From FISH to Hi-C: The Chromatin Architecture of the Chromosomal Region 7q36.3, Frequently Rearranged in Leukemic Cells, Is Evolutionary Conserved
Abstract
:1. Introduction
2. Results
2.1. Genomic Organization and Transcriptional Properties of the Gene Cluster in Human 7q36.3 Band
2.2. The 7q36.3 Chromosomal Band in the Human K562 Cell Line
2.3. Radial Nuclear Location of the MNX1 Alleles in the K562 Cells
2.4. Contact-Map and TAD Organization of the Human 7q36.3 Region
2.5. Contact-Map of the Mouse Regions Syntenic to the Human 7q36.3 Region
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. In Situ Hybridization
4.3. Radial Nuclear Location Analysis
4.4. Expression Analysis
4.5. Hi-C Data Sets and Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
AML | Acute Myeloid Leukemia |
BAC | Bacterial artificial chromosome |
CML | Chronic Myeloid Leukemia |
CTCF | CCCTC-binding factor |
DAPI | 4′,6-diamidino-2-phenylindole |
En2 | Engrailed homeobox 2 |
EXH2 | Enhancer of Zeste 2 Polycomb Repressive Complex 2 Subunit |
FISH | Fluorescence in situ hybridization |
GTEx | Genotype-Tissue Expression (GTEx) |
Hi-C | High-throughput chromosome conformation capture |
K562 | Leukemia derived cell line |
KMT2E | Lysine Methyltransferase 2E |
LMBR1 | Limb Development Membrane Protein 1 |
MET | MET Proto-Oncogene, Receptor Tyrosine Kinase |
MNX1 | Motor Neuron And Pancreas Homeobox 1 |
NOM1 | Nucleolar Protein With MIF4G Domain 1 |
PHA | Phytohaemagglutinin |
PTPRN2 | Protein Tyrosine Phosphatase Receptor Type N2 |
Shh | Sonic Hedgehog Signaling Molecule |
TAD | Topologically Associated Domain |
TBP | Tata-box binding protein |
UBE3C | Ubiquitin Protein Ligase E3C |
References
- Lieberman-Aiden, E.; van Berkum, N.L.; Williams, L.; Imakaev, M.; Ragoczy, T.; Telling, A.; Amit, I.; Lajoie, B.R.; Sabo, P.J.; Dorschner, M.O.; et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science 2009, 326, 289–293. [Google Scholar] [CrossRef] [Green Version]
- Hansen, P.; Gargano, M.; Hecht, J.; Ibn-Salem, J.; Karlebach, G.; Roehr, J.T.; Robinson, P.N. Computational Processing and Quality Control of Hi-C, Capture Hi-C and Capture-C Data. Genes 2019, 10, 548. [Google Scholar] [CrossRef] [Green Version]
- Cremer, T.; Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nat. Rev. Genet. 2001, 2, 292–301. [Google Scholar] [CrossRef]
- Saccone, S.; Federico, C.; Bernardi, G. Localization of the gene-richest and the gene-poorest isochores in the interphase nuclei of mammals and birds. Gene 2002, 300, 169–178. [Google Scholar] [CrossRef]
- Dixon, J.R.; Selvaraj, S.; Yue, F.; Kim, A.; Li, Y.; Shen, Y.; Hu, M.; Liu, J.S.; Ren, B. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 2012, 485, 376–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cremer, T.; Cremer, M. Chromosome territories. Cold Spring Harb. Perspect. Biol. 2010, 2, a003889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, S.S.; Huntley, M.H.; Durand, N.C.; Stamenova, E.K.; Bochkov, I.D.; Robinson, J.T.; Sanborn, A.L.; Machol, I.; Omer, A.D.; Lander, E.S.; et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 2014, 159, 1665–1680. [Google Scholar] [CrossRef] [Green Version]
- Federico, C.; Cantarella, C.D.; Di Mare, P.; Tosi, S.; Saccone, S. The radial arrangement of the human chromosome 7 in the lymphocyte cell nucleus is associated with chromosomal band gene density. Chromosoma 2008, 117, 399–410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daban, J.R. Supramolecular multilayer organization of chromosomes: Possible functional roles of planar chromatin in gene expression and DNA replication and repair. FEBS Lett. 2020, 594, 395–411. [Google Scholar] [CrossRef]
- Hu, J.; Zhang, Y.; Zhao, L.; Frock, R.L.; Du, Z.; Meyers, R.M.; Meng, F.L.; Schatz, D.G.; Alt, F.W. Chromosomal Loop Domains Direct the Recombination of Antigen Receptor Genes. Cell 2015, 163, 947–959. [Google Scholar] [CrossRef] [Green Version]
- Flavahan, W.A.; Drier, Y.; Liau, B.B.; Gillespie, S.M.; Venteicher, A.S.; Stemmer-Rachamimov, A.O.; Suvà, M.L.; Bernstein, B.E. Insulator dysfunction and oncogene activation in IDH mutant gliomas. Nature 2016, 529, 110–114. [Google Scholar] [CrossRef] [Green Version]
- Symmons, O.; Uslu, V.V.; Tsujimura, T.; Ruf, S.; Nassari, S.; Schwarzer, W.; Ettwiller, L.; Spitz, F. Functional and topological characteristics of mammalian regulatory domains. Genome Res. 2014, 24, 390–400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lupianez, D.G.; Kraft, K.; Heinrich, V.; Krawitz, P.; Brancati, F.; Klopocki, E.; Horn, D.; Kayserili, H.; Opitz, J.M.; Laxova, R.; et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 2015, 161, 1012–1025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Groschel, S.; Sanders, M.A.; Hoogenboezem, R.; de Wit, E.; Bouwman, B.A.M.; Erpelinck, C.; van der Velden, V.H.J.; Havermans, M.; Avellino, R.; van Lom, K.; et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell 2014, 157, 369–381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naumann, S.; Reutzel, D.; Speicher, M.; Decker, H.J. Complete karyotype characterization of the K562 cell line by combined application of G-banding, multiplex-fluorescence in situ hybridization, fluorescence in situ hybridization, and comparative genomic hybridization. Leuk. Res. 2001, 25, 313–322. [Google Scholar] [CrossRef]
- Mostafa Kamel, Y.; Naiel, A.; Alshehri, A.; Vetter, M.; Saccone, S.; Anderson, R.; Tosi, S. Fluorescence in situ hybridization assays designed for del(7q) detection uncover more complex rearrangements in myeloid leukaemia cell lines. Trends Cancer Res. 2014, 10, 17–26. [Google Scholar]
- Wildenhain, S.; Ingenhag, D.; Ruckert, C.; Degistirici, Ö.; Dugas, M.; Meisel, R.; Hauer, J.; Borkhardt, A. Homeobox protein HB9 binds to the prostaglandin E receptor promoter and inhibits intracellular cAMP mobilization in leukemic cells. J. Biol. Chem. 2012, 287, 40703–40712. [Google Scholar] [CrossRef] [Green Version]
- Ballabio, E.; Cantarella, C.D.; Federico, C.; Di Mare, P.; Hall, G.; Harbott, J.; Hughes, J.; Saccone, S.; Tosi, S. Ectopic expression of the HLXB9 gene is associated with an altered nuclear position in t(7;12) leukaemias. Leukemia 2009, 23, 1179–1182. [Google Scholar] [CrossRef] [PubMed]
- Federico, C.; Owoka, T.; Ragusa, D.; Sturiale, V.; Caponnetto, D.; Leotta, C.G.; Bruno, F.; Foster, H.A.; Rigamonti, S.; Giudici, G.; et al. Deletions of Chromosome 7q Affect Nuclear Organization and HLXB9 Gene Expression in Hematological Disorders. Cancers 2019, 11, 585. [Google Scholar] [CrossRef] [Green Version]
- Jancuskova, T.; Plachy, R.; Stika, J.; Zemankova, L.; Hardekopf, D.W.; Liehr, T.; Kosyakova, N.; Cmejla, R.; Zejskova, L.; Kozak, T.; et al. A method to identify new molecular markers for assessing minimal residual disease in acute leukemia patients. Leuk. Res. 2013, 37, 1363–1373. [Google Scholar] [CrossRef]
- Costantini, M.; Clay, O.; Federico, C.; Saccone, S.; Auletta, F.; Bernardi, G. Human Chromosomal bands: Nested structure, high-definition map and molecular basis. Chromosoma 2007, 116, 29–40. [Google Scholar] [CrossRef] [PubMed]
- D’Antoni, S.; Mattina, T.; Di Mare, P.; Federico, C.; Motta, S.; Saccone, S. Altered replication timing of the HIRA/Tuple1 locus in the DiGeorge and velocardiofacial syndromes. Gene 2004, 333, 111–119. [Google Scholar] [CrossRef]
- Sanborn, A.L.; Rao, S.S.P.; Huang, S.-C.; Durand, N.C.; Huntley, M.H.; Andrew, I.; Jewett, A.I.; Bochkov, I.D.; Chinnappan, D.; Cutkosky, A.; et al. Chromatin extrusion explains key features of loop and domain formation in wild-type and engineered genomes. Proc. Natl. Acad. Sci. USA 2015, 112, E6456–E6465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darrow, E.M.; Huntley, M.H.; Dudchenko, O.; Stamenova, E.K.; Durand, N.C.; Suna, Z.; Huang, S.-C.; Sanborn, A.L.; Machol, I.; Shamim, M.; et al. Deletion of DXZ4 on the human inactive X chromosome alters higher-order genome architecture. Proc. Natl. Acad. Sci. USA 2016, 113, E4504–E4512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hale, A.J.; ter Steege, E.; den Hertog, J. Recent advances in understanding the role of protein-tyrosine phosphatases in development and disease. Dev. Biol. 2017, 428, 283–292. [Google Scholar] [CrossRef] [PubMed]
- Bonev, B.; Cohen, N.M.; Szabo, Q.; Fritsch, L.; Papadopoulos, G.L.; Lubling, Y.; Xu, X.; Lv, X.; Hugnot, J.-P.; Tanay, A.; et al. Multiscale 3D Genome Rewiring during Mouse Neural Development. Cell 2017, 171, 557–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Federico, C.; Leotta, C.G.; Bruno, F.; Longo, A.M.; Owoka, T.; Tosi, S.; Saccone, S. Nuclear Repositioning of the Non-Translocated HLXB9 Allele in the Leukaemia Cell Line GDM-1 Harbouring a t(6;7)(q23;q36). Cytogenet. Genome Res. 2017, 153, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Spielmann, M.; Mundlos, S. Structural variations, the regulatory landscape of the genome and their alteration in human disease. Bioessays 2013, 35, 533–543. [Google Scholar] [CrossRef]
- Maass, P.G.; Weise, A.; Rittscher, K.; Lichtenwald, J.; Barutcu, A.R.; Liehr, T.; Aydin, A.; Wefeld-Neuenfeld, Y.; Pölsler, L.; Tinschert, S.; et al. Reorganization of inter-chromosomal interactions in the 2q37-deletion syndrome. EMBO J. 2018, 37, e96257. [Google Scholar] [CrossRef]
- Williamson, J.; Kane, L.; Devenney, P.S.; Flyamer, I.M.; Anderson, E.; Kilanowski, F.; Hill, R.E.; Bickmore, W.A.; Lettice, L.A. Developmentally regulated Shh expression is robust to TAD perturbations. Development 2019, 146, dev179523. [Google Scholar] [CrossRef] [Green Version]
- Federico, C.; Pappalardo, A.M.; Ferrito, V.; Tosi, S.; Saccone, S. Genomic properties of chromosomal bands are linked to evolutionary rearrangements and new centromere formation in primates. Chromosome Res. 2017, 25, 261–276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Durand, N.C.; Robinson, J.T.; Shamim, M.S.; Machol, I.; Mesirov, J.P.; Lander, E.S.; Aiden, E.L. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell Syst. 2016, 3, 99–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Nucleotide sequence (5′-3′) | |
---|---|---|
LMBR1 | Forward | CATGGTTTGTGGAATCTTGC |
Reverse | GATTCCCTTTTTCAGGCCAG | |
NOM1 | Forward | GACCAGGATTCGGTTTATGC |
Reverse | GACCAAAGCTCTCTGCAGTT | |
MNX1 | Forward | GTTCAAGCTCAACAAGTACC |
Reverse | GGTTCTGGAACCAAATCTTC | |
UBE3C | Forward | AGGTGCGAGGCAACAAGTTT |
Reverse | GAGAGGGCCCCCAAATAAT | |
PTPRN2 | Forward | ATGGAGCACGGATTCATACC |
Reverse | GACGATGGACCTCTTGGTAA | |
TBP | Forward | GCCAAGAGTGAAGAACAG |
Reverse | GAAGTCCAAGAACTTAGCTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gulino, G.M.; Bruno, F.; Sturiale, V.; Brancato, D.; Ragusa, D.; Tosi, S.; Saccone, S.; Federico, C. From FISH to Hi-C: The Chromatin Architecture of the Chromosomal Region 7q36.3, Frequently Rearranged in Leukemic Cells, Is Evolutionary Conserved. Int. J. Mol. Sci. 2021, 22, 2338. https://doi.org/10.3390/ijms22052338
Gulino GM, Bruno F, Sturiale V, Brancato D, Ragusa D, Tosi S, Saccone S, Federico C. From FISH to Hi-C: The Chromatin Architecture of the Chromosomal Region 7q36.3, Frequently Rearranged in Leukemic Cells, Is Evolutionary Conserved. International Journal of Molecular Sciences. 2021; 22(5):2338. https://doi.org/10.3390/ijms22052338
Chicago/Turabian StyleGulino, Gesualda M., Francesca Bruno, Valentina Sturiale, Desiree Brancato, Denise Ragusa, Sabrina Tosi, Salvatore Saccone, and Concetta Federico. 2021. "From FISH to Hi-C: The Chromatin Architecture of the Chromosomal Region 7q36.3, Frequently Rearranged in Leukemic Cells, Is Evolutionary Conserved" International Journal of Molecular Sciences 22, no. 5: 2338. https://doi.org/10.3390/ijms22052338