Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Data Mining
2.3. DNA, RNA Extraction and cDNA Synthesis
2.4. Full-Length cDNA and Gene Cloning from Anemonia viridis
2.5. Sequence and Phylogenetic and Structural Analyses
2.6. Anemonia viridis Translationally Controlled Tumour Protein Tissue-Specific Expression Pattern
2.7. Challenging Sea Anemone with Environmental Elicitors
2.8. Quantitative Reverse Transcription PCR (RT-qPCR)
3. Results and Discussion
3.1. Anemonia viridis cDNA Characterisation and Identification of TCTPs in Cnidarians
3.2. Phylogenetic and Structural Analysis of Cnidarian TCTPs
3.3. Phylogenetic Analysis with other Eumetazoa and Structural Inferences
3.4. Tissue Expression Pattern of AvTCTP
3.5. Expression Profiles in Response to Thermal, Chemical and Biotic Challenges
4. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Bommer, U.-A.; Thiele, B.-J. The translationally controlled tumour protein (TCTP). Int. J. Biochem. Cell Biol. 2004, 36, 379–385. [Google Scholar] [CrossRef] [Scilit]
- Thaw, P.; Baxter, N.J.; Hounslow, A.M.; Price, C.; Waltho, J.P.; Craven, C.J. Structure of TCTP reveals unexpected relationship with guanine nucleotide-free chaperones. Nat. Struct. Biol. 2001, 8, 701–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gnanasekar, M.; Rao, K.V.N.; Chen, L.; Narayanan, R.B.; Geetha, M.; Scott, A.L.; Ramaswamy, K.; Kaliraj, P. Molecular characterization of a calcium binding translationally controlled tumour protein homologue from the filarial parasites Brugia malayi and Wuchereria bancrofti. Mol. Biochem. Parasitol. 2002, 121, 107–118. [Google Scholar] [CrossRef] [Scilit]
- Meyvis, Y.; Houthoofd, W.; Visser, A.; Borgonie, G.; Gevaert, K.; Vercruysse, J.; Claerebout, E.; Geldhof, P. Analysis of the translationally controlled tumour protein in the nematodes Ostertagia ostertagi and Caenorhabditis elegans suggests a pivotal role in egg production. Int. J. Parasitol. 2009, 39, 1205–1213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Fang, D.-A.; Li, W.-W.; Wang, J.; Jiang, H. A Novel TCTP Gene from the crustacean Eriocheir sinensis: possible role involving metallic Cu2+ stress. Biol. Bull. 2011, 221, 290–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Wu, B.; Ye, T.; Huang, H.; Dai, C.; Yuan, J.; Wang, W. TCTP is a critical factor in shrimp immune response to virus infection. PLoS ONE 2013, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajesh, S.; Kamalakannan, V.; Narayanan, R.B. Immune modulations and protection by translationally controlled tumour protein (TCTP) in Fenneropenaeus indicus harboring white spot syndrome virus infection. J. Invertebr. Pathol. 2014, 120, 33–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bangrak, P.; Graidist, P.; Chotigeat, W.; Phongdara, A. Molecular cloning and expression of a mammalian homologue of a translationally controlled tumour protein (TCTP) gene from Penaeus monodon shrimp. J. Biotechnol. 2004, 108, 219–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; He, N.; Lei, K.; Xu, X. Genomic organization of the translationally controlled tumour protein (TCTP) gene from shrimp Marsupenaeus japonicus. Mol. Biol. Rep. 2009, 36, 1135–1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Qiu, L.; Ning, X.; Chen, A.; Qin, S.; Wu, H.; Zhao, J. The first molluscan TCTP in Venerupis philippinarum: Molecular cloning and expression analysis. Fish Shellfish Immunol. 2010, 29, 530–533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, L.; Ning, X.; Liu, F.; Zhao, J.; Wang, Q.; Wu, H. The response profiles of HSPA12A and TCTP from Mytilus galloprovincialis to pathogen and cadmium challenge. Fish Shellfish Immunol. 2013, 35, 343–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, Z.; Wang, M.; Yue, F.; Wang, X.; Wang, L.; Song, L. The immunomodulation of a maternal translationally controlled tumour protein (TCTP) in Zhikong scallop Chlamys farreri. Fish Shellfish Immunol. 2017, 60, 141–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, F.; Zhang, D.; Fujise, K. Characterization of Fortilin, a Novel Antiapoptotic Protein. J. Biol. Chem. 2001, 276, 47542–47549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koide, Y.; Kiyota, T.; Tonganunt, M.; Pinkaew, D.; Liu, Z.; Kato, Y.; Hutadilok-Towantana, N.; Phongdara, A.; Fujise, K. Embryonic Lethality of Fortilin-null mutant mice by BMP-pathway overactivation. Biochim. Biophys. Acta 2009, 1790, 326–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, L.; Fei, K.; Bridge, D.; Sarras, M.P. A cnidarian homologue of translationally controlled tumour protein (P23/TCTP). Dev. Genes Evol. 2000, 210, 507–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richier, S.; Sabourault, C.; Courtiade, J.; Zucchini, N.; Allemand, D.; Furla, P. Oxidative stress and apoptotic events during thermal stress in the symbiotic sea anemone, Anemonia viridis. FEBS J. 2006, 273, 4186–4198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venn, A.A.; Tambutté, E.; Lotto, S.; Zoccola, D.; Allemand, D.; Tambutté, S. Imaging intracellular pH in a reef coral and symbiotic anemone. Proc. Natl. Acad. Sci. USA 2009, 106, 16574–16579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ball, E.E.; Hayward, D.C.; Saint, R.; Miller, D.J. A simple plan—Cnidarians and the origins of developmental mechanisms. Nat. Rev. Genet. 2004, 5, 567–577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grasshoff, M. Cnidarian phylogeny—A biomechanical approach. In Recent Advances in the Paleobiology and Geology of the Cnidaria, Palontographica Americana; Paleontological Research Institution: Ithaca, NY, USA, 1984; pp. 127–135. [Google Scholar]
- Bridge, D.; Cunningham, C.W.; DeSalle, R.; Buss, L.W. Class-level relationships in the phylum Cnidaria: Molecular and morphological evidence. Mol. Biol. Evol. 1995, 12, 679–689. [Google Scholar] [PubMed]
- Kortschak, R.D.; Samuel, G.; Saint, R.; Miller, D.J. EST analysis of the cnidarian Acropora millepora reveals extensive gene loss and rapid sequence divergence in the model invertebrates. Curr. Biol. 2003, 13, 2190–2195. [Google Scholar] [CrossRef] [PubMed]
- Putnam, N.H.; Srivastava, M.; Hellsten, U.; Dirks, B.; Chapman, J.; Salamov, A.; Terry, A.; Shapiro, H.; Lindquist, E.; Kapitonov, V.V.; et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 2007, 317, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicosia, A.; Maggio, T.; Costa, S.; Salamone, M.; Tagliavia, M.; Mazzola, S.; Gianguzza, F.; Cuttitta, A. Maintenance of a protein structure in the dynamic evolution of TIMPs over 600 Million years. Genome Biol. Evol. 2016, 8, 1056–1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarras, M.P. Components, structure, biogenesis and function of the Hydra extracellular matrix in regeneration, pattern formation and cell differentiation. Int. J. Dev. Biol. 2012, 56, 567–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martindale, M.Q.; Pang, K.; Finnerty, J.R. Investigating the origins of triploblasty: “mesodermal” gene expression in a diploblastic animal, the sea anemone Nematostella vectensis (phylum, Cnidaria; class, Anthozoa). Development 2004, 131, 2463–2474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burton, P.M. Insights from diploblasts; the evolution of mesoderm and muscle. J. Exp. Zool. B Mol. Dev. Evol. 2008, 310, 5–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cuttitta, A.; Ragusa, M.A.; Costa, S.; Bennici, C.; Colombo, P.; Mazzola, S.; Gianguzza, F.; Nicosia, A. Evolutionary conserved mechanisms pervade structure and transcriptional modulation of allograft inflammatory factor-1 from sea anemone Anemonia viridis. Fish Shellfish Immunol. 2017, 67, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sabourault, C.; Ganot, P.; Deleury, E.; Allemand, D.; Furla, P. Comprehensive EST analysis of the symbiotic sea anemone, Anemonia viridis. BMC Genom. 2009, 10, 333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, J.A.; Kirkness, E.F.; Simakov, O.; Hampson, S.E.; Mitros, T.; Weinmaier, T.; Rattei, T.; Balasubramanian, P.G.; Borman, J.; Busam, D.; et al. The dynamic genome of Hydra. Nature 2010, 464, 592–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shinzato, C.; Shoguchi, E.; Kawashima, T.; Hamada, M.; Hisata, K.; Tanaka, M.; Fujie, M.; Fujiwara, M.; Koyanagi, R.; Ikuta, T.; et al. Using the Acropora digitifera genome to understand coral responses to environmental change. Nature 2011, 476, 320–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kozlov, S.; Grishin, E. The mining of toxin-like polypeptides from EST database by single residue distribution analysis. BMC Genom. 2011, 12, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicosia, A.; Maggio, T.; Mazzola, S.; Cuttitta, A. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis. Mar. Drugs 2013, 11, 4213–4231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicosia, A.; Maggio, T.; Mazzola, S.; Gianguzza, F.; Cuttitta, A.; Costa, S. Characterization of small HSPs from Anemonia viridis reveals insights into molecular evolution of alpha crystallin genes among cnidarians. PLoS ONE 2014, 9, e105908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Armon, A.; Graur, D.; Ben-Tal, N. ConSurf: An algorithmic tool for the identification of functional regions in proteins by surface mapping of phylogenetic information. J. Mol. Biol. 2001, 307, 447–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finn, R.D.; Attwood, T.K.; Babbitt, P.C.; Bateman, A.; Bork, P.; Bridge, A.J.; Chang, H.-Y.; Dosztányi, Z.; El-Gebali, S.; Fraser, M.; et al. InterPro in 2017—beyond protein family and domain annotations. Nucleic Acids Res. 2017, 45, D190–D199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finn, R.D.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Mistry, J.; Mitchell, A.L.; Potter, S.C.; Punta, M.; Qureshi, M.; Sangrador-Vegas, A.; et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 2016, 44, D279–D285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sigrist, C.J.A.; de Castro, E.; Cerutti, L.; Cuche, B.A.; Hulo, N.; Bridge, A.; Bougueleret, L.; Xenarios, I. New and continuing developments at PROSITE. Nucleic Acids Res. 2013, 41, D344–D347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- T-Coffee Server. Available online: http://tcoffee.crg.cat/apps/tcoffee/do:regular (accessed on 10 January 2018).
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salamone, M.; Nicosia, A.; Bennici, C.; Quatrini, P.; Catania, V.; Mazzola, S.; Ghersi, G.; Cuttitta, A. Comprehensive analysis of a Vibrio parahaemolyticus strain extracellular serine protease VpSP37. PLoS ONE 2015, 10, e0126349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modelling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Touw, W.G.; Baakman, C.; Black, J.; te Beek, T.A.H.; Krieger, E.; Joosten, R.P.; Vriend, G. A series of PDB-related databanks for everyday needs. Nucleic Acids Res. 2015, 43, D364–D368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kabsch, W.; Sander, C. Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 1983, 22, 2577–2637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bommer, U.-A.; Borovjagin, A.V.; Greagg, M.A.; Jeffrey, I.W.; Russell, P.; Laing, K.G.; Lee, M.; Clemens, M.J. The mRNA of the translationally controlled tumour protein P23/TCTP is a highly structured RNA, which activates the dsRNA-dependent protein kinase PKR. RNA 2002, 8, 478–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, C.; Chen, T.; Jiang, X.; Wang, Y.; Hu, C. The first characterization of gene structure and biological function for echinoderm translationally controlled tumour protein (TCTP). Fish Shellfish Immunol. 2014, 41, 137–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, S.W.; Gilbert, W. Rates of intron loss and gain: Implications for early eukaryotic evolution. Proc. Natl. Acad. Sci. USA 2005, 102, 5773–5778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rogozin, I.B.; Carmel, L.; Csuros, M.; Koonin, E.V. Origin and evolution of spliceosomal introns. Biol. Direct 2012, 7, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seipel, K.; Schmid, V. Mesodermal anatomies in cnidarian polyps and medusae. Int. J. Dev. Biol. 2006, 50, 589–599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, X.; Yang, B.; Li, Y.; Zhong, C.; Ding, J. Molecular basis of the acceleration of the GDP-GTP exchange of human ras homolog enriched in brain by human translationally controlled tumour protein. J. Biol. Chem. 2009, 284, 23754–23764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gachet, Y.; Tournier, S.; Lee, M.; Lazaris-Karatzas, A.; Poulton, T.; Bommer, U.A. The growth-related, translationally controlled protein P23 has properties of a tubulin binding protein and associates transiently with microtubules during the cell cycle. J. Cell. Sci. 1999, 112 pt 8, 1257–1271. [Google Scholar] [PubMed]
- Overington, J.; Donnelly, D.; Johnson, M.S.; Sali, A.; Blundell, T.L. Environment-specific amino acid substitution tables: Tertiary templates and prediction of protein folds. Protein Sci. 1992, 1, 216–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldman, N.; Thorne, J.L.; Jones, D.T. Assessing the impact of secondary structure and solvent accessibility on protein evolution. Genetics 1998, 149, 445–458. [Google Scholar] [PubMed]
- Bloom, J.D.; Drummond, D.A.; Arnold, F.H.; Wilke, C.O. Structural determinants of the rate of protein evolution in yeast. Mol. Biol. Evol. 2006, 23, 1751–1761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Franzosa, E.A.; Xia, Y. Structural determinants of protein evolution are context-sensitive at the residue level. Mol. Biol. Evol. 2009, 26, 2387–2395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramsey, D.C.; Scherrer, M.P.; Zhou, T.; Wilke, C.O. The relationship between relative solvent accessibility and evolutionary rate in protein evolution. Genetics 2011, 188, 479–488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blundell, T.L.; Wood, S.P. Is the evolution of insulin Darwinian or due to selectively neutral mutation? Nature 1975, 257, 197–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, J.; James, M.N.G.; Hsu, I.N.; Jenkins, J.A.; Blundell, T.L. Structural evidence for gene duplication in the evolution of the acid proteases. Nature 1978, 271, 618–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ragusa, M.A.; Nicosia, A.; Costa, S.; Cuttitta, A.; Gianguzza, F. Metallothionein gene family in the sea urchin paracentrotus lividus: gene structure, differential expression and phylogenetic analysis. Int. J. Mol. Sci. 2017, 18, 812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, J.; Guo, M.; Ji, H.; Yan, Y.; Ouyang, Z.; Huang, X.; Hang, Y.; Qin, Q. Grouper translationally controlled tumour protein prevents cell death and inhibits the replication of Singapore grouper iridovirus (SGIV). Fish Shellfish Immunol. 2012, 33, 916–925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thayanithy, V.; Venugopal, T. Evolution and expression of translationally controlled tumour protein (TCTP) of fish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2005, 142, 8–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarras, M.P.; Deutzmann, R. Hydra and Niccolo Paganini (1782–1840)—Two peas in a pod? The molecular basis of extracellular matrix structure in the invertebrate, Hydra. Bioessays 2001, 23, 716–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, H.; Aufschnaiter, R.; Li, L.; Sarras, M.P.; Borza, D.-B.; Abrahamson, D.R.; Sado, Y.; Zhang, X. The extracellular matrix of hydra is a porous sheet and contains type IV collagen. Zoology 2008, 111, 410–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Macrander, J.; Broe, M.; Daly, M. Tissue-specific venom composition and differential gene expression in sea anemones. Genome Biol. Evol. 2016, 8, 2358–2375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bode, H.R. Axial patterning in Hydra. Cold Spring Harb. Perspect. Biol. 2009, 1, a000463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moya, A.; Huisman, L.; Ball, E.E.; Hayward, D.C.; Grasso, L.C.; Chua, C.M.; Woo, H.N.; Gattuso, J.-P.; Forêt, S.; Miller, D.J. Whole transcriptome analysis of the coral Acropora millepora reveals complex responses to CO2-driven acidification during the initiation of calcification. Mol. Ecol. 2012, 21, 2440–2454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wooldridge, S.A. Is the coral-algae symbiosis really ‘mutually beneficial’ for the partners? Bioessay 2010, 32, 615–625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagano-Ito, M.; Ichikawa, S. Biological effects of Mammalian translationally controlled tumour protein (TCTP) on cell death, proliferation and tumorigenesis. Biochem. Res. Int. 2012, 2012, 204960. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, A.; Bellamy, A.R.; Taylor, J.A. Expression of translationally controlled tumour protein is regulated by calcium at both the transcriptional and post-transcriptional level. Biochem. J. 1999, 342, 683–689. [Google Scholar] [CrossRef] [PubMed]
- Bridges, C.C.; Zalups, R.K. Molecular and ionic mimicry and the transport of toxic metals. Toxicol. Appl. Pharmacol. 2005, 204, 274–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thiele, H.; Berger, M.; Lenzner, C.; Kühn, H.; Thiele, B.J. Structure of the promoter and complete sequence of the gene coding for the rabbit translationally controlled tumour protein (TCTP) P23. Eur. J. Biochem. 1998, 257, 62–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ganesan, S.; Volodina, O.; Pearce, S.C.; Gabler, N.K.; Baumgard, L.H.; Rhoads, R.P.; Selsby, J.T. Acute heat stress activated inflammatory signaling in porcine oxidative skeletal muscle. Physiol. Rep. 2017, 5, e13397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souza, V.; Escobar, M.D.; Mdel, C.; Gómez-Quiroz, L.; Bucio, L.; Hernández, E.; Cossio, E.C.; Gutiérrez-Ruiz, M.C. Acute cadmium exposure enhances AP-1 DNA binding and induces cytokines expression and heat shock protein 70 in HepG2 cells. Toxicology 2004, 197, 213–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kondo, M.; Inamura, H.; Matsumura, K.; Matsuoka, M. Cadmium activates extracellular signal-regulated kinase 5 in HK-2 human renal proximal tubular cells. Biochem. Biophys. Res. Commun. 2012, 421, 490–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brulle, F.; Cocquerelle, C.; Mitta, G.; Castric, V.; Douay, F.; Leprêtre, A.; Vandenbulcke, F. Identification and expression profile of gene transcripts differentially expressed during metallic exposure in Eisenia fetida coelomocytes. Dev. Comp. Immunol. 2008, 32, 1441–1453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stürzenbaum, S.R.; Kille, P.; Morgan, A.J. Identification of heavy metal induced changes in the expression patterns of the translationally controlled tumour protein (TCTP) in the earthworm Lumbricus rubellus. Biochim. Biophys. Acta 1998, 1398, 294–304. [Google Scholar] [CrossRef] [Scilit]
- Augustin, R.; Bosch, T.C.G. Cnidarian immunity: A tale of two barriers. Adv. Exp. Med. Biol. 2010, 708, 1–16. [Google Scholar] [PubMed]
- Kabanov, D.S.; Prokhorenko, I.R. Structural analysis of lipopolysaccharides from Gram-negative bacteria. Biochemistry 2010, 75, 383–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wheeler, R.; Chevalier, G.; Eberl, G.; Gomperts Boneca, I. The biology of bacterial peptidoglycans and their impact on host immunity and physiology. Cell Microbiol. 2014, 16, 1014–1023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, D.J.; Hemmrich, G.; Ball, E.E.; Hayward, D.C.; Khalturin, K.; Funayama, N.; Agata, K.; Bosch, T.C. The innate immune repertoire in cnidaria—Ancestral complexity and stochastic gene loss. Genome Biol. 2007, 8, R59. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primers | Sequences (5′–3′) | Amplicon Size (bp) |
|---|---|---|
| 3′ RACE | GACCGCTTTAATGGAGTCTTC F | - |
| Fl-TCTP | GAGGTCGAGCTGTACCAACAA F | 877 |
| TTGTTCACGACGAACTTCCTAC R | ||
| RCC2 | GGTTCCAAATCCTCCACAAACC F | 83 |
| TGTCCCAATCCGCACGTTAC R | ||
| COP γ | GCCTGTTGGACACCGATGAT F | 142 |
| TGCAAGGCTCTCTCCAGTCC R | ||
| qTCTP | GGATGAAATGTTCGGAGGAAAC F | 133 |
| CATAGTGGGCTGTTCGCTGTAT R | ||
| F Forward primer | ||
| R Reverse primer | ||
| Species | Accession Number | Taxonomic Group |
|---|---|---|
| Homo sapiens | AAQ01550.1 | Mammalia |
| Mus musculus | NP033455.1 | Mammalia |
| Sus scrofa | AAL68965.1 | Mammalia |
| Rattus norvegicus | NP446319.1 | Mammalia |
| Gallus gallus | NP990729.1 | Aves |
| Xenopus tropicalis | NP_001008074.1 | Amphibia |
| Pogona vitticeps | XP_020652710.1 | Reptilia |
| Danio rerio | NP937783.1 | Osteichtyes |
| Salmo salar | ACI68686.1 | Osteichtyes |
| Xiphophorus maculatus | XP005807723.1 | Osteichtyes |
| Takifugu rubripes | XP003962088.1 | Osteichtyes |
| Petromyzon marinus | EB084009.1 | Agnata |
| Branchiostoma floridae | XP_002592847.1 | Cephalochordata |
| Ciona intestinalis | FK151528.1 | Tunicata |
| Apostichopus japonicus | ABC87996.1 | Echinodermata |
| Stichopus monotuberculatus | AID69538.1 | Echinodermata |
| Strongylocentrotus purpuratus | XP795619.2 | Echinodermata |
| Nilaparvata lugens | XP_022184371.1 | Insecta |
| Drosophila melanogaster | NP001303431.1 | Insecta |
| Anopheles sinensis | KFB46001.1 | Insecta |
| Spodoptera frugiperda | ADK56158.1 | Insecta |
| Harpegnathos saltator | XP011150938.1 | Insecta |
| Megachile rotundata | XP_003700051.1 | Insecta |
| Fenneropenaeus chinensis | ABB05535.1 | Crustacea |
| Penaeus monodon | ACD13588.1 | Crustacea |
| Lepeophtheirus salmonis | ACO12977.1 | Crustacea |
| Octopus bimaculoides | XP_014780570.1 | Mollusca |
| Aplysia californica | XP_005092645.1 | Mollusca |
| Crassostrea virginica | XP_022338092.1 | Mollusca |
| Caenorhabditis elegans | Q93573.1 | Nematoda |
| Caenorhabditis remanei | EFP12520.1 | Nematoda |
| Dictyocaulus viviparus | KJH46926.1 | Nematoda |
| Brugia malayi | XP001897741 | Nematoda |
| Clonorchis sinensis | AAX84199.1 | Platyhelmintes |
| Macrostomum lignano | PAA86325.1 | Platyhelmintes |
| Hydra vulgaris 1 | NM_001309745.1 | Hydrozoa |
| Hydra vulgaris 2 | XM_002157314.3 | Hydrozoa |
| Hydractinia echinata | DT623491.1 | Hydrozoa |
| Podocoryna carnea | DY451741.1 | Hydrozoa |
| Clytia hemisphaerica | FP985759.1 | Hydrozoa |
| Polypodium hydriforme | GBGH01019625.1 | Hydrozoa |
| Kudoa iwatai | GBGI01001069.1 | Myxozoa |
| Aurelia aurita | GBRG01251580.1 | Scyphozoa |
| Alatina alata | GEUJ01004399.1 | Cubozoa |
| Haliclystus sanjuanensis | HAHB01030183.1 | Staurozoa |
| Haliclystus auricula | HAHA01057349.1 | Staurozoa |
| Calvadosia cruxmelitensis | HAHC01090444.1 | Staurozoa |
| Acanthogiorgia aspera | GETB01037007.1 | Anthozoa Octocorallia |
| Heliopora coerulea | IABP01022130.1 | Anthozoa Octocorallia |
| Acropora digitifera | XP_015766473.1 | Anthozoa Hexacorallia |
| Acropora millepora | JR988252.1 | Anthozoa Hexacorallia |
| Acropora palmata | GW212294.1 | Anthozoa Hexacorallia |
| Montastraea faveolata | GW258989.1 | Anthozoa Hexacorallia |
| Nematostella vectensis | XM_001624752.1 | Anthozoa Hexacorallia |
| Metridiumsenile | FC834313.1 | Anthozoa Hexacorallia |
| Anemonia viridis | FK734027.1 | Anthozoa Hexacorallia |
| Aiptasia pulchella | CK662981.1 | Anthozoa Hexacorallia |
| Exaiptasia pallida | XP_020911835.1 | Anthozoa Hexacorallia |
| Amphimedon qeenslandica | XP_003382650.1 | Porifera |
| Organism | Protein Length a | Molecular Weight b | pI c | Templates d |
|---|---|---|---|---|
| A. millepora | 173 | 19,436.99 | 4.60 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| 1TXJ (P. knowlesi) | ||||
| A. digitifera | 173 | 19,392.98 | 4.65 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| 1TXJ (P. knowlesi) | ||||
| A. viridis | 180 | 20,553.34 | 4.54 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| N. vectensis | 181 | 20,715.78 | 4.78 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| E. pallida | 185 | 21,076.87 | 4.73 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| H. vulgaris 1 | 184 | 20,950.68 | 4.76 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| 1TXJ (P. knowlesi) | ||||
| H. vulgaris 2 | 180 | 20,854.76 | 5.48 | 1H6Q (S. pombe) |
| 2KWB (C. elegans) | ||||
| 1YZ1 (H. sapiens) | ||||
| 1TXJ (P. knowlesi) |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nicosia, A.; Bennici, C.; Biondo, G.; Costa, S.; Di Natale, M.; Masullo, T.; Monastero, C.; Ragusa, M.A.; Tagliavia, M.; Cuttitta, A. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues. Genes 2018, 9, 30. https://doi.org/10.3390/genes9010030
Nicosia A, Bennici C, Biondo G, Costa S, Di Natale M, Masullo T, Monastero C, Ragusa MA, Tagliavia M, Cuttitta A. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues. Genes. 2018; 9(1):30. https://doi.org/10.3390/genes9010030
Chicago/Turabian StyleNicosia, Aldo, Carmelo Bennici, Girolama Biondo, Salvatore Costa, Marilena Di Natale, Tiziana Masullo, Calogera Monastero, Maria Antonietta Ragusa, Marcello Tagliavia, and Angela Cuttitta. 2018. "Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues" Genes 9, no. 1: 30. https://doi.org/10.3390/genes9010030
APA StyleNicosia, A., Bennici, C., Biondo, G., Costa, S., Di Natale, M., Masullo, T., Monastero, C., Ragusa, M. A., Tagliavia, M., & Cuttitta, A. (2018). Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues. Genes, 9(1), 30. https://doi.org/10.3390/genes9010030

