure to the predator (p < 0.05). F_phasic and F_tonic of large-sized scallops were lower than those of small- and medium-sized scallops. The interaction of scallop size with the presence or absence of crabs was also detected to be significant (two-way ANOVA, p < 0.05). The absence or presence of crabs, in addition to size, also had significant effects (p < 0.05) on F_tonic and F_total, and an interaction effect was detected.

3.3. Changes in Enzyme Activity of Scallops Due to Crab Predation

Exposure to the predator significantly affected ODH, SOD, AK, and CAT activities in the scallop gill, adductor muscles, and mantle. Fluctuations in these activities occurred in the tissues after sustained stimulation (Figure 7, Figure 8 and Figure 9). The scallops in different sizes had enzyme activities changed to different degrees in gill tissues after exposure to crabs (Figure 7). Compared to the controls, the gills of medium- and large-sized scallops exposed to the predator exhibited significantly different SOD, CAT, and ODH activities (p < 0.01), and the decline of SOD in medium-sized scallops was the most prominent. The activity of AK declined significantly in each size group (p < 0.01).

In the mantle, crab stimulation led to an extreme decrease in SOD activity (p < 0.01) in medium-sized scallops and an extreme increase in CAT activity but a decrease in AK activity in large-sized scallops (p < 0.01). However, changes in enzyme activities in small scallops were not obvious (Figure 8).

In the adductor muscles, the SOD activity increased significantly (p < 0.01), and the ODH activity decreased significantly (p < 0.01) in large-sized scallops exposed to the predator (Figure 9). Medium-sized scallops showed the most pronounced changes in enzyme activities after exposure to crabs. There were extremely significant rises in SOD and ODH activities (p < 0.01) but significant decreases in CAT and AK activities, in contrast to those in the control group (p < 0.05). The activities of CAT were not different in small-sized scallops, whereas SOD, ODH, and AK activities showed extremely significant differences.

3.4. Transcriptome Results

3.4.1. Transcriptome Sequencing

Immunological measurements showed that the medium-sized scallops had significant differences in enzyme activities in the adductor muscles. Therefore, we selected the adductor muscles from medium-sized scallops in the natural state (control group) and after continuous stimulation by C. japonica for 3 min (experimental group) for transcriptome sequencing. We referred to them as mBJ (medium-sized scallop muscle tissue) and X-mBJ (stimulation by crab medium-sized scallop muscle tissue).

The adductor muscle tissue RNA concentration of mBJ and X-mBJ (X-mBJ1, X-mBJ2, and X-mBJ3) samples ranged from 70.0000 to 289.0000 ng/μL, and the total amount of RNA was 2.4500–9.2480 μg. The RNA integrity value was >6.0, and the samples satisfied the quality requirements needed for library sequencing.

The transcriptome sequencing yielded a total of 58.41–61.74 × 10⁶ raw reads, and with the junctions and low-quality reads removed, 55.62–60.62 × 10⁶ clean reads were acquired, of which the data volume was 54.68 G. The GC percentage was 41.05–43.85%, and the Q20 and Q30 values were over 94.92% and 87.6%, respectively. The highest error rate of a single base was only 0.07%, which showed that our data were highly credible and could be used for subsequent analyses.

3.4.2. DEG Analysis

The correlation coefficients within and between groups were calculated and plotted as a heatmap according to the FPKM values of all genes in each sample. As shown in the left part of Figure 10, the mBJ group was different from the X-mBJ group in the sample correlations.

DESeq (https://bioconductor.org/packages/release/bioc/html/DESeq2.html, accessed on 3 February 2023) for comparison of RNA-seq data between the X-mBJ and mBJ groups and a drawing of a volcano plot were adopted to quickly and intuitively identify the regulation and distribution of the differentially expressed genes (DEGs) in scallop adductor muscle following crab stimulation (right part of Figure 10).

Transcriptome sequencing resulted in 780 significant DEGs consisting of 458 down-regulated genes plus 322 up-regulated genes. The expression ranges of up- and down-regulated genes were comparable, and the overall significance differences were relatively obvious.

3.4.3. Gene Ontology (GO) Functional Enrichment Analysis of DEGs

On the basis of GO database analysis and functional enrichment classification of the 780 DEGs in the X-mBJ vs. mBJ comparison, 198, 98, and 331 DEGs corresponding to the biological process, cellular component category, and molecular function category were annotated. Figure 11 shows the 10 GO entries with the most DEGs enriched for each category. As for the biological process, the enrichment of DEGs was mainly found in the phosphorus metabolic process, cellular nitrogen compound biosynthetic process, and phosphate-containing compound metabolic process. DEGs associated with the cellular component category were mainly enriched in protein-containing complex, cytoplasm, and membrane-bounded organelle processes. Regarding the molecular function category, the enrichment of DEGs occurred in the processes of transition metal ion binding, transporter activity, and transmembrane transporter activity. These results suggested changes in gene expression in scallops of different sizes to different degrees after exposure to predation.

3.4.4. Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis of DEGs

Being a comprehensive database, KEGG incorporates genomic, chemical, and systemic–functional information, so the biological functions of DEGs from scallops stimulated by crab could be further understood through KEGG analysis. A total of 159 DEGs presented enrichment in 86 KEGG pathways, and the top 20 enriched pathways are listed in Figure 12. Among them, ribosome, oxidative phosphorylation, autophagy-animal, purine metabolism, nucleocytoplasmic transport, and ribosome biogenesis in eukaryotes were the most significantly enriched.

3.4.5. qRT-PCR Validation Analysis

qRT-PCR validation analysis was performed on 9 DEGs, and the selected genes had identical expression patterns in close relation to the RNA-Seq results (R² = 0.91). These results confirm that the results of transcriptome analysis were reliable (Figure 13).

4. Discussion

4.1. Role of Crab Predation in Affecting the Shell-Closing Force of Scallops

At present, there are two methods for investigating the physiological status of shellfish: valvometry and photoplethysmography [30]. By virtue of the contraction or diastole of the adductor muscles, for instance, a scallop is able to move slowly or fast away from predators [31]. The shell-opening and shell-closing activities of bivalve mollusks reflect their physiological conditions and responses to changes in the marine environment [32]. The shells of shellfish can protect mollusks from adverse conditions and natural enemies [5,33]. Therefore, closing the shell can effectively separate shellfish from threats from natural enemies and environmental pollution [34]. It is known that bivalves will change their normal shell-opening behavior when responding to adverse conditions [34,35,36]. Under natural conditions, the shell is open and occasionally closed, while under adverse conditions, it will show obvious shell-opening and shell-closing activities [30]. In the present study, a dynamometer was applied to detect the F_max of scallops in large, medium, and small sizes, and analysis was conducted on the T_phasic, T_tonic, F_max, and frequency collected from shell closure data. As shown in the results, for both scallops stimulated and unstimulated by the predator, the Fmax rose with the increase in scallop size, and the presence of crabs induced a greater shell closure force under the F_max of scallops in the same size group, similar to the findings reported by Zhang et al. [17]. Additionally, the experiment used different specifications of crabs to stimulate scallops; the data showed that as the C. japonica specifications were enhanced, the jumps of scallops increased significantly in number, regardless of an apparent increase in swimming behavior. It was speculated from all these findings that scallops preferred the bitemporal contraction response under predator stimulation (that is, scallops escape from predation by rapidly opening and closing the shells to produce jumping behaviors). Zhang et al. [17], who used starfish (Asterias amurensis) to stimulate M. yessoensis, obtained consistent findings.

The thick shell and unique swimming ability of scallops serve as their protective mechanisms in response to stress. The defense mechanism of scallops is influenced by multiple factors. Changes in pH and temperature can affect the physiological processes of scallops. It has been reported that under low pH conditions, the growth of scallops slows down, and the expression of biomineralization functional molecules increases [37]. As a result, scallops increase the thickness of their shells to defend against attacks from external adverse conditions [38]. During the growth/development process of scallops, the growth of their shells involves a complex mobilization mechanism and overall coordination. The strength of the shell of shellfish is related to overall conditions, such as the height/thickness/width of the shell and the presence or absence of protrusions [39]. There are two strategies for scallops to respond to predators: either closing the shells tightly or jumping quickly for evasion. The hard and thick shell provides protection against predators, but, in turn, a heavy shell weakens the swimming ability of scallops. In the case of threats from predators, therefore, scallops experience a trade-off between swimming ability and mechanical protection. Additionally, during individual development, the escape behavior of scallops under predator stimulation is likely to alter over time [20]. The results manifested that the small- and medium-sized scallops exhibited higher T_phasic and T_tonic values after crab stimulation than those in the control group. Moreover, the stimulation led to a significantly increased frequency of shell closure, and frequent shell closure was observed among small-sized scallops in the first 30 s following stimulation. However, the T_phasic and T_tonic values of large-sized scallops showed insignificant variations after stimulation. In contrast to those in the control group, the duration of shell closure was more than twice as long in this experimental group, while the frequency of shell closure was not significantly increased. The results mentioned above suggest that when escaping from predators, small- and medium-sized scallops are prone to locomotor behavior, but large-sized ones prefer shell closure.

During growth, scallops develop thickening shells and the capability of managing predator attacks, while their swimming ability is attenuated [20]. Different species undergo variations in swimming behavior and ability as they grow older and become larger. The scallops in all sizes have decreasing locomotor ability (magnitude of shell closure force plus frequency of shell closure) along with age. The locomotor system of scallops is mainly composed of two parts: the adductor muscle and a ligament. When threatened by predators, scallops escape by ejecting water through the side opening [40]. Different shell structures and adductor muscle morphologies may produce different types of escape responses. Two scallop species, Amusium balloti and Pecten. magellanicus, are active swimmers and escape with phasic contractions throughout. Pecten. fumatus will have a strong burst of phasic contractions after stress, but the duration is very short. The scallop Mimachlamys asperrima starts phasic contractions at a slower speed after being stimulated, while scallop Crassadoma gigantea usually responds to predators by closing its shell, and only in rare cases will it have phasic contractions [41]. Based on the research on Aequipecten opercularis, in the first and second processes of escape responses, smaller individuals presented an increased frequency of shell closure in comparison with larger ones [42], in line with the results of this study on M. yessoensis. Consequently, it was assumed that M. yessoensis in a smaller size are more active, and they perform rapid shell closure to evade predation by C. japonica. In contrast, the frequency of shell closure was decreased, and the duration of shell closure was increased in larger scallops so as to avoid predators.

4.2. Effects of Crab Predation on the Enzyme Activities of Scallops

Given the role of enzyme activity as a fundamental driver for all chemical changes in living organisms, enzyme activity modulation has been recognized as a crucial approach to regulating biological metabolism [43]. Exposure to stressors like predators serves as an influencing factor for the immunity of scallops. Belonging to pivotal immunoenzymes in the immune system of shellfish, SOD and CAT are important participants in the maintenance of a balanced antioxidant system therein [8,44]. Both of them can eliminate and balance reactive oxygen radicals inside cells, becoming vital indicators for the immune defense ability of shellfish [20]. In addition, SOD takes part in defending against biomolecular damage and senescence [45]. Subsequently, SOD, CAT, ODH, and AK were compared between control scallops and crab-stimulated scallops in this research regarding their activities in the adductor muscles. Crab stimulation exerted effects on SOD and CAT activities in scallops of different sizes. SOD activity presented a significant increase in the adductor muscles of large- and medium-sized scallops, whereas it decreased significantly in small-sized ones. We thus postulate that the acute stress response of M. yessoensis to predation by C. japonica will differ according to size and age. We surmise that the decline in SOD in small scallops may be attributed to the enzyme activity rising rapidly in the short term and then dropping promptly, or it may be caused by experimental error. According to Yang et al. [46], the immune response of age II Chinese softshell turtles (Trionyx sinensis) was positively correlated with body weight compared to age I turtles, and an increase in body weight resulted in an increase in the immune response. Mourente et al. [47] found that the antioxidant enzyme activities of male red prawns (Aristeus antennatus) were closely related to body length and age, and the activity of SOD increased with increasing body length. Hao et al. [48] also showed that the antioxidant capacity and high temperature tolerance of older M. yessoensis were significantly higher than those of smaller and younger scallops.

In general, stronger activities of CAT and peroxidase have correlations with greater resistance and free radical-eliminating ability. In the case of an altered living environment for organisms that poses stress on them, the two enzymes experience changes in activities, thereby enabling the adaptation of organisms to the new environment [49]. As uncovered by this study, the CAT activity of adductor muscles of different-sized scallops exposed to crabs decreased to different degrees, with the most prominent reduction in medium-sized ones. On the contrary, medium-sized scallops displayed significantly enhanced SOD activity. It was speculated that in the face of a perceived threat of predation, CAT tended to function in scallops during the elimination of reactive oxygen radicals, but the specific reasons need to be further investigated.

As for marine invertebrates (shellfish in particular), putative ODHs (OpDHs) are important players in anaerobic metabolism. The first OpDH was discovered in 1959 when Van Thoai and Robin found that ODH was produced by an enzymatic reaction in a variety of marine invertebrates [50]. In 1969, Van Thoai et al. isolated and purified ODH for the first time from scallop adductor muscles [51]. Other researchers reported that the ODH-generated octopus enzyme resembles the lactate dehydrogenase-produced lactic acid in vertebrate muscles. Such studies indicate that the elevation of ODH levels is in relation to strengthened swimming ability. The reason is that the hydrolysis of phosphoarginine provides support for adenosine triphosphate (ATP) generation in this activity, and then ODH-catalyzed NADH and L-arginine enable continuous oxidation in subsequence, thus producing octopus alkali, NAD+, and water to guarantee redox balance in cells [51,52].

By analyzing the adductor muscles of scallops, it was discovered that there was an extremely significant difference in ODH activity between the control group and the three size groups (crab-stimulated scallops). Especially among the groups exposed to predation, the ODH activity showed a highly significant increase in medium- and small-sized scallops. As a result, the increased ODH synthesis was assumed to have associations with M. yessoensis regarding acute stress or sudden swimming activity. According to [53], the intense muscle activities, namely, escape and swimming behaviors of bivalves when there is a predator, gain support from ATP produced by phospho-L-arginine trans-phosphorylation and anaerobic glycolysis. In the process of escape response or subsequent recovery, phospho-L-arginine is restored in bivalves through anaerobic glycolysis, ultimately producing octopine. With varying functions in different tissues, octopine was at a higher level in swimming scallops. Argopecten ventricosus, under long-term exposure to predators, have a great mass of adductor muscles and high ODH content [54], consistent with the results of this study on M. yessoensis.

As one of the leading regulatory enzymes for energy metabolism in invertebrates, AK utilizes the enzyme-specific guanidinium receptor to exert an effect on the reversible transfer of phosphate groups between ATP, thereby maintaining a relatively stable level of ATP [55]. AK also has direct or indirect involvement in relevant immune responses [56]. Arginine kinase (AK) plays an important role in energy regulation in most invertebrates [57]. Studies have found that when the ATP supply is sufficient, AK synthesizes phosphagen in one direction. However, in acute stress responses, AK mediates the rapid decomposition of phosphagen in the opposite direction. [58]. AKs probably take part in sustaining normal life activities, enhancing the defense of an organism against detrimental external environments, and facilitating the locomotor behaviors of an organism in the face of environmental threats [59]. Following a 48 h exposure to salinity stress, the activity of the adenylate kinase (AK) enzyme in the muscle of Sepia pharaonis significantly increased, facilitating the maintenance of ATP dynamics [60]. In a separate study, Rosa L. et al. investigated high-temperature stress in Nodipecten subnodosus larvae, revealing a rapid enhancement of respiratory efficiency to mitigate thermal damage and sustain cellular energy homeostasis via aerobic metabolism and the hydrolysis of arginine phosphate in the adductor muscle [61]. Additionally, prior research has indicated that the amino acid composition in scallops is influenced by variations in water temperature and depth [62], with differential expression levels of arginine observed across tissues of scallops of varying sizes [63]. It was indicated in the present study that among all sizes of scallops subjected to crab stimulation, AK activity was down-regulated in diversified tissues. Significant down-regulation of AK expression was observed in the adductor muscles from medium- and small-sized scallops, indicating that muscle stress occurs and energy metabolism is accelerated in scallops with the presence of predators. The aforementioned result suggests a critical role of AK in the muscle movements of scallops under stress. Similar findings have been published [64]. Predation stress can induce explosive locomotor behavior in scallops, consuming a large amount of energy. According to Smits et al. [52], the analysis of enzyme activity in the adductor muscles of scallops performing escape or locomotor behavior demonstrated the participation of AK in vigorous muscle movements. According to Gäde et al. [65], AK decreased significantly in bivalves after jumping locomotor movements, conforming to the current findings for M. yessoensis. The reduced AK expression in the case of predation stress mirrors the incremented demand for stress-related energy as well, while the raised AK content promotes the energy metabolism of the organism. Such a procedure provides the organism with energy to respond to predation stress, thus benefiting the swimming ability and survival of scallops during attack by predators.

4.3. Effects of Crab Predation on the Transcriptome of Scallops

Predator–prey relationships develop gradually in nature, with the predator producing a stress response in its prey [66]. Scallops have a typical escape response that involves a series of rapid valvular internalizations or claps that allow them to jump or swim to escape from the predator [11]. The physiological responses of organisms are mediated by gene expression, predation pressure leads to stress responses in animals, and differential genes may be focused on stress, energy metabolism, immunity, and other related components. In this study, the transcriptome sequencing of adductor muscles of scallops after predation stimulation by crabs yielded 780 DEGs, of which 623 were annotated. GO annotation showed that more differential genes were enriched for the cellular nitrogen compound biosynthetic process, phosphate-containing compound metabolic process, transporter activity, and transmembrane transporter activity than for other processes. These enriched genes indicated that predation stress activated a series of physiological activities in the scallops, including significant up-regulation of complement C1q like 4 (C1QL4).

Being a C1q/TNF superfamily member, C1QL4 is marked by the presented globular C1q domain [67,68,69,70]. The members of this superfamily affect a variety of vital physiological functions, including innate immune response [71], insulin metabolism [72], and synapse homeostasis [73,74]. C1q is part of complement C1 and participates in the classical activation pathway, in which it not only conjugates with antibodies in antigen–antibody complexes but also activates C1r and C1s. Consequently, C1q plays a crucial role in bridging acquired and innate immunities, while C1q-like proteins have been identified from numerous taxa (e.g., Lampetra japonica, Branchiostoma, Pyrosomella verticilliata, and Echinocardium) [75]. In addition to its performance in classical activation pathways, C1q is involved in a number of immune processes [76], including the removal of regulatory cells for immune tolerance maintenance [77,78], such as B cells [79,80], T cells [81], and fibroblasts [82]. Such processes as development [83] and trauma healing [84] are also associated with C1q. In studies on rodents, C1QL4 expression was modulated by developmental and hormonal factors, which triggered an acute response by activating steroids [85]. The scallops researched herein showed a significant up-regulation of C1QL4 after exposure to the predator. We hypothesize that this predatory stress induced changes in scallops from the aspects of energy metabolism and cellular function that were associated with the expression of C1QL4. Therefore, C1QL4 may play a role in scallops when responding to predatory stimuli.

The expression of kinesin family member 13 B (KIF13B), adenylate kinase 9 (AK9), and hemicentin (HMCN) genes presented significant changes in scallops after predator stimulation, as revealed by transcriptome sequencing. KIF is a superfamily of microtubule-associated motor proteins that possess different functions in cells, like mediating intracellular vesicle and organelle transport, as well as cytokinesis [86], and transport cellular material along microtubules by virtue of the energy resulting from ATP hydrolysis [87]. It plays a central role in controlling synaptic function, as well. According to Willemsen et al. [88], KIF4A and KIF5C in the hippocampal neurons of rats have pivotal regulatory effects on both excitatory and inhibitory synaptic transmission. In the research conducted by Andrea Serra-Marques et al. [89], the dynamics of Rab6 vesicle transport from the Golgi apparatus to the cell periphery in HeLa cells revealed that KIF13B plays a pivotal role in the majority of this transport process. Furthermore, Rab6 was shown to direct secretory vesicles to specific plasma membrane regions enriched with the cortical protein ELKS, a known binding partner of Rab6 [90]. Investigations by Richard G. Held et al. utilizing conditional knockout mice for ELKS demonstrated that this protein enhances the readily releasable pool (RRP) of excitatory synapses [91]. These findings collectively suggest that KIF13B serves a positive regulatory function in excitatory synaptic transmission within neurons. In vivo, KIF13B binds to vascular endothelial growth factor to act together in cells to promote endothelial cell growth, which is crucial in the growth of blood vessels [92]. In this experiment, KIF13B in the adductor muscle of M. yessoensis was significantly up-regulated after predation stimulation by Charybdis japonica. Thus, it is speculated that predation stimulation from C. japonica may cause stress in M. yessoensis, leading to changes in synaptic function to cope with predation by predators.

AK is a monomeric enzyme found throughout plants, animals, and microorganisms that plays an important role in energy metabolism, as well as a variety of biological processes within the cell. AK9 is the ninth isoform of AK [93]. The main function of AKs is to catalyze the interconversion between adenosine diphosphate (ADP) and ATP: ATP + AMP ↔ 2ADP. When the levels of ATP and ADP change, so do the levels of AMP, thus enabling AMP-influenced enzymes and compounds to receive stress signals and respond metabolically [94]. AK and the downstream AMP signaling system are an integrated metabolic monitoring system in the body. This system senses and regulates the cellular energy state and transmits signals to metabolic sensors to maintain the energy balance of the organism and respond to various stresses by altering the cellular energy metabolism through growth factors and hormones [94]. AKs are most widely distributed in organisms such as arthropods [95], protozoa [96], nematodes [97], molluscs [98], and cnidarians [99]. According to Yang [100], an AK4 knockdown experiment was conducted in male zebrafish, revealing alterations in cellular energy status and an increase in cellular death within the spermatheca. Yang et al. [63] cloned four adenylate kinase (AK) genes (PyAK1-4) from the genome of P. yessoensis and conducted a systematic identification and expression analysis during individual development in adult muscle tissues and under low pH stress. Their findings revealed significant variations in PyAK expression throughout the growth and developmental stages of scallops, indicating that the roles of PyAK differ during these processes. In parallel, Shi et al. identified an AK gene (CfAK) in Chlamys farreri, demonstrating its expression across various developmental stages and its ubiquitous presence in most tissues of adult scallops. Furthermore, the research indicated that CfAK is involved in energy generation and utilization throughout the life cycle of C. farreri, and it may also play a role in immune regulation by modulating nitric oxide concentration and inducible nitric oxide synthase activity [101]. In our experiment, AK9 expression in the adductor muscles of scallops was down-regulated after predation stimulation. We propose that scallops respond to predators by accelerating their metabolism under predatory conditions, thus enhancing their ability to escape and reducing stress-induced damage.

HMCN1, a member of the hemicentin family of proteins, is an extracellular matrix protein that encodes immunoglobulins [102]. It is involved in the formation of the dynamic base of the cell and has important roles in cell organization, migration, invasion of the basement membrane, and formation of stable cell–cell contacts [103]. Chowdhury et al. [104] found that HMCN1 can direct fibroblast differentiation, regulate the formation of stress fibers during differentiation, and induce transforming growth factor-β-mediated effects. Carney et al. [105] studied zebrafish and found that HMCN1 mutation defects led to developmental defects, such as blistering of fins. Additionally, HMCN1 in mammals plays an important role in tissue development and injury response [106]. We found that HMCN1 expression was down-regulated in scallops after they were stimulated by predation. We hypothesize that it is also involved in regulating the stress or escape behavior of scallops, but the specific regulatory mechanism needs to be further investigated.

In marine fish exposed to predators, the expression of genes such as prominin 1A (PROM1A) was down-regulated, and members of the zinc finger protein family and kinesin family were up-regulated [107]. In our study, the expression levels of DEGs such as ZCCHC8, a member of the zinc finger protein family, and KIF13B, C1ql4, and OTOF, members of the kinesin family, were up-regulated, and DEGs such as CHRNA2, HMCN1, and PROM1A were down-regulated. Therefore, we hypothesize that these genes could play a regulatory role when scallops are stimulated by predators, but the specific regulatory mechanism needs to be further verified.

4.4. Differences in Escape Behaviors of Scallops

In nature, animals exhibit diverse locomotor behaviors to forage for food, attract mates, and evade predators [108]. Scallops demonstrate a distinctive escape response among bivalve mollusks, owing to their exceptional swimming capability, which is activated upon encountering threats. To evade predators, scallops employ swimming behavior [109]. During swimming, the phasic adductor muscle rapidly contracts to produce the majority of propulsion, while the tonic adductor muscle facilitates the prolonged closure of the shell, aiding in the recovery of physical strength [110]. Researchers have observed that the swimming behavior and locomotion mode of the giant scallop, P. magellanicus, vary with body size [111]. Smaller scallops typically exhibit an upward jumping motion, while medium-sized scallops swim in a straight line, allowing for smooth movement over moderate distances [111,112,113]. In contrast, larger scallops are limited to short swimming distances due to their heavier shells. Notably, medium-sized P. magellanicus, with a shell height ranging from 40 to 80 mm, are identified as the fastest swimmers [112].

The size of scallops influences the endurance of escape responses and the frequency of shell closure. As scallops grow, larger individuals develop more robust adductor muscles, leading to a higher proportion of myofibrillar proteins in their muscles, along with an increased ATP catalytic capacity of myosin. Consequently, the catalytic efficiency of myosin for ATP may enhance with the increase in scallop size [108]. Additionally, the adductor muscle exhibits a longer extension distance and greater angle of inclination [114]. The force produced during the rapid opening and closing of the shell is significantly greater in larger scallops. Consequently, these larger individuals often exhibit enhanced escape capabilities alongside strong recovery abilities. When the size of P. magellanicus reaches a certain threshold, the likelihood of predation decreases substantially [115,116], prompting them to adopt a strategy of shell closure and remain motionless in response to environmental changes.

Thus, we propose that the escape behaviors of scallops of varying sizes are influenced not only by individual size and shell shape but also by the functional utilization of muscle tissue, muscle metabolic capacity, and predation pressure, continuously evolving with scallop growth and development. In response to predation threats, smaller scallops tend to employ rapid and multiple shell-closing and snapping behaviors for escape, while medium and large scallops adapt to predation pressure by increasing shell-closing force, reducing the frequency of closures, and extending the duration of shell closure.

4.5. Effects of Environment on Scallops

The substantial absorption of carbon dioxide by the ocean has led to ocean acidification [117]. Increasingly severe changes in parameters such as pH, temperature, salinity, oxygen levels, and food supply pose multiple challenges for benthic organisms, including bivalve mollusks [118]. Acidic conditions characterized by low oxygen and low pH adversely affect scallop shell calcification and overall survival [119]. Existing research has demonstrated that changes in seawater pH resulting from ocean acidification impact scallop calcification and survival rates [120,121]. Gaylord et al. [122] found that reduced pH levels lead to thinner and weaker larval shells in M. californianus, consequently slowing the growth and development of its congeneric species.

Bivalve mollusks possess a highly developed sensitivity to environmental changes [123]. Environmental factors influencing marine organisms interact synergistically, collectively affecting their growth, development, and physiological processes [124,125]. Experiments have demonstrated that an abundant food supply can provide the necessary energy for calcifying organisms in acidified ocean waters, enabling them to sustain normal life activities, growth, and development under ocean acidification (OA) conditions [126]. Furthermore, an adequate food supply can also assist bivalve animals in dealing with adverse environmental circumstances, such as extreme temperatures [127] and hypoxia [128], and mitigate the harm inflicted by harsh conditions.

Marine animals possess two strategies for addressing predation risks, namely avoidance adaptations and escape adaptations [129]. Numerous prey species will manifest defensive behaviors upon detecting predators, and the intensity of escape responses augments with the escalation of predation risk. Legault et al. [109] investigated the escape behaviors of bivalve mollusks Serripes groenlandicus and Clinocardium ciliatum, discovering that they exhibit strong reactions to major predators but minimal responses to those that rarely prey on them. This highlights the influence of predation risk on the evolution of defensive strategies in marine bivalves. Harvey et al. [130] and subsequent research have observed that juvenile Buccinum undatum lack the pronounced escape responses characteristic of their adult counterparts. Additionally, comparative studies have indicated that the shells of wild-caught scallops are more robust than those of their cultivated counterparts [131].

The complex development of scallops is shaped by numerous factors affecting their locomotor behavior, such as shell calcification, physiological changes, swimming, escape responses, temperature, and age. Bivalves adapt their predation-avoidance tactics across different life stages and conditions.

5. Conclusions

In summary, we found that predation by C. japonica causes stress and related physiological responses in M. yessoensis. Small- and medium-sized scallops tend to escape from predation by rapid swimming and other escape behaviors, whereas large-sized scallops tend to close their shells and remain motionless. During this time period, physiological activities such as enzyme activity, substance metabolism, and cell proliferation are regulated to cope with predation stress. Previous studies have demonstrated that scallop farming is influenced by multiple factors, including temperature, pH, food availability, predator presence, and the substrate conditions of habitats. Based on these findings, we recommend that artificial scallop farming should involve careful consideration of stocking density and size. Furthermore, it is advisable to select sea areas with sandy and gravelly sediments while ensuring a sufficient supply of food resources.