Next Article in Journal
Clostridium perfringens Enterotoxin: The Toxin Forms Highly Cation-Selective Channels in Lipid Bilayers
Next Article in Special Issue
Phylogeny and Mycotoxin Characterization of Alternaria Species Isolated from Wheat Grown in Tuscany, Italy
Previous Article in Journal
Subtype Specificity of β-Toxin Tf1a from Tityus fasciolatus in Voltage Gated Sodium Channels
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis

Institute of Food Science and Technology, Chinese Academy of Agricultural Sciences/Key Laboratory of Agro-Products Quality and Safety Control in Storage and Transport Process, Ministry of Agriculture, Beijing 100193, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Toxins 2018, 10(9), 340; https://doi.org/10.3390/toxins10090340
Submission received: 12 July 2018 / Revised: 14 August 2018 / Accepted: 16 August 2018 / Published: 22 August 2018

Abstract

:
Ochratoxin A (OTA) is a potent nephrotoxic, hepatotoxic, and teratogenic compound which is a significant mycotoxin contaminates cereals during storage. Aspergillus ochraceus is the most common producer of OTA in cereals and cereal-derived products. Cinnamaldehyde is a natural substance derived from plant cinnamon playing an important role in the reduction of OTA contamination. In this study, the antifungal and antitoxigenic effect of cinnamaldehyde was investigated with its mechanisms of inhibition of fungal growth at the morphological and ultrastructural levels, and inhibition of OTA biosynthesis at the transcriptional level. Significant A. ochraceus growth was inhibited at 0.4–1.6 mmol/L with fumigation. A. ochraceus exposed to 0.4 mmol/L of cinnamaldehyde indicated irreversible harmful morphological and ultrastructural modifications such as the folding of the cell, the loss of integrity of the cell wall, the disruption of plasma membrane, the destruction of the mitochondria, and the absence of intracellular organelles. These alterations may be attributed to its inhibition of enzymatic reactions that regulate cell wall synthesis, thus disturbing the morphogenesis and growth of A. ochraceus. In the presence of cinnamaldehyde, the tested biosynthetic and regulatory genes like pks, nrps, veA, laeA and velB were highly downregulated. Moreover, the downregulation effect of cinnamaldehyde increased proportionally with the concentrations. These results suggest that the decrease of OTA production by cinnamaldehyde is attributed to the downregulation of the transcriptional levels of OTA biosynthetic and regulatory genes besides the inhibition of fungal growth. The study reveals the mechanisms of the antifungal and antitoxigenic activities of cinnamaldehyde against A. ochraceus, and further emphasizes that cinnamaldehyde could be a safe and effective natural agents against OTA contamination during cereals storage.
Key Contribution: Cinnamaldehyde down regulates the expression of pks, nrps, veA, laeA, and velB genes involved in OTA biosynthesis. Cinnamaldehyde causes irreversible deleterious morphological and ultrastructural alterations in A. ochraceus.

1. Introduction

Ochratoxin A (OTA) is an important mycotoxin mainly produced by the species of the genera Aspergillus and Penicillium during pre-harvest period and storage [1]. OTA contaminates a wide range of foods and feeds, including cereals and cereal-derived products, peanuts, oilseeds, coffee beans, grapes, beverages, dried fruits, spices, beer, and wine [2,3,4,5]. OTA is highly nephrotoxic, hepatotoxic, teratogenic, neurotoxic, embryotoxic, genotoxic, and immunosuppressive in nature [5,6,7,8,9], and has been classified as potential carcinogen (group 2B) by the International Agency for Research on Cancer [10]. Therefore, the European Union set the limitation of 5 µg/kg OTA in cereal grains [11], and a similar standard is maintained in China [12]. The main OTA-producing fungi include Aspergillus ochraceus, Aspergillus carbonarius, Aspergillus niger, Aspergillus westerdijkiae, Penicillium nordicum, and Penicillium verrucosum [9,13]. Of them, A. ochraceus and P. verrucosum are mainly responsible for OTA contamination in wheat, barley, rice, oats, and coffee beans, while other species are mainly responsible for OTA in grapes, raisins, beverages, and wine [9,13,14,15].
To remove OTA in our food chain, numerous approaches have been used to either prevent OTA-producing fungi or block OTA production [9]. Chemical-based fungicides such as low molecular weight organic acids, aromatic hydrocarbons, benzimidazole, and sterol biosynthesis inhibitors are often used to control the post-harvest contamination of mycotoxins in foods [9]. However, many disadvantages are associated with their use, such as the increased risk of toxic residues in foods and fungicide resistance [16,17,18,19]. So, in recent years, the worldwide tendency is to limit chemical fungicide use in grains and foodstuffs [20]. Essential oils extracted from plants have been attractive in both academia and the food industry due to their antimicrobial and antioxidative properties [21]. In our previous study, the inhibitory effect of 10 essential oils on A. ochraceus growth and OTA production was investigated using fumigation and contact assays, and cinnamaldehyde proved to be most effective compared with other essential oils, followed by citral and eugenol [9].
To date, the molecular mechanism of action behind cinnamaldehyde inhibits OTA production has not been revealed. Previous studies have showed that several enzymes, such as polyketide synthase (PKS), nonribosomal peptide synthase (NRPS), cytochrome p450 monoxygenase, and halogenase, are involved in the key steps of the OTA biosynthesis [22,23,24]. Based on the results of previous studies and our work, we have determined the steps of OTA biosynthesis and proposed an OTA biosynthetic pathway [25]. In the OTA biosynthetic pathway, pks encodes a polyketide synthase which is responsible for the synthesis of 7-methylmellein, the first step of the putative pathway [26], and the nrps encodes a nonribosomal peptide which combines OTβ and L-β-phenylalanine to form an amide bond to synthesize OTB [25]. OTA biosynthesis is also associated with genes encoding the velvet regulating proteins (VelB, VeA, and LaeA). VelB, veA, and laeA are transcriptional factors which can coordinate fungal development and secondary metabolism and can activate OTA production [27].
In the present study, to reveal the inhibitory mechanism of A. ochraceus growth by cinnamaldehyde, the effect of cinnamaldehyde on A. ochraceus hyphae ultrastructure alterations was investigated using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). In order to uncover the molecular mechanism of action by which cinnamaldehyde inhibits OTA biosynthesis, the transcript levels of key OTA biosynthetic and regulatory genes (pks, nrps, veA, laeA, and velB) were evaluated using real-time PCR.

2. Results

2.1. Inhibitory Effect of Cinnamaldehyde on the Growth and Ochratoxin A Production by A. ochraceus with Fumigation

The effect of cinnamaldehyde on A. ochraceus growth and OTA production were shown in Figure 1 and Table 1, respectively. Cinnamaldehyde could significantly inhibit A. ochraceus growth and OTA production at the tested concentrations (0.4–1.6 mmol/L). The inhibitory effect of fungal growth proportionally increased with cinnamaldehyde in concentrations, and also had impact based on the incubation time. The increase in the concentration of cinnamaldehyde (0.4, 1.0, and 1.6 mmol/L) caused a delay in conidia germination and showed higher inhibitory effects. After one day of exposition to 1.6 mmol/L of cinnamaldehyde, the A. ochraceus growth was completely inhibited. At the concentration of 0.4 and 1.0 mmol/L, cinnamaldehyde limited the mycelia growth to 3.45 ± 0.10 cm and 2.15 ± 0.05 cm from 8 to 20 days, respectively, and as shown in Table 1, OTA production declined from 1.90 to 0–0.34 ng/mm2 colony with the inhibition rate ranging from 82.0% to 100%.

2.2. Effect of Cinnamaldehyde on the Morphology of A. ochraceus by SEM

The morphologic alterations of A. ochraceus treated with 0.4 mmol/L of cinnamaldehyde are shown in Figure 2. Compared with controls, mycelia exposed to cinnamaldehyde revealed marked alterations in both the whole length of the hyphae and the apical regions. For the A. ochraceus that were untreated, the mycelia showed a normal morphology and the hyphae were linear, regular, and homogenous, and their cell walls were smooth (Figure 2A–C). However, this morphology underwent alterations upon exposure to 0.4 mmol/L of cinnamaldehyde. It was noted that the mycelia tips were elongated after cinnamaldehyde treatment and became easy to break (Figure 2D). These hyphae shrank and underwent winding (Figure 2E), then lost their linearity with some depressions on the hyphae surface (Figure 2D,E). The craters were obvious on the cell wall and damages with clear disruption were observed in the cell wall (Figure 2F).

2.3. Effect of Cinnamaldehyde on the Ultrastructure of A. ochraceus by TEM

The ultrastructural alterations of A. ochraceus treated with 0.4 mmol/L of cinnamaldehyde are shown in Figure 3. The normal ultrastructure of A. ochraceus cells showed intact mycelia with sound and homogeneous structure, mitochondria, endoplasmic reticulum, and vacuoles were observed in the cytoplasm obtained by TEM. However, the healthy ultrastructure of A. ochraceus cells was disrupted after treated with cinnamaldehyde. The pivotal alterations include leakage of cytoplasmic contents and disruption of cell walls (DCW) (Figure 3B,C). In the cytoplasm appeared wide vacuoles (WV), with disorganized aggregated mitochondria (DAM) and large lipid globules (LLG) (Figure 3B–D). Alterations in the cell wall were also noted including thin cell walls (TCW), disintegration of nuclear membrane (DNM), clumping of nuclear material (CNM) (Figure 3B,E), and even appearing of the precipitates (PP) in the exterior part of the plasmalemma (Figure 3E,F).

2.4. Effect of Cinnamaldehyde on Ochratoxin A Biosynthetic and Regulatory Genes Expression

The expression levels of pks, nrps, veA, laeA, and velB genes in A. ochraceus treated with 0.4 and 1.0 mmol/L of cinnamaldehyde were shown in Figure 4. Compared to the control, all the genes were downregulated by cinnamaldehyde. Among the five genes, the transcription level of pks gene had the highest downregulation with an average of 98% reduction at 1.0 mmol/L, followed by nrps, laeA, veA, and velB with the average of 96%, 84%, 76%, and 74% reduction, respectively. The downregulation effect of cinnamaldehyde proportionally increased with the concentrations. For 0.4 mmol/L of cinnamaldehyde, the downregulation rates of pks, nrps, laeA, veA, and velB were 90%, 88%, 68%, 66%, and 65%, respectively. These results suggest that cinnamaldehyde causes the down regulation of the tested OTA biosynthetic and regulatory genes, which in turn results in the reduction (82%) of OTA production at 7 days after treatment.

3. Discussion

Food and feed contaminated with OTA produced by A. ochraceus during storage is a serious global threat to food safety. Consumption of food and products contaminated with OTA causes increased risks of diseases like renal adenomas and carcinomas, hepatocellular carcinomas, Alzheimer’s, and Parkinson’s, which in turn result in severe damage on the health of humans and animals. Multiple approaches have been developed to prevent A. ochraceus growth and to control OTA production in food and feed. Antifungal chemicals potentially increase the risk of toxic residues in food and feed and may lead to antifungal-resistant fungus. Therefore, numerous plant essential oils, which are safer, are regarded as alternatives to chemical fungicides and preservatives [28]. The findings of previous studies for natural substance had revealed the inhibitory role of essential oils on different fungal and bacterial species [9,21,28,29,30], and cinnamon oil was highly effective against all the tested organisms and phage [28,29]. In our previous study, cinnamaldehyde, which is the main component of cinnamon oil, was the most effective against A. ochraceus growth and OTA production, followed by citral and eugenol [9]. In general, cinnamaldehyde is regarded as safe and widely used as flavor for ingredients in the food industry. Several studies also had investigated the antifungal and antioxidant effects of cinnamaldehyde and reported its activities inhibiting mycelia growth and mortality accompanied by membrane damage [31,32,33]. Earlier studies indicated that cinnamaldehyde had remarkable antimicrobial efficacy on food-borne microorganisms [34,35]. In order to promote the application of cinnamaldehyde in stored foods and feeds, the inhibitory mechanism of A. ochraceus growth and OTA production by cinnamaldehyde was investigated in the present study.
With regard to the viability and morphological changes of A. ochraceus exposed to cinnamaldehyde, the SEM and TEM images of fungus treated with cinnamaldehyde for 24 h showed marked alterations compared to the controls. The mycelia exhibited obvious alterations in both the length of the hyphae and the apical regions, as well as significant decrease or absence of cytoplasmic contents, a reduction in membrane integrity, the destruction of mitochondria, the disruption of plasma membrane, loss of integrity of the cell wall, and folding of the cell. These results were similar to those reported by Tyagi et al. [36], who found that yeast cells shrank and were obviously absent of cytoplasmic contents after treatment with Cymbopogon citratus essential oil. Similarly, previous studies [28,30] found that Fusarium verticillioides cells shrank and were obviously absent of cytoplasmic contents after treatment with Zingiber officinale essential oil and cinnamaldehyde, respectively.
In A. ochraceus treated with cinnamaldehyde, the loss of cytoplasm, the destruction of mitochondria, the disruption of plasma membrane, the loss of integrity of the cell wall, and the folding of the cell were observed. Similarly, the decreased diameter and the thinning of the hyphae wall were observed in A. niger treated with Cymbopogon nardus (L) essential oils [37]. After treatment with Thymus eriocalyx and T. x-porlock essential oils, the reduced diameter and thickness of the hyphal wall were also observed in A. niger [21]. Furthermore, ultrastructural analysis highlighted that the multiple effects of essential oils on Aspergillus fumigatus, Trichophyton rubrum, and F. verticillioides cells, were damage to the cell walls, membranes, cytoplasmic contents, and decreasing in elastase and keratinase activities [28,38]. Cinnamaldehyde has also been reported to inhibit the activities of chitin synthase 1 and β-(1, 3)-glucan synthase, which are key cell wall synthesizing enzymes in fungi [39]. In human promyelocytic leukemia HL-60 cells, cinnamaldehyde also affected cell wall-synthesizing enzymes or mitochondria [40]. These modifications in the cell wall may be due to the lipophilic properties of essential oils, which making them pervious to the cytoplasmic membrane and cell wall, thus increasing the possibility of their interaction with the cytoplasmic membrane and cell wall, inhibiting cell wall-synthesizing enzymatic reactions, and disrupting cell integrity [21,33]. This mechanism of action disrupts membrane integrity and fluidity, alters the structure of several layers of phospholipids, polysaccharides, proteins, and fatty acids, and in turn results in the leakage of cytoplasmic contents [28].
Complete inhibition of A. ochraceus growth and OTA production were observed when 1.6 mmol/L of cinnamaldehyde was applied. However, a significant reduction (82%) in the OTA production with less inhibition in A. ochraceus growth (41%) was observed at cinnamaldehyde concentration of 0.4 mmol/L. This result suggests that OTA reduction may be due to the downregulation of OTA biosynthetic and regulatory genes. Several natural compounds have been proved to inhibit mycotoxins production by down regulating the transcript levels of biosynthetic genes [9]. For example, curcumin inhibited AFB1 production in A. parasiticus by reducing the transcript levels of aflatoxin biosynthetic genes like pksA, ver-1, nor-1, omtA, and aflR [41,42]; cinnamaldehyde, eugenol, and citral inhibited AFB1 production in A. flavus by reducing the transcript levels of ver-1, nor-1, omtA, aflR, and aflT [42]; 2-phenylethanol reduced the expression of the structural genes (aflC, aflD, aflO, and aflM) in aflatoxin pathway [43]; Zataria multiflora Boiss essential oil reduced the transcript levels of aflD, aflM, and aflP in A. paraciticus [44]; piperine inhibited AFB1 production in A. flavus by downregulating the expression of almost all genes participating in aflatoxin biosynthetic pathway [45]; and eugenol inhibited AFB1 production in A. flavus by reducing expression of 20 of 29 genes in aflatoxin biosynthetic pathway using RNA-seq [46]. In this study, pks, nrps, veA, laeA, and velB genes, which are involved in OTA biosynthesis, were highly downregulated by cinnmaldehyde at 0.4 and 1.0 mmol/L. A similar result was observed previously [41,42,43,44,45,46] in A. parasiticus and A. flavus. The pks gene had the highest downregulation, followed by nrps, laeA, veA, and velB. The pks and nrps genes are included in the OTA-putative gene cluster [25,47,48], while, velA, laeA, and velB are known as transcription factors regulating the secondary metabolism [27,49]. The downregulation of pks and nrps was significant higher than other three genes. These results might be explained based on the role described for VeA and LaeA in other fungi. Previous studies indicated that the complex formed by VelB, VeA, and LaeA proteins connects light-response with fungal development and secondary metabolism, including the positive regulation of the OTA biosynthetic genes’ expression [26,27]. These results suggest that cinnamaldehyde can suppress the transcription of genes such as veA, laeA, velB, pks, and nrps, and in turn down regulates both fungal development and OTA biosynthesis.
The results revealed the inhibitory mechanism of A. ochraceus growth and OTA production by cinnamaldehyde. Cinnamaldehyde causes irreversible harmful morphological and ultrastructural changes, and the downregulation of OTA biosynthetic and regulatory genes, which in turn results in the inhibition of fungal growth and OTA production. These findings further emphasize the toxicity of cinnamaldehyde on fungi and mean that it is a good alternative to chemical fungicides and preservatives during food and feed storage.

4. Materials and Methods

4.1. Cinnamaldehyde and Ochratoxin A Standards

The cinnamaldehyde (96%) used in the experiments was purchased from Jiangxi Xuesong (Jiangxi Xue Song Natural Medicinal Oil Co., Ltd., Ji’an, Jiangxi, China) and its concentration was confirmed in the lab by Gas Chromatography-Mass Spectrometer (GC-MS, Thermo Fisher Scientific, Waltham, MA, USA). 100 μg/mL of OTA (Sigma Chemical, St. Louis, MO, USA) was prepared in acetonitrile:water (50:50, v/v) and stored in amber vials at −18 °C.

4.2. Fungal Strain and Culture Conditions

A. ochraceus fc-1 is a high OTA-producing strain which is maintained in our lab. The strain was grown on potato dextrose agar (PDA) and stored at 4 °C. Conidia suspensions were harvested by surface washing of 7-day-old A. ochraceus PDA cultures with 0.1% tween-80 in sterile deionized water. Then the conidia were counted using a hemocytometer and adjusted to 1 × 106 conidia/mL with 0.1% of Tween-80 solution.

4.3. Effect of Cinnamaldehyde on Fungal Growth and Ochratoxin A Production

To evaluate the inhibitory effect of cinnamaldehyde on fungal growth and OTA production, the treatment of A. ochrceus with cinnamaldehyde by fumigation was performed according to the method described by [28,50] with minor modifications. Briefly, 10 µL of 106 conidia/mL were spotted in the center of Petri dishes containing 20 mL of MEA. Each liter of MEA medium contained 30.0 g malt extract, 3.0 g soy peptone, and 15.0 g agar. The pH of the medium was adjusted to 5.6 ± 0.2. Subsequently, 0, 1, 2.5, and 4 µL of cinnamaldehyde (96%) were added to a 5-mm diameter sterile filter paper disk which was placed on the medium-free cover of the dish for each Petri dish, to the final concentrations of 0, 0.4, 1.0, and 1.6 mmol/L, respectively. According to our measurement, the empty space of each dish with MEA medium is 20 mL; the above concentrations were obtained after full fumigation of cinnamaldehyde in the sealed dish. The sealed dishes were incubated at 28 ± 1 °C for 20 days. All treatments were repeated 5 times and the experiment was conducted twice. The average diameters were obtained by measuring fungal colony in two directions at right angles to each other every 2 days [28].

4.4. The Extraction and Determination of Ochratoxin A

OTA production on MEA was assessed according to a method described previously [51,52] with the following modifications. After incubation, three agar plugs (6 mm diameter) were removed starting from the center to the edge of the colony each (4.5 cm), placed in a 1.5 mL glass vial, and then stored at −20 °C until extraction. The three plugs were mixed with 1 mL methanol, vortexed and kept at room temperature (about 20 °C) for 1 h, mixed again, and filtered using 0.22 µm disk filters for high-performance liquid chromatography (HPLC) analysis of OTA.
OTA in culture extracts was detected and quantified using a HPLC unit according to the methodology proposed by [9,53] with minor modifications. Waters 2695 HPLC (Waters Corporation, Milford, MA, USA) with a 2475 fluorescence detector (λexc 330 nm; λem 460 nm) and a Agilent TC-C18 column (250 × 4.6 mm, 5 µm) was applied. At room temperature, samples (50 µL) were injected, then the mobile phase (acetonitrile/water/acetic acid, 99:99:2, v/v/v) [5] was pumped at a flow rate 1.0 mL/min. The retention time was around 6 min. The calibration curve was obtained using 5, 25, 50, 75, and 100 ng/g OTA standards. The OTA concentration was determined by comparing peak areas of sample extracts with the calibration curve. Mean recovery was measured by spiking the MEA medium with OTA standards at 5, 25, 50, 75, and 100 ng/g and was estimated at 89.2 ± 9.7%. The limit of detection was 1 ng/g.

4.5. Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM)

SEM was operated using a method proposed previously [28] with minor modifications. The mycelia of A. ochraceus untreated and treated with 0.4 mmol/L cinnamaldehyde were collected from MEA cultures and mixed with formaldehyde, subsequently washed and dehydrated using PBS buffer and gradient ethanol solutions, respectively. Then, the samples were suffered from critical-point drying in CO2 with a method described previously [28,54] and sputter-coated with gold. For the SEM analysis, the mycelia were fixed onto stubs, then placed on the gold coater holder and coated with a 1.40 nm layer of gold [28]. TEM was carried out using a method reported previously [28]. The A. ochraceus mycelia, both untreated and treated with cinnamaldehyde, were observed under a Hitachi H-7500 TEM.

4.6. Real-Time PCR Analysis of OTA Biosynthetic and Regulatory genes

To evaluate the effect of cinnamaldehyde (0.4 and 1.0 mmol/L) on the transcript levels of OTA biosynthetic and regulatory genes, a 10 µL conidia suspension (106 conidia/mL) was spotted in the center of MEA medium covered with sterile cellophane layers. After incubations for 7 days, A. ochraceus mycelia were collected from cellophane layers and flash-frozen using liquid nitrogen and subsequently ground to fine powder for RNA isolation. Total RNA was extracted from 100 mg of mycelia using the Fungal RNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions. RNA samples were treated with RNase-Free DNase (QIAGEN GmbH, Hilden, Germany) to digest the residual DNA. The purity and concentrations of RNA were detected by measuring the absorbance of RNA samples at 260 and 280 nm using a NanoDrop 2000 (Thermo Fisher Scientific, Wattham, MA, USA). The cDNA was synthesized by reverse transcription from 5 μg of total RNA using a Takara RNA PCR Kit (AMV) ver. 3.0 (Takara Bio Inc, Beijing, China). All primers were designed using Primer Premier 6.0 software (Premier Biosoft International, Palo Alto, CA, USA, 2010) and their specificities were validated using the Primer-BLAST software [55]. All primers were synthesized by Sangon Biotech (Beijing, China) and their sequences are listed in Table 2.
Experiments were carried out using an ABI Prism 7500 system (Applied Biosystems, Foster City, CA, USA). The amplification was performed using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and each reaction well contained a final volume of 20 μL mix: 10 μL of SYBR Green PCR Master Mix, 1 μL of cDNA material (100 ng), 0.5 μL of each primer (10 mmol/L), and Nuclease-Free water 8 μL. The thermal protocol was carried out as described previously [56]. The GADPH was used as reference gene [25,57]. The results were analyzed using the sequence detection system software 1.9.1 (Applied Biosystems, Foster City, CA, USA) and the relative expression of targeted gene was calculated using the 2−ΔΔct method [58]. Three distinct experiments were conducted, each including at least three biological replicates of each condition.

4.7. Statistical Analysis

All the statistical analyses were conducted using SAS v. 9.2 (SAS Institute Inc., Cary, NC, USA, 2007) and Microsoft Excel 2013 (15.0.5059.1000, Microsoft Corporation, Redmond, WA, USA, 2013). The gene expression analyses were evaluated by one-way analysis of variance (ANOVA, SAS v. 9.2, SAS Institute Inc., Cary, NC, USA, 2013). Mean comparisons were analyzed by Turkey’s multiple range tests. Differences were considered to be significant at p < 0.05.

Author Contributions

Conceptualization, L.W., J.J., and F.X.; Methodology, L.W., J.J., and X.L.; Software, Y.W.; Validation, X.L. and Y.Z.; Formal Analysis, L.W. and J.J.; Writing-Original Draft Preparation, L.W. and F.X.; Writing-Review & Editing, J.J.; Supervision, Y.L. and F.X.; Project Administration, F.X.; Funding Acquisition, F.X.

Funding

This research was funded by the National Key R&D Program of China (2016YFD0400105) and the National Natural Science Foundation of China (31571938).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Valero, A.; Farré, J.R.; Sanchis, V.; Ramos, A.J.; Marín, S. Effects of fungal interaction on ochratoxin A production by A. carbonarius at different temperatures and aw. Int. J. Food Microbiol. 2006, 110, 160–164. [Google Scholar] [CrossRef] [PubMed]
  2. Jørgensen, K. Survey of pork, poultry, coffee, beer and pulses for ochratoxin A. Food Addit. Contam. 1998, 15, 550–554. [Google Scholar] [CrossRef] [PubMed]
  3. Magnoli, C.; Astoreca, A.; Ponsone, L.; Combina, M.; Palacio, G.; Rosa, C.A.R.; Dalcero, A.M. Survey of mycoflora and ochratoxin A in dried vine fruits from Argentina markets. Lett. Appl. Microbiol. 2004, 39, 326–331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Magnoli, C.; Hallak, C.; Astoreca, A.; Ponsone, L.; Chiacchiera, S.M.; Palacio, G.; Dalcero, A. Surveillance of toxigenic fungi and ochratoxin A in feedstuffs from Córdoba Province, Argentina. Vet. Res. Commun. 2005, 29, 409–420. [Google Scholar] [CrossRef] [PubMed]
  5. Magnoli, C.; Astoreca, A.; Ponsone, M.L.; Fernández-Juri, M.G.; Barberis, C.; Dalcero, A.M. Ochratoxin A and Aspergillus section Nigri in peanut seeds at different months of storage in Córdoba, Argentina. Int. J. Food Microbiol. 2007, 119, 213–218. [Google Scholar] [CrossRef] [PubMed]
  6. Denli, M.; Perez, J.F. Ochratoxins in feed, a risk for animal and human health: Control strategies. Toxins 2010, 2, 1065–1077. [Google Scholar] [CrossRef] [PubMed]
  7. Pfohlleszkowicz, A. Ochratoxin A and aristolochic acid involvement in nephropathies and associated urothelial tract tumours. Arch. Ind. Hyg. Toxicol. 2009, 60, 465–482. [Google Scholar]
  8. Ringot, D.; Chango, A.; Schneider, Y.J.; Larondelle, Y. Toxicokinetics and toxicodynamics of ochratoxin A, an update. Chem.-Biol. Interact. 2006, 159, 18–46. [Google Scholar] [CrossRef] [PubMed]
  9. Hua, H.; Xing, F.; Selvaraj, J.N.; Wang, Y.; Zhao, Y.; Zhou, L. Inhibitory effect of essential oils on Aspergillus ochraceus growth and ochratoxin A production. PLoS ONE 2014, 9, e108285. [Google Scholar] [CrossRef] [PubMed]
  10. Harnden, D.G. Iarc monographs on the evaluation of carcinogenic risk of chemicals to man. Vol. 10: Some naturally occurring substances. IARC Monogr. Eval. Carcinog. Risks Chem. Hum. 1977, 35, 125. [Google Scholar] [CrossRef]
  11. Commission of the European Communities. Commission regulation (EU) No 165/2010 of 26 February 2010 amending, Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards aflatoxins. Off. J. Eur. Union L50 2010, 8–12. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?qid=1534863759388&uri=CELEX:32010R0165 (accessed on 26 February 2010).
  12. China National Food Safety Standard (GB 2761-2017), Maximum Limit of Mycotoxins in Food. 2017. Available online: http://www.nhfpc.gov.cn/sps/s7891/201704/b83ad058ff544ee39dea811264878981.shtml (accessed on 14 April 2017). (In Chinese)
  13. Sokolić-Mihalak, D.; Frece, J.; Slavica, A.; Delaš, F.; Pavlović, H.; Markov, K. The effect of wild thyme (Thymus Serpyllum L.) essential oil components against ochratoxin-producing Aspergilli. Arch. Ind. Hyg. Toxicol. 2012, 63, 457–462. [Google Scholar]
  14. Čvek, D.; Markov, K.; Frece, J.; Dragičević, T.; Majica, M.; Delaš, F. Growth inhibition of Aspergillus ochraceus ZMPBF 318 and Penicillium expansum ZMPBF 565 by four essential oils. Arch. Ind. Hyg. Toxicol. 2010, 61, 191–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Reddy, K.R.N.; Salleh, B.; Saad, B.; Abbas, H.K.; Abel, C.A.; Shier, W.T. An overview of mycotoxin contamination in foods and its implications for human health. Toxin Rev. 2010, 29, 3–26. [Google Scholar] [CrossRef]
  16. Al-Omair, A.; Helaleh, M.I.H. Selected-Ion storage GC–MS analysis of polycyclic aromatic hydrocarbons in palm dates and tuna fish. Chromatographia 2004, 59, 715–719. [Google Scholar] [CrossRef]
  17. Chen, P.J.; Moore, T.; Nesnow, S. Cytotoxic effects of propiconazole and its metabolites in mouse and human hepatoma cells and primary mouse hepatocytes. Toxicol. In Vitro 2008, 22, 1476–1483. [Google Scholar] [CrossRef] [PubMed]
  18. Chilvers, M.I.; Hay, F.S.; Hills, J.; Dennis, J.J.C.; Wilson, C.R. Influence of benzimidazole fungicides on incidence of Botrytis allii infection of onion leaves and subsequent incidence of onion neck rot in storage in Tasmania, Australia. Aust. J. Exp. Agric. 2006, 46, 1661–1664. [Google Scholar] [CrossRef]
  19. Isaac, S. What is the mode of action of fungicide and how do fungi develop resistance? Mycologist 1999, 13, 38–39. [Google Scholar] [CrossRef]
  20. López, A.G.; Theumer, M.G.; Zygadlo, J.A.; Rubinstein, H.R. Aromatic plants essential oils activity on Fusarium verticillioides Fumonisin B1 production in corn grain. Mycopathologia 2004, 158, 343–349. [Google Scholar] [CrossRef] [PubMed]
  21. Rasooli, I.; Rezaei, M.B.; Allameh, A. Growth inhibition and morphological alterations of Aspergillus niger by essential oils from Thymus eriocalyx and Thymus x-porlock. Food Control 2006, 17, 359–364. [Google Scholar] [CrossRef]
  22. Gallo, A.; Bruno, K.S.; Bruno, K.S.; Solfrizzo, M.; Perrone, G.; Mulè, G. New insight into the ochratoxin A biosynthetic pathway through deletion of a nonribosomal peptide synthetase gene in Aspergillus carbonarius. Appl. Environ. Microbiol. 2012, 78, 8208–8218. [Google Scholar] [CrossRef] [PubMed]
  23. Harris, J.P.; Mantle, P.G. Biosynthesis of ochratoxins by Aspergillus ochraceus. Phytochemistry 2001, 58, 709–716. [Google Scholar] [CrossRef]
  24. Huff, W.; Hamilton, P. Mycotoxins-their biosynthesis in fungi: Ochratoxins-metabolites of combined pathways. J. Food Prot. 1979, 42, 815–820. [Google Scholar] [CrossRef]
  25. Wang, Y.; Wang, L.; Wu, F.; Liu, F.; Wang, Q.; Zhang, X.; Selvaraj, J.N.; Zhao, Y.; Xing, F.; Yin, W.-B.; et al. A consensus ochratoxin A biosynthetic pathway: Insights from the genome sequence of Aspergillus ochraceus and a comparative genomic analysis. Appl. Environ. Microbiol. 2018. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, L.; Wang, Y.; Wang, Q.; Liu, F.; Selvaraj, J.N.; Liu, L. Functional characterization of new polyketide synthase genes involved in ochratoxin A biosynthesis in Aspergillus ochraceus fc-1. Toxins 2015, 7, 2723–2738. [Google Scholar] [CrossRef] [PubMed]
  27. Crespo-Sempere, A.; Marín, S.; Sanchis, V.; Ramos, A.J. VeA and LaeA transcriptional factors regulate ochratoxin A biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2013, 166, 479–486. [Google Scholar] [CrossRef] [PubMed]
  28. Xing, F.; Hua, H.; Selvaraj, J.N.; Zhao, Y.; Zhou, L.; Liu, X.; Liu, Y. Growth inhibition and morphological alterations of Fusarium verticillioides by cinnamon oil and cinnamaldehyde. Food Control 2014, 46, 343–350. [Google Scholar] [CrossRef]
  29. Chao, S.C.; Young, D.G.; Oberg, C.J. Screening for inhibitory activity of essential oils on selected bacteria, fungi and viruses. J. Essent. Oil Res. 2000, 12, 639–649. [Google Scholar] [CrossRef]
  30. Yamamoto-Ribeiro, M.M.G.; Crespan, R.; Kohiyama, C.Y.; Ferreira, F.D.; Mossini, S.A.G.; Silva, E.L. Effect of Zingiber officinale essential oil on Fusarium verticillioides and fumonisin production. Food Chem. 2013, 141, 3147–3152. [Google Scholar] [CrossRef] [PubMed]
  31. Molania, T.; Moghadamnia, A.A.; Pouramir, M.; Aghel, S.; Moslemi, D.; Ghassemi, L.; Motallebnejad, M. The effect of cinnamaldehyde on mucositis and salivary antioxidant capacity in gamma-irradiated rats (a preliminary study). DARU J. Pharm. Sci. 2012, 20, 1–5. [Google Scholar] [CrossRef] [PubMed]
  32. Taquchi, Y.; Hayama, K.; Okada, M.; Sagawa, T.; Arai, R.; Abe, S. Therapeutic effects of cinnamaldehyde and potentiation of its efficacy in combination with methylcellulose on murine oral candidiasis. Med. Mycol. J. 2011, 52, 145–152. [Google Scholar] [CrossRef] [PubMed]
  33. Taguchi, Y.; Hasumi, Y.; Abe, S.; Nishhiyama, Y. The effect of cinnamaldehyde on the growth and the morphology of Candida albicans. Med. Mol. Morphol. 2013, 46, 8–13. [Google Scholar] [CrossRef] [PubMed]
  34. Hong, D.; Han, M. Crystal structure of catena-bis (µ3-5-methoxyisophthalato)-bis(µ2-1,6-bis (imidazol-1-yl)-hexane) nickel (II), [Ni-2(CH3OC8H3O4)2(C12H18N4)2], C42H48N8Ni2O10. Z. Krist-New Cryst. St. 2013, 228, 434–436. [Google Scholar]
  35. Visvalingam, J.; Holley, R.A. Temperature-dependent effect of sublethal levels of cinnamaldehyde on viability and morphology of Escherichia coli. J. Appl. Microbiol. 2012, 113, 591–600. [Google Scholar] [CrossRef] [PubMed]
  36. Tyagi, A.K.; Malik, A. Liquid and vapour-phase antifungal activities of selected essential oils against Candida albicans: Microscopic observations and chemical characterization of Cymbopogon citratus. BMC Complement. Altern. Med. 2009, 10, 65. [Google Scholar] [CrossRef] [PubMed]
  37. De Billerbeck, V.G.; Roques, C.G.; Bessiére, J.M.; Fonvieille, J.L.; Dargent, R. Effects of Cymbopogon nardus (L.) W. Watson essential oil on the growth and morphogenesis of Aspergillus niger. Can. J. Micro Biol. 2001, 47, 9–17. [Google Scholar] [CrossRef]
  38. Khan, M.S.A.; Ahmad, I. In vitro antifungal, anti-elastase and anti-keratinase activity of essential oils of Cinnamomum-, Syzygium- and Cymbopogon-species against Aspergillus fumigatus and Trichophyton rubrum. Phytomedicine 2011, 19, 48–55. [Google Scholar] [CrossRef] [PubMed]
  39. Bang, K.H.; Lee, D.W.; Park, H.M. Inhibition of fungal cell wall synthesizing enzymes by trans-cinnamaldehyde. Biosci. Biotech. Biochem. 2000, 64, 1061–1063. [Google Scholar] [CrossRef]
  40. Ka, H.; Park, H.J.; Jung, H.J.; Choi, J.W.; Cho, K.S.; Ha, J. Cinnamaldehyde induces apoptosis by ROS-mediated mitochondrial permeability transition in human promyelocytic leukemia HL-60 cells. Cancer Lett. 2003, 196, 143–152. [Google Scholar] [CrossRef]
  41. Jahanshiri, Z.; Shams-Ghahfarokhi, M.; Allameh, A.; Razzaghi-Abyaneh, M. Effect of curcumin on Aspergillus parasiticus growth and expression of major genes involved in the early and late stages of aflatoxin biosynthesis. Iran. J. Public Health 2012, 41, 72–79. [Google Scholar] [PubMed]
  42. Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef] [PubMed]
  43. Hua, S.S.T.; Beck, J.J.; Sarreal, S.B.L.; Gee, W. The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Res. 2014, 30, 71–78. [Google Scholar] [CrossRef] [PubMed]
  44. Yahyaraeyat, R.; Khosravi, A.R.; Shahbazzadeh, D.; Khalaj, V. The potential effects of Zataria multiflora Boiss essential oil on growth, aflatoxin production and transcription of aflatoxin biosynthesis pathway genes of toxigenic Aspergillus parasiticus. Braz. J. Microbiol. 2013, 44, 643–649. [Google Scholar] [CrossRef] [PubMed]
  45. Caceres, I.; Khoury, R.E.; Bailly, S.; Oswald, I.P.; Puel, O.; Bailly, J.-D. Piperine inhibits aflatoxin B1 production in Aspergillus flavus by modulating fungal oxidative stress response. Fungal Genet. Biol. 2017, 107, 77–85. [Google Scholar] [CrossRef] [PubMed]
  46. Lv, C.; Wang, P.; Ma, L.; Zheng, M.; Liu, Y.; Xing, F. Large-scale comparative analysis of eugenol-induced/repressed genes expression in Aspergillus flavus using RNA-seq. Front. Microbiol. 2018, 9, 1116. [Google Scholar] [CrossRef] [PubMed]
  47. Gerin, D.; De Miccolis Angelini, R.M.; Pollastro, S.; Faretra, F. RNA-Seq reveals OTA-related gene transcriptional changes in Aspergillus carbonarius. PLoS ONE 2016, 11, e0147089. [Google Scholar] [CrossRef] [PubMed]
  48. Gil-Serna, J.; García-Díaz, M.; González-Jaén, M.T.; Vázquez, C.; Patiño, B. Description of an orthologous cluster of ochratoxin A biosynthetic genes in Aspergillus and Penicillium species. A comparative analysis. Int. J. Food Microbiol. 2018, 268, 35–43. [Google Scholar] [CrossRef] [PubMed]
  49. Park, H.S.; Ni, M.; Jeong, K.C.; Kim, Y.H.; Yu, J.H. The role, interaction and regulation of the velvet regulator VelB in Aspergillus nidulans. PLoS ONE 2012, 7, e45935. [Google Scholar] [CrossRef] [PubMed]
  50. Soliman, K.M.; Badeaa, R.I. Effect of oil extracted from some medicinal plants on different mycotoxigenic fungi. Food Chem. Toxicol. 2002, 40, 1669–1675. [Google Scholar] [CrossRef]
  51. Leong, S.L.L.; Hocking, A.D.; Scott, E.S. Effect of temperature and water activity on growth and ochratoxin A production by Australian Aspergillus carbonarius and A. niger isolates on a simulated grape juice medium. Int. J. Food Microbiol. 2006, 110, 209–216. [Google Scholar] [CrossRef] [PubMed]
  52. Copetti, M.V.; Iamanaka, B.T.; Mororó, R.C.; Pereira, J.L.; Frisvad, J.C.; Taniwaki, M.H. The effect of cocoa fermentation and weak organic acids on growth and ochratoxin A production by Aspergillus species. Int. J. Food Microbiol. 2012, 155, 158–164. [Google Scholar] [CrossRef] [PubMed]
  53. Scudamore, K.A.; Macdonald, S.J. A collaborative study of an HPLC method for determination of ochratoxin A in wheat using immunoaflinity column clean-up. Food Addit. Contam. 1998, 15, 401–410. [Google Scholar] [CrossRef] [PubMed]
  54. Bray, D. Critical point drying of biological specimens for scanning electron microscopy. In Supercritical Fluid Methods and Protocols; Williams, J.R., Clifford, A.A., Eds.; Humana Press: New York, NY, USA, 2000; Volume 13, pp. 235–243. [Google Scholar]
  55. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinf. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
  56. Xing, F.; Wang, L.; Liu, X.; Selvaraj, J.N.; Wang, Y.; Zhao, Y.; Liu, Y. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus. Int. J. Food Microbiol. 2017, 256, 1–10. [Google Scholar] [CrossRef] [PubMed]
  57. Wang, Y.; Liu, F.; Wang, L.; Wang, Q.; Selvaraj, J.N.; Zhao, Y.; Wang, Y.; Xing, F.; Liu, Y. pH-signaling transcription factor AopacC regulators ochratoxin A biosynthesis in Aspergillus ochraceus. J. Agric. Food Chem. 2018, 66, 4394–4401. [Google Scholar] [CrossRef] [PubMed]
  58. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effect of cinnamaldehyde fumigation on the gowth of A. ochraceus. Values represent the means of ten replicates and their standard deviation. Different letters show the significance of difference (p < 0.05) between treatments.
Figure 1. Effect of cinnamaldehyde fumigation on the gowth of A. ochraceus. Values represent the means of ten replicates and their standard deviation. Different letters show the significance of difference (p < 0.05) between treatments.
Toxins 10 00340 g001
Figure 2. SEM images of the nonfumigated A. ochraceus mycelia (AC) and fumigated mycelia (DF) with 0.4 mmol/L of cinnamaldehyde.
Figure 2. SEM images of the nonfumigated A. ochraceus mycelia (AC) and fumigated mycelia (DF) with 0.4 mmol/L of cinnamaldehyde.
Toxins 10 00340 g002
Figure 3. TEM images of A. ochraceus cells grown for 24 h in MEA with (A) 0 (control), or (B–F) 0.4 mmol/L of cinnamaldehyde. DCW, disruption of cell walls; WV, wide vacuoles; DAM, disorganized aggregated mitochondria; LLG, large lipid globules; TCW, thin cell wall; DNM, disintegration of nuclear membrane; CNM, clumping of nuclear material; PP, appearing of the precipitates.
Figure 3. TEM images of A. ochraceus cells grown for 24 h in MEA with (A) 0 (control), or (B–F) 0.4 mmol/L of cinnamaldehyde. DCW, disruption of cell walls; WV, wide vacuoles; DAM, disorganized aggregated mitochondria; LLG, large lipid globules; TCW, thin cell wall; DNM, disintegration of nuclear membrane; CNM, clumping of nuclear material; PP, appearing of the precipitates.
Toxins 10 00340 g003
Figure 4. Effect of cinnamaldehyde on the transcript levels of pks, nrps, veA, laeA, and velB in A. ochraceus. Fold change levels of genes in A. ochraceus treated with 0.4 mmol/L cinnamaldehyde (blue bars), 1.0 mmol/L cinnamaldehyde (orange bars). Baseline represents the expression levels of genes in untreated fungus (treated as 1.0), * p < 0.05, ** p < 0.01.
Figure 4. Effect of cinnamaldehyde on the transcript levels of pks, nrps, veA, laeA, and velB in A. ochraceus. Fold change levels of genes in A. ochraceus treated with 0.4 mmol/L cinnamaldehyde (blue bars), 1.0 mmol/L cinnamaldehyde (orange bars). Baseline represents the expression levels of genes in untreated fungus (treated as 1.0), * p < 0.05, ** p < 0.01.
Toxins 10 00340 g004
Table 1. Inhibitory effect of cinnamaldehyde on Ochratoxin A production.
Table 1. Inhibitory effect of cinnamaldehyde on Ochratoxin A production.
Concentration of Cinnamaldehyde (mmol/L)OTA Production
(ng/mm2 colony)
Inhibition Ratio
(%)
01.90 ± 0.45 a-
0.40.34 ± 0.14 b82.0
1.00.03 ± 0.03 c98.7
1.60.00 ± 0.00 d100.0
Values are mean (n = 10) ± RSD (relative standard deviation). Different letters show the significance of differences (p < 0.05) between treatments.
Table 2. Primers sequences and their PCR products.
Table 2. Primers sequences and their PCR products.
GenePrimer NamePrimers (5′ to 3′)Product Length (bp)
GADPHG-F
G-R
CGCTCAGAACATCATCCCCA
ATGTCCTCGTAGGTGACGGA
142
pksP-F
P-R
CGCCTCATCATCAATCCTT
CAACTCGGTCAAGCAGAT
144
nrpsN-F
N-R
TGTGGACATCTGGAAGCA
GTGAACGAGGTGAATTGGA
136
veAVA-F
VA-R
ACCAACATCAGCCGTGTCAT
GTACGAGTCAGGCGTGGAAA
159
laeAL-F
L-R
GCCCAATAGCCCACAACTCT
TGTACCACCGAGCAACCTTC
141
velBVB-F
VB-R
TACTATTCGGGAGGCGGTCA
TTGTTGTCGGGATCGGTCAG
143

Share and Cite

MDPI and ACS Style

Wang, L.; Jin, J.; Liu, X.; Wang, Y.; Liu, Y.; Zhao, Y.; Xing, F. Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis. Toxins 2018, 10, 340. https://doi.org/10.3390/toxins10090340

AMA Style

Wang L, Jin J, Liu X, Wang Y, Liu Y, Zhao Y, Xing F. Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis. Toxins. 2018; 10(9):340. https://doi.org/10.3390/toxins10090340

Chicago/Turabian Style

Wang, Limin, Jing Jin, Xiao Liu, Yan Wang, Yang Liu, Yueju Zhao, and Fuguo Xing. 2018. "Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis" Toxins 10, no. 9: 340. https://doi.org/10.3390/toxins10090340

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop