Next Article in Journal
Compatibilities of Cyprinus carpio with Varied Colors of Robotic Fish
Previous Article in Journal
Environmental Influences on Illex argentinus Trawling Grounds in the Southwest Atlantic High Seas
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 6
10.3390/fishes9060210
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Different Concentrations of Hydrogen-Rich Water on the Growth Performance, Digestive Ability, Antioxidant Capacity, Glucose Metabolism Pathway, mTOR Signaling Pathway, and Gut Microbiota of Largemouth Bass (Micropterus salmoides)

by
Yin Yuan
1,
Huixiang Li
2,
Songwei Chen
2,
Yongchun Lin
3,
Jiangyuan Peng
4,
Junru Hu
5,* and
Yongsheng Wang
1,*
1
Kunpeng Institute of Modern Agricultural Research at Foshan, Foshan 528225, China
2
School of Life Sciences and Engineering, Foshan University, Foshan 528225, China
3
Guangdong Cavolo Hydrogen Technology Company Ltd., Foshan 528200, China
4
Yingde Jinyuan Agricultural and Animal Husbandry Products Development Company Ltd., Yingde 511500, China
5
Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(6), 210; https://doi.org/10.3390/fishes9060210
Submission received: 30 April 2024 / Revised: 30 May 2024 / Accepted: 31 May 2024 / Published: 1 June 2024
(This article belongs to the Section Physiology and Biochemistry)
Browse Figures
Versions Notes

Abstract

:
Hydrogen-rich water (HRW) is widely recognized for its growth promoting, antioxidant, and anti-inflammatory properties. However, little is known about the role of HRW in aquaculture. This study aims to investigate how different concentrations of HRW affect the growth performance, digestive ability, antioxidant capacity, mTOR signaling pathway, and gut microbiota of juvenile largemouth bass. We randomly assigned 360 fish (13.73 ± 0.1 g) to three treatments. The control group was maintained in regular water, while the treatment groups were treated with different concentrations of H2 dissolved in water, which were H1 (179.65 ± 31.95 ppb) and H2 (280.65 ± 64.43 ppb), respectively. Through an analysis of the three treatments, it was found that H1 significantly increased the final body weight, weight gain rate, specific growth rate, and survival rate, and reduced the feed conversion ratio (p < 0.05). In addition, the trypsin activity was significantly increased in the intestine (p < 0.05), and the expression of genes related to the glucose metabolism (pk and pepck) and mTOR (tor, akt, s6k1, 4ebp1, and ampka) signaling pathways were significantly increased in the liver in H1 (p < 0.05). The relative abundance of Blautia in the gut microbiota (p < 0.05) was significantly increased in H1. Therefore, these results indicated that H1 can significantly improve growth performance, promote intestinal digestion, activate the glucose metabolism pathway and mTOR signaling pathway, and increase the abundance of beneficial bacteria in the gut of largemouth bass. These findings provided valuable support for the application of HRW to support the healthy aquaculture of largemouth bass.
Keywords:
hydrogen rich water; growth performance; glucose metabolism; mTOR pathways; gut microbiota; largemouth bass
Key Contribution: In order to promote the sustainable development of largemouth bass aquaculture, we explored the impact of different concentrations of hydrogen-rich water on largemouth bass, and the results showed that H1 can significantly improve growth performance, promote intestinal digestion, activate the glucose metabolism pathway and the mTOR signaling pathway, and increase the abundance of beneficial bacteria in the gut of largemouth bass. The findings may provide valuable support for the application of HRW to support the healthy aquaculture of largemouth bass.

1. Introduction

With the rapid development of aquaculture across the world, the global food consumption pattern has been profoundly changed, bringing enormous economic profits to fishermen [1]. The largemouth bass (Micropterus salmoides) is one of the most widely cultivated freshwater aquatic animals in China due to its short breeding period, rapid growth, delicious taste, easy cultivation, and tender meat quality, meaning it has high economic benefits [2]. Recently, the degradation of germplasm resources, high-density aquaculture, and the deterioration of water quality have seriously constrained the sustainable development of largemouth bass aquaculture.
Hydrogen is the most broadly distributed and lightest chemical element [3]. Hydrogen is the future of energy with a role in the clean, efficient, and easily scalable energy storage [4]. Hydrogen agriculture belongs to a low-carbon economy [5]. In 2007, a study found that hydrogen alleviated oxidative damage caused by cerebral ischemia by clearing excess reactive oxygen species [6]. From then on, the research on hydrogen has paid close attention to people. The application of hydrogen in agriculture was focused on the planting industry. It was found that hydrogen can improve crop productivity and promote growth and development [7,8]. Most of the studies were performed in rodents and humans, with only a few being performed in pigs and rabbits [9]. It was found that hydrogen-rich water (HRW) protected against fusarium mycotoxin-induced intestinal injury in female piglets [10]. And it can alleviate steroid related bone necrosis by inhibiting oxidative stress in rabbits [11]. Furthermore, HRW can improve the intestinal structure and antioxidant properties and significantly alter egg quality in hens [12]. However, little is known about the use of hydrogen rich water in aquatic animals. In 2017, the application of HRW was first reported in zebrafish [13]. Recently, a study indicated that HRW can improve the growth performance of juvenile largemouth bass by increasing feed intake, reducing serum lipids, activating the mTOR and Nrf2 signaling pathways, and altering their intestinal microbiota [14]. However, there is a lack of appropriate concentrations of HRW for the cultivation of largemouth bass.
As is well known, the mammalian target of rapamycin (mTOR) contributes to cell growth, metabolic regulation, cytoskeleton remodeling, and cell survival [15,16]. It can also promote the survival of animals during different types of environmental emergencies [17]. In addition, the gut microbiota plays an important role in development, metabolism, and immunity [18]. Studies have shown that HRW can activate the mTOR signaling pathway and improve the gut microbiota [19,20], but its application in aquatic animals is poorly understood.
This study injected different concentrations of hydrogen into the aquaculture water of largemouth bass, and analyzed its effects on the growth performance, histological changes, biochemical indicators, oxidative stress system, carbohydrate metabolism, TOR signaling pathway, and intestinal microbial community. We aimed to provide a theoretical basis for the application of HRW in the healthy breeding of largemouth bass.

2. Materials and Methods

2.1. Ethics Statement

The use of juvenile largemouth bass in this study complied with the animal welfare laws, guidelines, and policies, as approved by the Scientific Ethic Committee of Kunpeng Institute of Modern Agriculture at Foshan, China. To minimize the stress response during sampling, largemouth bass were anesthetized with 100 mg/L tricaine methanesulfonate (MS222, Fujian Jinjiang Shengyuan Aquatic Products Co., Ltd., Quanzhou, China) prior to all sampling tests.

2.2. Fish Culture

We obtained juvenile largemouth bass from Jinyuan Agricultural and Animal Husbandry Products Development Co., Ltd. (Yingde, China). The experiment was conducted in an indoor recirculating system at Kunpeng Institute of Modern Agricultural Research at Foshan, and fish were fed commercial feed produced by Foshan Jieda Feed Co., Ltd. (Foshan, China) (crude protein ≥ 48.20%, crude lipid ≥ 11.30%, crude ash ≤ 12.60%) for acclimation for 2 weeks. In this study, three treatments were set up, including control (0 ppb), H1 (179.65 ± 31.95 ppb), and H2 (280.65 ± 64.43 ppb). Hydrogen was produced by electrolysis of water using PEM proton exchange membrane equipment, and two concentrations were generated to be introduced to the H1 (600 ppb hydrogen production per hour and per ton water) and H2 (1000 ppb hydrogen production per hour and per ton water) groups, respectively. Subsequently, to control the actual hydrogen concentration in culture water and stability during the experiment period, we monitored the value in the water every 10 days using the ORP electrode (Sensorex, Garden Grove, CA, USA). The experimental hydrogen production equipment and hydrogen inspection equipment were provided by Guangdong Cavolo Hydrogen Technology Co., Ltd. (HIM-19-07, Foshan, China) The juvenile largemouth bass were healthy and evenly sized (13.73 ± 0.10 g) and randomly assigned to one of the three treatments. Each treatment was replicated 4 times with 30 fish per replicate (n = 360) which were kept in a tank (125 L) for 56 days. During the experiment, feed thrice daily at 7:00, 12:00, and 18:00, respectively. The daily feeding rate was adjusted according to the previous day’s feed intake, which ranged from 3 to 5% of the total weight of largemouth bass in each tank. During the acclimatization and experiment, water temperature was maintained at 24 ± 1.00 °C with a pH of 8.00 ± 0.50 and dissolved oxygen of 6.60 ± 0.30 mg/L. Largemouth bass were fed three times/day with commercial feed.

2.3. Sample Collection

At the end of the experiment, largemouth bass were weighed and counted after 24 h fasting. Livers and whole intestines were dissected from 12 fish from each treatment (3 fish for each tank). To prepare a 10% tissue homogenate, we took 0.1 g of liver and 0.9 mL of 0.65% normal saline which were then homogenized. After centrifugation at 4000 rpm at 4 °C for 10 min, the supernatant was removed and stored at −80 °C. We subsequently pooled equal amounts of the total protein from 3 liver and intestine sample from each pond for the analysis of enzyme activity. In addition, the livers from 3 fish per treatment were collected and maintained at −80 °C until they were required for RNA isolation. One section of the intestine from 4 fish per treatment was stored in 4% paraformaldehyde solution for histological analyses. The intestines from 4 fish per treatment were collected and maintained at −80 °C until required for DNA isolation.

2.4. Biological Analyses in Largemouth Bass Tissues

To evaluate the histopathological changes in the intestines of 4 fish per treatment were removed aseptically and then stored in 4% paraformaldehyde solution. The embedded tissue was cut into 5-μm thick sections. Samples were then stained with hematoxylin-eosin (H/E) solution. Histological changes were studied using a microscope (ECLIPSE, Nikon, Tokyo, Japan). Subsequently, CaseViewer2.4 software was used to select the target area of the tissue for 50× imaging. Then, the muscle layer thickness, mucosal thickness, villus width, and villus height at 5 locations were measured from each section using Image-Pro Plus 6.0, with 1-mm as the standard unit, and the average value was calculated.
The whole intestines from 4 fish per treatment were collected to quantify digestive enzyme activities. Amylase, trypsin, and lipase activities were measured using commercial kits based on the starch iodine chromogenic method, the α-Benzoyl-L-arginine ethyl ester substrate, and the methyl halogenating substrate, respectively. Furthermore, the supernatant’s protein content was determined using commercial kits based on the bicinchoninic acid method. All steps, including reagent preparation, homogenization, and experimental procedures, adhered to the precise instructions provided by Nanjing Jiancheng Bioengineering Institute, Nanjing, China.
The livers from 4 fish per treatment were collected to quantify antioxidant enzyme activities. The activities of superoxide dismutase, glutathione peroxidase, and catalase were determined with commercial kits based on the water-soluble tetrazolium-1 (WST-1) method, the colorimetric method, and the ammonium molybdate method, respectively. The contents of malondialdehyde, hydrogen peroxide, and nitric oxide were determined with commercial kits based on the thiobarbituric acid (TBA) method and the colorimetric method, respectively. All kits used were purchased from Nanjing Jiancheng Bioengineering Institute. The reagent preparations and operations were performed according to the specific kits’ operating instructions.

2.5. DNA Extraction and 16s rRNA Gene Sequencing

The microbial community structure and the diversity of the control and treatment groups (H1 and H2) were analyzed by high-throughput sequencing technology. Microbial DNA from intestines from all groups was extracted with FastDNA® Spin Kit for Soil (MP Biomedicals, Santa Ana, CA, USA). All the samples were analyzed by Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China). The V3-V4 variable region of the 16S rRNA gene was amplified by PCR. The TruSeq®DNA PCR-free Sample Preparation Kit (Illumina, San Diego, CA, USA) was employed to create genomic libraries, with each sample being indexed accordingly. The MiSeq PE300/NovaSeq PE250 platform (Illumina, San Diego, CA, USA) was used for sequencing the libraries, and the sequences were uploaded to the GenBank database (accession number: PRJNA1086655). Moreover, the overall microbial composition was obtained with beta analysis through partial least squares discriminant analysis in the Majorbio platform.

2.6. RNA Extraction and qPCR Amplification

Eastern® Super assay kit (Promega, Shanghai, China) was used to extract total RNA from the livers of the largemouth bass (n = 12). The quality and integrity of RNA were examined by a NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA) and assessed by electrophoresis on 1% agarose gel, respectively. The cDNA was synthesized with a Goldenstar™ RT6 cDNA Synthesis Kit (TsingKe, Beijing, China) and stored at −20 °C. The qPCR amplification was used to evaluate the mRNA level of the target genes. Target genes included keap1, sod, cat, pk, pepck, tor, akt, s6k1, 4ebp1, and ampka. All specific primers were designed by primer3 plus and synthesized by TSINGKE Biological Technology Co., Ltd. (Guangzhou, China) (Table 1). The 2−ΔΔCt method was used to calculate the relative expression of target genes [21].

2.7. Statistical Analysis

Survival rate (SR, %) = 100 × (final Micropterus salmoides number/initial Micropterus salmoides number).
Weight gain ratio (WGR, %) = 100 × (final body weight − initial body weight)/initial body weight.
Specific growth rate (SGR, %d−1) = [ln (FBW) − ln (IBW)]/56 × 100.
Feed conversion ratio (FCR) = feed intake (g)/weight gain (g).
All data were analyzed by One-way ANOVA tests using SPSS 22.0 (IBM SPSS Statistics for Windows, Version 22.0, Armonk, NY, USA). Then, Tukey’s multiple comparison method was used to test whether there were significant differences (p < 0.05) between the treatments, which was indicated through the lowercase letter “a”, “b”, “c”. Values were presented as mean ± standard deviation (SD). GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA) was applied to plot the data.

3. Result

3.1. Effect of Hydrogen on the Growth Performance of Largemouth Bass

The growth performances of the largemouth bass are presented in Table 2. The results showed that the FWBs, WGRs, and SGRs of the treatment groups (H1 and H2) were significantly higher than those of the control group (p < 0.05). The FCRs of the treatment groups (H1 and H2) were significantly decreased compared to the control (p < 0.05). The H1 treatment group showed the highest SR.

3.2. Histological Observation

No significant changes were observed in the intestines of the largemouth bass after the hydrogen was injected (Figure 1A), with no differences being observed in muscle layer thickness, mucosal thickness, villus width, and villus height between the treatment groups (H1 and H2) and the control (Figure 1B, p > 0.05).

3.3. Effect of Hydrogen on Biochemical Indicators of Largemouth Bass

As shown in Table 3, with the injection of hydrogen, the amount of Trypsin in the intestine increased significantly in the H1 group, while Lipase decreased significantly in 4the H2 (p < 0.05). For the liver, the results showed a significant increase in malondialdehyde content (MDA) in the H2 group (p < 0.05). However, the hydrogen peroxide (H2O2) and nitric oxide (NO) contents decreased significantly in the H1 and H2 groups, respectively (p < 0.05). Compared with the control, no significant changes were observed in the contents of superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), and catalase (CAT) in the H1 and H2 groups, respectively (p > 0.05).

3.4. Effects of Hydrogen on the Oxidative Stress System, Carbohydrate Metabolism, and TOR Pathway of Largemouth Bass

The expression of keap1 decreased significantly after injecting the bass with H2 hydrogen compared with the control (Figure 2, p < 0.05). The expressions of pk, pepck, tor, akt, s6k1, 4ebp1, and ampka increased significantly after injecting the bass with H1 hydrogen compared with the control (p < 0.05). The expressions of keap1, sod, and cat showed an increasing trend in H1.

3.5. Effects of Hydrogen on Microbial Diversity

The ACE, Chao I, Shannon, and Sobs indices indicated that the number of microorganisms in the H1 group was significantly higher than that in the control group (Figure 3A, p < 0.05). We can see that, after injecting the hydrogen, the control and the treatment (H1 and H2) have different patterns of microbial community composition at the phylum and genus levels (Figure 3B). At the phylum level, the intestineal microbial taxa were dominated by Actinobacteriota, Proteobacteria, and Firmicutes. Compared with the control, the relative abundance of Actinobaciota increased in the H1 group, while the relative abundance of Proteobacteria and Firmicutes decreased. The relative abundance of Proteobacteria increased in the H2 group, whereas that of Actinobaciota and Firmicutes decreased. At the genus level, the intestinal microbial taxa were dominated by Rhodococcus, Mycoplasma, Enterobacter, Aeromonas, and Citrobacter. Compared with the control, the relative abundance of Enterobacter, Aeromonas, and Citrobacter decreased in H1, whereas that of Rhodococcus and Mycoplasma increased. The relative abundance of Rhodococcus and Citrobacter decreased in H2, while the relative abundance of Mycoplasma, Enterobacter, and Aeromonas increased.

3.6. Effect of Hydrogen on the Difference in Microbial Community Composition of Phylum Level and Genus Level

The abundances of Bacteroidota, Cyanobacteria, Chloroflexi, Acidobacteriota, Myxococcota, and Methylomirabilota at the phylum level in H1 were significantly higher than those in the control group (Figure 3C, p < 0.05). The abundances of Pseudomonas, Bacteroides, and Faecalibacterium and so on at the genus level in H1 were significantly higher than those in the control group (Figure 3D, p < 0.05).

4. Discussion

The present study indicated that HRW significantly promoted the growth performance of largemouth bass, which means that HRW can be used as safe aquaculture water. Compared with the control, the treatments showed significantly higher rates of weight gain and specific growth. This is similar to results observed in piglets [10]. On the contrary, long-term (180 days) HRW (1200 ppb) intervention can reduce the weight of rats [22]. Therefore, there was a dose-response effect of hydrogen on animal growth [23]. In order to explore the appropriate concentration of hydrogen in largemouth bass, we set up two treatments. Our study also found that HRW can improve the survival rate of largemouth bass with better effects at the H1 concentration compared to H2. Similarly, the research has shown that 1% (60 ppb) and 4% (240 ppb) HRW increased the survival rate of Danio rerio infected with Aeromonas hydrophila, with 1% having a better protection efficiency than 4% [13]. However, 100% hydrogen-rich water had no inhibiting effect on the normal (non-infected) Danio rerio [24]. The differences in the species (Micropterus salmoides vs. Danio rerio) and gas type (H2 vs. H2/O2) between our study and others could explain this difference in results. Noticeably, the previous study found that HRW significantly increased the food intake of juvenile largemouth bass (3.55 ± 0.01 g), but had no effect on feed efficiency after culturing for 42 days [14]. However, we found that HRW significantly decreased the feed efficiency of juvenile largemouth bass (13.73 ± 0.10 g), but had no effect on feeding intake after culturing for 56 days. This may be due to differences in the cultivation time and fish specification.
The digestive enzyme activity of fish is an important indicator that reflects their digestive functions [25]. Trypsin is a proteolytic enzyme that plays a crucial role in the growth and development of fish [26]. Our study found that H1 had the highest intestinal trypsin activity, indicating that hydrogen may enhance the digestive ability of largemouth bass. mTOR is a serine/threonine protein kinase in the PI3K related kinase (PIKK) family, which forms catalytic subunits of two different protein complexes called mTOR complexes 1 (mTORC1) and 2 (mTORC2) [27]. mTOR is the core component of mTORC1, and the best substrate for characterizing mTORC1 is S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E (eIF4E) binding protein 1 (4E-BP1) [28]. The activation of mTORC1 can regulate cell growth and metabolism [15]. According to other reports, the activation of the mTOR signaling pathway can promote the growth performance of Cyprinus carpio and abalone [29,30]. Similarly, in our study, the mTOR signaling pathway was activated in the largemouth bass, which was consistent with a previous study. Therefore, hydrogen may promote the growth performance of largemouth bass.
Hydrogen is defined as an antioxidant that selectively scavenges toxic free radicals, exerting a protective effect on organs by regulating oxidative stress [31,32]. SOD is the main antioxidant enzyme in cells and also a free radical scavenger [33]. SOD converts the superoxide anions into H2O2, which is detoxified to H2O through GSH-Px and CAT [34]. MDA is the final product of lipid oxidation, the activity of which can directly reflect the level of oxygen free radicals released by the body, and its expression can indirectly reflect the degree to which cells are attacked by free radicals [35]. A lot of reports revealed that HRW can increase the activity of SOD, GSH-Px, and CAT, and reduce the content of MDA in animals, plants, and humans [36,37,38,39]. This study indicated that the H1 group has no significant effect on the SOD, GSH-Px, CAT, and MDA of largemouth bass, which may show that the experimental subjects have not been affected by external substances and have always maintained a healthy state. However, the H1 group showed a significant decrease in H2O2, while the H2 group showed an increase in MDA. A further exploration showed that H1 has a better effect than H2.
Hydrogen stimulates the expression of specific genes to improve the metabolism of glucose [40]. As we know, the largemouth bass, as a carnivorous fish, has a poor carbohydrate utilization ability [41]. PK and PEPCK are the key rate-limiting enzymes for glycolysis and gluconeogenesis, respectively [42]. In our study, the expression of pk at the mRNA level in the liver was significantly increased in the H1 group, indicating that a low concentration of hydrogen may improve largemouth bass’ ability to utilize sugar. Numerous studies have shown a positive correlation between liver glycogen metabolism (synthesis and decomposition) and blood glucose levels [42,43]. We found that PEPCK increased in the H1 group while it remained unchanged in the livers of the fish in the H2 group, suggesting that the ability of gluconeogenesis is related to hydrogen concentration.
The intestine is the site of the digestion and absorption of nutrients in fish, as well as the first barrier against harmful substances entering the fish’s body. Histological changes can affect the intestinal barrier, thereby affecting the health of fish [44]. This study showed that no significant changes in the muscle layer thickness, mucosal thickness, villus width, and villus height occurred in largemouth bass treated with HRW. This is consistent with previous research [23]. This result indicates that HRW maintains the integrity and stability of the intestinal structure. It is worth noting that some studies have reported the regulatory effect of H2 on the gut microbiota [45,46,47]. However, there were only a few reports on the effects of H2 on gut bacteria in fish [23]. Some studies have shown that HRW or H2 can alter the structure of gut microbiota, increasing its abundance and diversity [46,48]. Similarly, in our present research, we found that HRW can increase microbial communities. Furthermore, at the genus, the H1 group significantly increased the relative abundance of Blautia in the intestine of largemouth bass. Blautia is an anaerobic bacterium with probiotic characteristics, which can biotransform and regulate host health and alleviate metabolic syndrome [49]. Therefore, it is assumed that an appropriate concentration of HRW may be beneficial for the alteration of the gut microbiota in largemouth bass.

5. Conclusions

Our research indicated that HRW with a concentration of 179.65 ± 31.95 ppb has a good effect on the growth performance of juvenile largemouth bass. This effect may be attributed to an increase in digestive enzyme activity and gene expression related to the glucose metabolism and mTOR pathways, as well as an increase in the abundance of beneficial gut microbiota. HRW with a concentration of 179.65 ± 31.95 ppb may be used as a beneficial supplement for the growth of juvenile largemouth bass.

Author Contributions

Conceptualization, Y.Y. and Y.W.; Methodology, Y.Y., H.L. and S.C.; Formal analysis and investigation, Y.Y., H.L. and S.C.; Resources, Y.L. and J.P.; Writing—original draft preparation, Y.Y.; Writing—review and editing: Y.W.; Funding acquisition: Y.W.; Supervision: J.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Excellent Fish Program of Kunpeng Institute of Modern Agricultural Research at Foshan, China (2023002).

Institutional Review Board Statement

The use of Micropterus salmoides in this study complied with the animal welfare laws, guidelines, and policies, as approved by the Scientific Ethic Committee of Kunpeng Institute of Modern Agriculture at Foshan, China (20230301).

Informed Consent Statement

Not applicable.

Data Availability Statement

No data was used for the research described in the article.

Conflicts of Interest

The Authors Songwei Chen and Yongchun Lin were employed by the company Guangdong Cavolo Hydrogen Technology Company Ltd., Jiangyuan Peng Foshan 528200, China. Yingde Jinyuan was employed by Agricultural and Animal Husbandry Products Development Company Ltd., Yingde 511500, China. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Bohnes, F.A.; Hauschild, M.Z.; Schlundt, J.; Nielsen, M.; Laurent, A. Environmental sustainability of future aquaculture production: Analysis of Singaporean and Norwegian policies. Aquaculture 2022, 549, 737717. [Google Scholar] [CrossRef]
  2. Li, R.; Wen, Z.Y.; Zou, Y.C.; Qin, C.J.; Yuan, D.Y. Largemouth bass pond culture in China: A review. Int. J. Vet. Sci. Res. 2017, 3, 14–17. [Google Scholar] [CrossRef]
  3. Wang, R.; Yang, X.; Chen, X.; Zhang, X.; Chi, Y.; Zhang, D.; Chu, S.; Zhou, P. A critical review for hydrogen application in agriculture: Recent advances and perspectives. Crit. Rev. Environ. Sci. Technol. 2023, 54, 222–238. [Google Scholar] [CrossRef]
  4. Guo, J.; Yin, C.K.; Zhong, D.L.; Wang, Y.L.; Qi, T.; Liu, G.H.; Li, X.B. Formic acid as a potential on-board hydrogen storage method: Development of homogeneous noble metal catalysts for dehydrogenation reactions. ChemSusChem 2021, 14, 2655–2681. [Google Scholar] [CrossRef]
  5. Li, L.; Lou, W.; Kong, L.; Shen, W. Hydrogen commonly applicable from medicine to agriculture: From molecular mechanisms to the field. Curr. Pharm. Des. 2021, 27, 747–759. [Google Scholar] [CrossRef]
  6. Ohsawa, I.; Ishikawa, M.; Takahashi, K.; Watanabe, M.; Nishimaki, K.; Yamagata, K.; Katsura, K.-I.; Katayama, Y.; Asoh, S.; Ohta, S. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat. Med. 2007, 13, 688–694. [Google Scholar] [CrossRef]
  7. Xu, S.; Zhu, S.; Jiang, Y.; Wang, N.; Wang, R.; Shen, W.; Yang, J. Hydrogen-rich water alleviates salt stress in rice during seed germination. Plant Soil 2013, 370, 47–57. [Google Scholar] [CrossRef]
  8. Liu, F.; Wang, Y.; Zhang, G.; Li, L.; Shen, W. Molecular hydrogen positively influences lateral root formation by regulating hydrogen peroxide signaling. Plant Sci. 2022, 325, 111500. [Google Scholar] [CrossRef]
  9. Ichihara, M.; Sobue, S.; Ito, M.; Ito, M.; Hirayama, M.; Ohno, K. Beneficial biological effects and the underlying mechanisms of molecular hydrogen-comprehensive review of 321 original articles. Med. Gas Res. 2015, 5, 12. [Google Scholar] [CrossRef]
  10. Zheng, W.; Ji, X.; Zhang, Q.; Du, W.; Wei, Q.; Yao, W. Hydrogen-Rich Water and Lactulose Protect Against Growth Suppression and Oxidative Stress in Female Piglets Fed Fusarium Toxins Contaminated Diets. Toxins 2018, 10, 228. [Google Scholar] [CrossRef]
  11. Huang, S.L.; Jiao, J.; Yan, H.W. Hydrogen-rich saline attenuates steroid-associated femoral head necrosis through inhibition of oxidative stress in a rabbit model. Exp. Ther. Med. 2016, 11, 177–182. [Google Scholar] [CrossRef]
  12. Zhang, B.; Lu, C.; Zang, Y.; Bing, S.; Mo, Q.; Shu, D. Drinking with electrolyzed reduced hydrogen-rich water alters egg quality, intestinal morphology, and antioxidant activities in heat-stressed layers. J. Appl. Poult. Res. 2022, 31, 100244. [Google Scholar] [CrossRef]
  13. Hu, Z.; Wu, B.; Meng, F.; Zhou, Z.; Lu, H.; Zhao, H. Impact of molecular hydrogen treatments on the innate immune activity and survival of zebrafish (Danio rerio) challenged with Aeromonas hydrophila. Fish Shellfish Immunol. 2017, 67, 554–560. [Google Scholar] [CrossRef]
  14. Hu, J.; Huang, L.; Wang, L.; Huang, W.; Lai, M.; Li, X.; Lin, Y.; Sun, Y. Hydrogen administration improves the growth performance of juvenile largemouth bass (Micropterus salmoides) by increasing feed intake, reducing serum lipids, activating mTOR and Nrf2 signaling pathways, and altering the intestinal microbiota. Aquac. Rep. 2023, 33, 101749. [Google Scholar] [CrossRef]
  15. Saxton, R.A.; Sabatini, D.M. mTOR signaling in growth, metabolism, and disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef]
  16. Liu, G.Y.; Sabatini, D.M. mTOR at the nexus of nutrition, growth, ageing and disease. Nat. Rev. Mol. Cell Biol. 2020, 21, 183–203. [Google Scholar] [CrossRef]
  17. Wu, C.W.; Storey, K.B. mTOR Signaling in Metabolic Stress Adaptation. Biomolecules 2021, 11, 681. [Google Scholar] [CrossRef]
  18. Lerner, A.; Neidhofer, S.; Matthias, T. The gut microbiome feelings of the brain: A perspective for non-microbiologists. Microorganisms 2017, 5, 66. [Google Scholar] [CrossRef]
  19. Lu, H.; Chen, W.; Liu, W.; Si, Y.; Zhao, T.; Lai, X.; Guo, Z. Molecular hydrogen regulates PTEN-AKT-mTOR signaling via ROS to alleviate peritoneal dialysis-related peritoneal fibrosis. FASEB J. 2020, 34, 4134–4146. [Google Scholar] [CrossRef]
  20. Liang, B.; Shi, L.; Du, D.Y.; Li, H.; Yi, N.; Long, J.G. Hydrogen-rich water ameliorates metabolic disorder via modifying gut microbiota in impaired fasting glucose patients: A randomized controlled study. Antioxidants 2023, 12, 1245. [Google Scholar] [CrossRef]
  21. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  22. Xun, Z.M.; Zhao, Q.H.; Zhang, Y.; Ju, F.D.; He, J.; Yao, T.T.; Zhang, X.K.; Yi, Y.; Ma, S.N.; Zhao, P.X.; et al. Effects of long-term hydrogen intervention on the physiological function of rats. Sci. Rep. 2020, 10, 18509. [Google Scholar] [CrossRef]
  23. Önalan, Ş.; Bulut, M.; Alwazeer, D. Evaluation of the Potential Use of Oxy-Hydrogen Gas for the Treatment of Lactococcus garvieae Infected- Zebrafish in Hydrogen-Rich Water Aquarium. Braz. Arch. Biol. Technol. 2023, 66, e23220750. [Google Scholar] [CrossRef]
  24. Carnovali, M.; Mariotti, M.; Banfi, G. Molecular hydrogen enhances osteogenesis in Danio rerio embryos. J. Fish Biol. 2021, 98, 1471–1474. [Google Scholar] [CrossRef]
  25. Kolkovski, S. Digestive enzymes in fish larvae and juveniles-implications and applications to formulated diets. Aquaculture 2001, 200, 181–201. [Google Scholar] [CrossRef]
  26. Gudmundsdóttir, Á.; Pálsdóttir, H.M. Atlantic cod trypsins: From basic research to practical applications. Mar. Biotechnol. 2005, 7, 77–88. [Google Scholar] [CrossRef]
  27. Zoncu, R.; Efeyan, A.; Sabatini, D.M. Zoncu R, Efeyan A, Sabatini DM. mTOR: From growth signal integration to cancer, diabetes and ageing. Nat. Rev. Mol. Cell Biol. 2011, 12, 21–35. [Google Scholar] [CrossRef]
  28. Shiota, C.; Woo, J.T.; Lindner, J.; Shelton, K.D.; Magnuson, M.A. Multiallelic Disruption of the rictor Gene in Mice Reveals that mTOR Complex 2 Is Essential for Fetal Growth and Viability. Dev. Cell 2006, 11, 583–589. [Google Scholar] [CrossRef]
  29. Xiao, W.; Jiang, W.; Feng, L.; Liu, Y.; Wu, P.; Jiang, J.; Zhang, Y.; Zhou, X. Supplementation of enzyme-treated soy protein saves dietary protein and promotes digestive and absorptive ability referring to TOR signaling in juvenile fish. Fish Physiol. Biochem. 2017, 43, 1657–1675. [Google Scholar] [CrossRef]
  30. Yu, X.; Luo, K.; Rao, W.; Chen, P.; Lei, K.; Liu, C.; Cui, Z.; Zhang, W.; Mai, K. Effects of replacing dietary fish meal with enzyme-treated soybean meal on growth performance, intestinal microbiota, immunity and mTOR pathway in abalone Haliotis discus hannai. Fish Shellfish Immunol. 2022, 130, 9–21. [Google Scholar] [CrossRef]
  31. Ohta, S. Molecular hydrogen as a novel antioxidant: Overview of the advantages of hydrogen for medical applications. Methods Enzymol. 2015, 555, 289. [Google Scholar]
  32. Wang, F.; Yu, G.; Liu, S.Y.; Li, J.B.; Wang, J.F.; Bo, L.L.; Qian, L.R.; Sun, X.J.; Deng, X.M. Hydrogen-Rich Saline Protects Against Renal Ischemia/Reperfusion Injuryin Rats. J. Surg. Res. 2011, 167, e339–e344. [Google Scholar] [CrossRef]
  33. Feng, S.; Xu, Z.; Wang, F.; Yang, T.; Liu, W.; Deng, Y.; Xu, B. Sulforaphane Prevents Methylmercury-Induced Oxidative Damage and Excitotoxicity Through Activation of the Nrf2-ARE Pathway. Mol. Neurobiol. 2016, 54, 375–391. [Google Scholar] [CrossRef]
  34. Atamanalp, M.; Kirici, M.; Kirici, M.; Alwazeer, D.; Kocaman, M.; Uçar, A.; Parlak, V.; Özcan, S.; Alak, G. Does hydrogen-rich water mitigate MP toxicity in rainbow trout (Oncorhyncus mykiss)? Monitoring with hematology, DNA damage, and apoptosis via ROS/GSH/MDA pathway. Oceanol. Hydrobiol. Stud. 2023, 52, 206–220. [Google Scholar] [CrossRef]
  35. Yang, S.; Chou, G.; Li, Q. Cardioprotective role of azafrin in against myocardial injury in rats via activation of the Nrf2-ARE pathway. Phytomedicine 2018, 47, 12–22. [Google Scholar] [CrossRef]
  36. Li, L.; Liu, T.; Liu, L.; Li, S.; Liu, F. Effect of hydrogen-rich water on the Nrf2/ARE signaling pathway in rats with myocardial ischemia-reperfusion injury. J. Bioenerg. Biomembr. 2019, 51, 393–402. [Google Scholar] [CrossRef]
  37. Xie, K.; Yu, Y.; Pei, Y.; Hou, L.; Chen, S.; Xiong, L.; Wang, G. Protective effects of hydrogen gas on murine polymicrobial sepsis via reducing oxidative stress and HMGB1 release. Shock 2010, 34, 90–97. [Google Scholar] [CrossRef]
  38. Zulfiqar, F.; Russell, G.; Hancock, J.T. Molecular hydrogen in agriculture. Planta 2021, 254, 56. [Google Scholar] [CrossRef]
  39. Ohta, S. Molecular hydrogen as a preventive and therapeutic medical gas: Initiation, development and potential of hydrogen medicine. Pharmacol. Ther. 2014, 144, 1–11. [Google Scholar] [CrossRef]
  40. Kura, B.; Szantova, M.; LeBaron, T.W.; Mojto, V.; Barancik, M.; Szeiffova Bacova, B.; Kalocayova, B.; Sykora, M.; Okruhlicova, L.; Tribulova, N. Biological effects of hydrogen water on subjects with NAFLD: A randomized, placebo-controlled trial. Antioxidants 2022, 11, 1935. [Google Scholar] [CrossRef]
  41. Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of dietary carbohydrates in farmed fishes: New insights on influencing factors, biological limitations and future strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef]
  42. Xiong, Y.; Lei, Q.; Zhao, S.; Guan, K. Regulation of Glycolysis and Gluconeogenesis by Acetylation of PKM and PEPCK; Cold Spring Harbor Symposia on Quantitative Biology; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2011; p. a010942. [Google Scholar]
  43. Conde-Sieira, M.; Soengas, J.L.; Valente, L.M. Potential capacity of Senegalese sole (Solea senegalensis) to use carbohydrates: Metabolic responses to hypo-and hyper-glycaemia. Aquaculture 2015, 438, 59–67. [Google Scholar] [CrossRef]
  44. Chauhan, A.; Singh, R. Probiotics in aquaculture: A promising emerging alternative approach. Symbiosis 2019, 77, 99–113. [Google Scholar] [CrossRef]
  45. Lian, N.; Shen, M.; Zhang, K.; Pan, J.; Jiang, Y.; Yu, Y.; Yu, Y. Drinking hydrogen-rich water alleviates chemotherapy-induced neuropathic pain through the regulation of gut microbiota. J. Pain Res. 2021, 14, 681–691. [Google Scholar] [CrossRef]
  46. Lin, Y.-T.; Shi, Q.-Q.; Zhang, L.; Yue, C.-P.; He, Z.-J.; Li, X.-X.; He, Q.-J.; Liu, Q.; Du, X.-B. Hydrogen-rich water ameliorates neuropathological impairments in a mouse model of Alzheimer’s disease through reducing neuroinflammation and modulating intestinal microbiota. Neural Regen. Res. 2022, 17, 409. [Google Scholar]
  47. Jin, Z.; Sun, Y.; Yang, T.; Tan, L.; Lv, P.; Xu, Q.; Tao, G.; Qin, S.; Lu, X.; He, Q. Nanocapsule-mediated sustained H2 release in the gut ameliorates metabolic dysfunction-associated fatty liver disease. Biomaterials 2021, 276, 121030. [Google Scholar] [CrossRef]
  48. Han, Q.; Bai, Y.; Zhou, C.; Dong, B.; Li, Y.; Luo, N.; Chen, H.; Yu, Y. Effect of molecular hydrogen treatment on Sepsis-Associated encephalopathy in mice based on gut microbiota. CNS Neurosci. Ther. 2023, 29, 633–645. [Google Scholar] [CrossRef]
  49. Liu, X.; Mao, B.; Gu, J.; Wu, J.; Cui, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Blautia-a new functional genus with potential probiotic properties? Gut Microbes 2021, 13, 1875796. [Google Scholar] [CrossRef]
Fishes 09 00210 g001
Figure 1. (A) The intestinal histological changes and (B) muscle layer thickness, mucosal thickness, villus width, and villus height in the intestine. Values are means ± S.D. (n = 4). mlt: muscle layer thickness; mt: mucosal thickness; vw: villus width; vh: villus height.
Figure 1. (A) The intestinal histological changes and (B) muscle layer thickness, mucosal thickness, villus width, and villus height in the intestine. Values are means ± S.D. (n = 4). mlt: muscle layer thickness; mt: mucosal thickness; vw: villus width; vh: villus height.
Fishes 09 00210 g001
Fishes 09 00210 g002
Figure 2. Kelch-like ECH associated protein 1 (keap1); superoxide dismutase (sod); catalase (cat); pyruvate kinase (pk); phosphoenolpyruvate carboxykinase (pepck); target of rapamycin (tor); AKT serine/threonine Kinase 1 (akt); ribosomal protein s6 kinase1 (s6k1); 4E-binding protein 1 (4ebp1); and adenosine 5′-monophosphate-activated protein kinase alpha (ampka) in Micropterus salmoides liver after filling to different concentrations of hydrogen (control, H1, and H2). Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Figure 2. Kelch-like ECH associated protein 1 (keap1); superoxide dismutase (sod); catalase (cat); pyruvate kinase (pk); phosphoenolpyruvate carboxykinase (pepck); target of rapamycin (tor); AKT serine/threonine Kinase 1 (akt); ribosomal protein s6 kinase1 (s6k1); 4E-binding protein 1 (4ebp1); and adenosine 5′-monophosphate-activated protein kinase alpha (ampka) in Micropterus salmoides liver after filling to different concentrations of hydrogen (control, H1, and H2). Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Fishes 09 00210 g002
Fishes 09 00210 g003
Figure 3. (A) Effect of hydrogen injection on microbial alpha diversity; (B) effect of hydrogen on microbial community distribution at the phylum level and the genus level; (C) effect of hydrogen on the difference in microbial community composition at the phylum level; and (D) effect of hydrogen on the difference in microbial community composition at theof genus level. Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Figure 3. (A) Effect of hydrogen injection on microbial alpha diversity; (B) effect of hydrogen on microbial community distribution at the phylum level and the genus level; (C) effect of hydrogen on the difference in microbial community composition at the phylum level; and (D) effect of hydrogen on the difference in microbial community composition at theof genus level. Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Fishes 09 00210 g003
Table 1. Primer sequence.
Table 1. Primer sequence.
GeneAccession NumberPrimer SequenceTm (°C)Product Size (bp)
keap1XM_038713665.1F: CAGCATTACATGGCCGCATC62.186
R: CTTCTCTGGGTCGTAAGACTCC
sodMK614711.1F: CCACCAGAGGTCTCACAGCA58.7158
R: CCACTGAACCGAAGAAGGACT
catXM_038704976.1F: GTTCCCGTCCTTCATCCACT58.585
R: CAGGCTCCAGAAGTCCCACA
pkXM_038700626.1F: CTCTTTCATCCGCAAAGC53.8172
R: AATTCCCAGGTCACCACG
pepckXM_038696646.1F: GGAAACGGCCAACATTCT55.3151
R: GCCAACCAGCAGTTCTCAT
torXM_038723321.1F: TCAGGACCTCTTCTCATTGGC59.1208
R: CCTCTCCCACCATGTITCTCT
aktXM_038729214.1F: ATGGACTCCTCTCCAGACCC57.4164
R: TTCATGGCGTACTAGCGTCC
s6k1XM_038713349.1F: GCCAATCTCAGCGTTCTCAAC59.8156
R: CTGCCTAACATCATCCTCCTT
4ebp1XM_038709593.1F: AGCAGGAACITICGGTCATA50.2168
R: GTCAATGGGCAGTCAGAAGA
ampkαXM_038734014.1F: CACATGAATGCCAAGATTG52.1131
R: GGACCAGCATATAACCTTC
Β-actinXM_038695351.1F: AAAGGGAAATCGTGCGTGAC59.9184
R: AAGGAAGGCTGGAAGAGGG
Table 2. Effect of hydrogen on the growth performance of largemouth bass.
Table 2. Effect of hydrogen on the growth performance of largemouth bass.
IndexControlH1H2
Initial body weight (IBW, g)13.67 ± 0.16 a13.69 ± 0.14 a13.85 ± 0.03 a
Final body weight (FBW, g)416.53 ± 22.41 a492.78 ± 25.82 b481.59 ± 6.42 b
feed intake (FI, g)7225.15 ± 280.13 a7967.58 ± 497.33 a7818.32 ± 158.24 a
Survival rate (SR, %)90.00 ± 2.00 a96.00 ± 2.00 b94.67 ± 3.06 ab
Weight gain rate (WGR, %)2949.42 ± 201.59 a3499.72 ± 162.39 b3377.17 ± 43.95 b
Specific growth rate (SGR, %)6.10 ± 0.12 a6.40 ± 0.08 b6.34 ± 0.12 b
Feed conversion ratio (FCR)1.79 ± 0.04 c1.66 ± 0.03 ab1.63 ± 0.03 a
Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Table 3. Effect of hydrogen on biochemical indicators of largemouth bass.
Table 3. Effect of hydrogen on biochemical indicators of largemouth bass.
ItemControlH1H2
Amylase (U/mgprot)0.13 ± 0.09 a0.13 ± 0.09 a0.23 ± 0.03 a
Trypsin (U/mgprot)141.50 ± 15.33 a246.53 ± 38.06 b171.10 ± 12.29 a
Lipase (U/mgprot)1.56 ± 0.36 b1.03 ± 0.69 ab0.45 ± 0.19 a
SOD (U/mgprot)32.54 ± 2.71 a38.87 ± 15.37 a22.97 ± 3.57 a
GSH-PX (U/mL)21.42 ± 15.80 a22.91 ± 14.15 a19.91 ± 7.23 a
CAT (U/mgprot)4.41 ± 0.08 a2.35 ± 1.14 a3.44 ± 0.27 a
MDA (nmol/mgprot)3.62 ± 1.09 a3.97 ± 1.21 a6.78 ± 1.65 b
H2O2 (mmol/gprot)26.45 ± 11.61 b13.16 ± 5.25 a21.15 ± 2.48 ab
NO (umol/gprot)7.03 ± 1.83 b5.02 ± 1.10 ab4.67 ± 1.06 a
Values are means ± S.D. (n = 4). Different lowercase letters above each bar in each group represent significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, Y.; Li, H.; Chen, S.; Lin, Y.; Peng, J.; Hu, J.; Wang, Y. The Effects of Different Concentrations of Hydrogen-Rich Water on the Growth Performance, Digestive Ability, Antioxidant Capacity, Glucose Metabolism Pathway, mTOR Signaling Pathway, and Gut Microbiota of Largemouth Bass (Micropterus salmoides). Fishes 2024, 9, 210. https://doi.org/10.3390/fishes9060210

AMA Style

Yuan Y, Li H, Chen S, Lin Y, Peng J, Hu J, Wang Y. The Effects of Different Concentrations of Hydrogen-Rich Water on the Growth Performance, Digestive Ability, Antioxidant Capacity, Glucose Metabolism Pathway, mTOR Signaling Pathway, and Gut Microbiota of Largemouth Bass (Micropterus salmoides). Fishes. 2024; 9(6):210. https://doi.org/10.3390/fishes9060210

Chicago/Turabian Style

Yuan, Yin, Huixiang Li, Songwei Chen, Yongchun Lin, Jiangyuan Peng, Junru Hu, and Yongsheng Wang. 2024. "The Effects of Different Concentrations of Hydrogen-Rich Water on the Growth Performance, Digestive Ability, Antioxidant Capacity, Glucose Metabolism Pathway, mTOR Signaling Pathway, and Gut Microbiota of Largemouth Bass (Micropterus salmoides)" Fishes 9, no. 6: 210. https://doi.org/10.3390/fishes9060210

Article Metrics

Back to TopTop