Cia Zeaxanthin Biosynthesis, OsZEP and OsVDE Regulate Striped Leaves Occurring in Response to Deep Transplanting of Rice
Abstract
:1. Introduction
2. Results
2.1. Striped Leaves Phenotype of B03S Occurs in Response to Deep Transplanting
2.2. Metabolomics Analysis of the Leaf Colored Stripe Trait of B03S Targeted in the Carotenoid Pathway
2.3. Transcriptome Sequencing Analysis of the Leaf Color Stripe Trait of B03S
2.4. Verification of the Expression of Genes Involved in the Carotenoid Pathway in B03S Leaves
2.5. Analysis of ROS Accumulation in the B03S Leaves according to NBT Staining
3. Discussion
3.1. Dark Shading of the Leaf Sheath Induces Albinism in the Leaves of B03S
3.2. Typical Carotenoids That Enter the Xanthophyll Cycle Are Involved in the Formation or Regulation of Albinism in Leaves
3.3. Regulatory Zeaxanthin Accumulates via Increased OsZEP and OsVDE Expression in Leaves to Alleviate Photooxidative Stress
4. Materials and Methods
4.1. Plant Material and the Leaf Color Phenotype
4.2. Phenotypic Analysis by Experimental Treatments
4.3. Ultra-Performance Liquid Chromatography/Tandem Mass Spectrometry (UPLC–MS/MS) Analysis of Leaf Color Metabolites Composing Carotenoids
4.4. RNA Extraction, Sequencing and Expression Analysis in B03S Leaves
4.4.1. Quality Control
4.4.2. Reads Mapping to the Reference Genome
4.4.3. Quantification of Gene Expression Level
4.4.4. Differential Expression Analysis
4.4.5. GO and KEGG Enrichment Analysis of Differentially Expressed Genes
4.5. Real-Time Quantitative PCR (qPCR)-Based Validation of Gene Expression
4.6. Histochemical Staining of ROS in B03S Leaves
4.7. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Ahmad, N.; Zaidi, S.S.-E.-A.; Mansoor, S. Alternative Routes to Improving Photosynthesis in Field Crops. Trends Plant Sci. 2020, 25, 958–960. [Google Scholar] [CrossRef]
- Jing, Y.; Lin, R. Transcriptional regulatory network of the light signaling pathways. New Phytol. 2020, 227, 683–697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cackett, L.; Luginbuehl, L.H.; Schreier, T.B.; Lopez-Juez, E.; Hibberd, J.M. Chloroplast development in green plant tissues: The interplay between light, hormone, and transcriptional regulation. New Phytol. 2022, 233, 2000–2016. [Google Scholar] [CrossRef] [PubMed]
- Theeuwen, T.P.J.M.; Logie, L.L.; Harbinson, J.; Aarts, M.G.M. Genetics as a key to improving crop photosynthesis. J. Exp. Bot. 2022, 73, 3122–3137. [Google Scholar] [CrossRef] [PubMed]
- Kromdijk, J.; Glowacka, K.; Leonelli, L.; Gabilly, S.T.; Iwai, M.; Niyogi, K.K.; Long, S.P. Improving photosynthesis and crop productivity by accelerating recovery from photoprotection. Science 2016, 354, 857. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menzies, I.J.; Youard, L.W.; Lord, J.M.; Carpenter, K.L.; van Klink, J.W.; Perry, N.B.; Schaefer, H.M.; Gould, K.S. Leaf colour polymorphisms: A balance between plant defence and photosynthesis. J. Ecol. 2016, 104, 104–113. [Google Scholar] [CrossRef]
- Cao, H.; Luo, H.; Yuan, H.; Eissa, M.A.; Thannhauser, T.W.; Welsch, R.; Hao, Y.-J.; Cheng, L.; Li, L. A Neighboring Aromatic-Aromatic Amino Acid Combination Governs Activity Divergence between Tomato Phytoene Synthases. Plant Physiol. 2019, 180, 1988–2003. [Google Scholar] [CrossRef] [Green Version]
- Li, W.-x.; Yang, S.-b.; Lu, Z.; He, Z.-c.; Ye, Y.-l.; Zhao, B.-b.; Wang, L.; Jin, B. Cytological, physiological, and transcriptomic analyses of golden leaf coloration in Ginkgo biloba L. Hortic. Res. 2018, 5, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Tang, J.; Mustard, J.F. Beyond leaf color: Comparing camera-based phenological metrics with leaf biochemical, biophysical, and spectral properties throughout the growing season of a temperate deciduous forest. J. Geophys. Res. Biogeosci. 2014, 119, 181–191. [Google Scholar] [CrossRef] [Green Version]
- Shen, J.; Zou, Z.; Zhang, X.; Zhou, L.; Wang, Y.; Fang, W.; Zhu, X. Metabolic analyses reveal different mechanisms of leaf color change in two purple-leaf tea plant (Camellia sinensis L.) cultivars. Hortic. Res. 2018, 5, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, X.J.; Zhang, H.Q.; Yue, W.; Feng, H.; Liu, J.L.; Xiao, X.; Shu, Z.F.; Wei, L.; Wang, G.H.; Wang, G.L. Mapped Clone and Functional Analysis of Leaf-Color Gene Ygl7 in a Rice Hybrid (Oryza sativa L. ssp. indica). PLoS ONE 2014, 9, e99564. [Google Scholar] [CrossRef] [Green Version]
- Dhami, N.; Cazzonelli, C.I. Environmental impacts on carotenoid metabolism in leaves. Plant Growth Regul. 2020, 92, 455–477. [Google Scholar] [CrossRef]
- Wang, Y.-X.; Hu, Y.; Zhu, Y.-F.; Baloch, A.W.; Jia, X.-M.; Guo, A.-X. Transcriptional and physiological analyses of short-term Iron deficiency response in apple seedlings provide insight into the regulation involved in photosynthesis. BMC Genom. 2018, 19, 461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McQuinn, R.P.; Wong, B.; Giovannoni, J.J. AtPDS overexpression in tomato: Exposing unique patterns of carotenoid self-regulation and an alternative strategy for the enhancement of fruit carotenoid content. Plant Biotechnol. J. 2018, 16, 482–494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jahns, P.; Holzwarth, A.R. The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim. Biophys. Acta (BBA) Bioenerg. 2012, 1817, 182–193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guidi, L.; Lo Piccolo, E.; Landi, M. Chlorophyll Fluorescence, Photoinhibition and Abiotic Stress: Does it Make Any Difference the Fact to Be a C3 or C4 Species? Front. Plant Sci. 2019, 10, 104. [Google Scholar] [CrossRef]
- Leonelli, L.; Brooks, M.D.; Niyogi, K.K. Engineering the lutein epoxide cycle into Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2017, 114, E7002–E7008. [Google Scholar] [CrossRef] [Green Version]
- Zeng, L.; Yang, X.; Zhou, J. The xanthophyll cycle as an early pathogenic target to deregulate guard cells during Sclerotinia sclerotiorum infection. Plant Signal. Behav. 2020, 15, 1691704. [Google Scholar] [CrossRef]
- Demmig-Adams, B.; Cohu, C.M.; Muller, O.; Adams, W.W. Modulation of photosynthetic energy conversion efficiency in nature: From seconds to seasons. Photosynth. Res. 2012, 113, 75–88. [Google Scholar] [CrossRef]
- Sacharz, J.; Giovagnetti, V.; Ungerer, P.; Mastroianni, G.; Ruban, A.V. The xanthophyll cycle affects reversible interactions between PsbS and light-harvesting complex II to control non-photochemical quenching. Nat. Plants 2017, 3, 16225. [Google Scholar] [CrossRef] [PubMed]
- Dautermann, O.; Lohr, M. A functional zeaxanthin epoxidase from red algae shedding light on the evolution of light-harvesting carotenoids and the xanthophyll cycle in photosynthetic eukaryotes. Plant J. 2017, 92, 879–891. [Google Scholar] [CrossRef] [PubMed]
- Acebron, K.; Matsubara, S.; Jedmowski, C.; Emin, D.; Muller, O.; Rascher, U. Diurnal dynamics of nonphotochemical quenching in Arabidopsis npq mutants assessed by solar-induced fluorescence and reflectance measurements in the field. New Phytol. 2021, 229, 2104–2119. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Chen, T.; Feng, B.; Zhang, C.; Peng, S.; Zhang, X.; Fu, G.; Tao, L. Non-photochemical Quenching Plays a Key Role in Light Acclimation of Rice Plants Differing in Leaf Color. Front. Plant Sci. 2017, 7, 1968. [Google Scholar] [CrossRef] [Green Version]
- Dong, H.; Fei, G.-L.; Wu, C.-Y.; Wu, F.-Q.; Sun, Y.-Y.; Chen, M.-J.; Ren, Y.-L.; Zhou, K.-N.; Cheng, Z.-J.; Wang, J.-L.; et al. A Rice Virescent-Yellow Leaf Mutant Reveals New Insights into the Role and Assembly of Plastid Caseinolytic Protease in Higher Plants. Plant Physiol. 2013, 162, 1867–1880. [Google Scholar] [CrossRef] [Green Version]
- Gang, H.; Liu, G.; Chen, S.; Jiang, J. Physiological and Transcriptome Analysis of a Yellow-Green Leaf Mutant in Birch (Betula platyphylla × B. Pendula). Forests 2019, 10, 120. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Cheng, Z.; Ma, X.; Wu, H.; Liu, Y.; Zhou, K.; Chen, Y.; Ma, W.; Bi, J.; Zhang, X.; et al. A knockdown mutation of YELLOW-GREEN LEAF2 blocks chlorophyll biosynthesis in rice. Plant Cell Rep. 2013, 32, 1855–1867. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Zhang, D. Developing near isogenic lines of different critical male sterile temperature of thermo-photoperiod sensitive male sterile rice Peiai 64S. Zuo Wu Xue Bao 2001, 27, 351–355. [Google Scholar]
- Parrine, D.; Greco, T.M.; Muhammad, B.; Wu, B.-S.; Zhao, X.; Lefsrud, M. Color-Specific Recovery to Extreme High-Light Stress in Plants. Life 2021, 11, 812. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, J.; Hu, Z.; Xia, Y.; Huang, Q.; Yu, T.; Yi, H.; Lu, Y.; Wang, J.; Cao, M. A valine residue deletion in ZmSig2A, a sigma factor, accounts for a revertible leaf-color mutation in maize. Crop J. 2021, 9, 1330–1343. [Google Scholar] [CrossRef]
- Cheng, M.; Meng, F.; Mo, F.; Chen, X.; Zhang, H.; Wang, A. Insights into the molecular basis of a yellow leaf color mutant (ym) in tomato (Solanum lycopersicum). Sci. Hortic. 2022, 293, 110743. [Google Scholar] [CrossRef]
- Shu, Q.; Liu, G.; Xia, Y. Temperature-sensitve leaf color mutation in rice (Oryza sativa L.). Acta Agric. Nucleatae Sin. 1996, 10, 6–10. [Google Scholar]
- Schneider, T.; Bolger, A.; Zeier, J.; Preiskowski, S.; Benes, V.; Trenkamp, S.; Usadel, B.; Farré, E.M.; Matsubara, S. Fluctuating Light Interacts with Time of Day and Leaf Development Stage to Reprogram Gene Expression. Plant Physiol. 2019, 179, 1632–1657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, D.-E.; Shang, X.; Assefa, A.D.; Keum, Y.-S.; Saini, R.K. Metabolite profiling of green, green/red, and red lettuce cultivars: Variation in health beneficial compounds and antioxidant potential. Food Res. Int. 2018, 105, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.-E.; Ho, M.-H.; Chang, H.; Chao, H.-Y.; Ger, M.-J. Overexpression of plant ferredoxin-like protein promotes salinity tolerance in rice (Oryza sativa). Plant Physiol. Biochem. 2020, 155, 136–146. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.J.; Park, S.-Y.; Valan Arasu, M.; Al-Dhabi, N.A.; Ahn, H.-G.; Kim, J.K.; Park, S.U. Accumulation of Carotenoids and Metabolic Profiling in Different Cultivars of Tagetes Flowers. Molecules 2017, 22, 313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, P.; Lv, S.; Zhang, D.; Su, T.; Xin, X.; Wang, W.; Zhao, X.; Yu, Y.; Zhang, Y.; Yu, S.; et al. The Carotenoid Esterification Gene BrPYP Controls Pale-Yellow Petal Color in Flowering Chinese Cabbage (Brassica rapa L. subsp. parachinensis). Front. Plant Sci. 2022, 13, 844140. [Google Scholar] [CrossRef]
- Bernstein, P.S.; Li, B.; Vachali, P.P.; Gorusupudi, A.; Shyam, R.; Henriksen, B.S.; Nolan, J.M. Lutein, zeaxanthin, and meso-zeaxanthin: The basic and clinical science underlying carotenoid-based nutritional interventions against ocular disease. Prog. Retin. Eye Res. 2016, 50, 34–66. [Google Scholar] [CrossRef] [Green Version]
- Brookbank, B.P.; Patel, J.; Gazzarrini, S.; Nambara, E. Role of Basal ABA in Plant Growth and Development. Genes 2021, 12, 1936. [Google Scholar] [CrossRef]
- Daszkowska-Golec, A.; Szarejko, I. Open or Close the Gate–Stomata Action Under the Control of Phytohormones in Drought Stress Conditions. Front. Plant Sci. 2013, 4, 138. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Dong, B.; Zhang, C.; Yang, L.; Wang, Y.; Zhao, H. Effects of Exogenous Abscisic Acid (ABA) on Carotenoids and Petal Color in Osmanthus fragrans ‘Yanhonggui’. Plants 2020, 9, 454. [Google Scholar] [CrossRef] [Green Version]
- Sakuraba, Y.; Kim, D.; Han, S.-H.; Kim, S.-H.; Piao, W.; Yanagisawa, S.; An, G.; Paek, N.-C. Multilayered Regulation of Membrane-Bound ONAC054 Is Essential for Abscisic Acid-Induced Leaf Senescence in Rice. Plant Cell 2020, 32, 630–649. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Wang, H.; Zhang, Z.; Zhao, X.; Wang, Y.; Zhang, L. An RNA-seq Analysis Reveals Differential Transcriptional Responses to Different Light Qualities in Leaf Color of Camellia sinensis cv. Huangjinya. J. Plant Growth Regul. 2022, 41, 612–627. [Google Scholar] [CrossRef]
- Maritim, T.K.; Masand, M.; Seth, R.; Sharma, R.K. Transcriptional analysis reveals key insights into seasonal induced anthocyanin degradation and leaf color transition in purple tea (Camellia sinensis (L.) O. Kuntze). Sci. Rep. 2021, 11, 1244. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Ahn, Y.O.; Ahn, M.-J.; Jeong, J.C.; Lee, H.-S.; Kwak, S.-S. Cloning and characterization of an Orange gene that increases carotenoid accumulation and salt stress tolerance in transgenic sweetpotato cultures. Plant Physiol. Biochem. 2013, 70, 445–454. [Google Scholar] [CrossRef]
- Hoang, M.H.; Kim, H.-S.; Zulfugarov, I.S.; Lee, C.-H. Down-Regulation of Zeaxanthin Epoxidation in Vascular Plant Leaves Under Normal and Photooxidative Stress Conditions. J. Plant Biol. 2020, 63, 331–336. [Google Scholar] [CrossRef]
- Fernández-Marín, B.; Neuner, G.; Kuprian, E.; Laza, J.M.; García-Plazaola, J.I.; Verhoeven, A. First evidence of freezing tolerance in a resurrection plant: Insights into molecular mobility and zeaxanthin synthesis in the dark. Physiol. Plantarum. 2018, 163, 472–489. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Steen Collin, J.; Lyska, D.; Fischer Alexandra, L.; Endelman, B.; Iwai, M.; Niyogi Krishna, K.; Fleming Graham, R. Chlorophyll–carotenoid excitation energy transfer and charge transfer in Nannochloropsis oceanica for the regulation of photosynthesis. Proc. Natl. Acad. Sci. USA 2019, 116, 3385–3390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Ren, P.; Ji, L.; Zhu, B.; Xie, G. OsVDE, a xanthophyll cycle key enzyme, mediates abscisic acid biosynthesis and negatively regulates salinity tolerance in rice. Planta 2021, 255, 6. [Google Scholar] [CrossRef]
- Chen, Z.; Gao, Z.; Sun, Y.; Wang, Y.; Yao, Y.; Zhai, H.; Du, Y. Analyzing the grape leaf proteome and photosynthetic process provides insights into the injury mechanisms of ozone stress. Plant Growth Regul. 2020, 91, 143–155. [Google Scholar] [CrossRef]
- Tang, C.; Xie, J.; Lv, J.; Li, J.; Zhang, J.; Wang, C.; Liang, G. Alleviating damage of photosystem and oxidative stress from chilling stress with exogenous zeaxanthin in pepper (Capsicum annuum L.) seedlings. Plant Physiol. Biochem. 2021, 162, 395–409. [Google Scholar] [CrossRef]
- Liu, X.; Hou, X. Antagonistic Regulation of ABA and GA in Metabolism and Signaling Pathways. Front. Plant Sci. 2018, 9, 251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Ye, S.; Yuan, G.; Ma, X.; Heng, S.; Yi, B.; Ma, C.; Shen, J.; Tu, J.; Fu, T.; et al. Gene silencing of BnaA09.ZEP and BnaC09.ZEP confers orange color in Brassica napus flowers. Plant J. 2020, 104, 932–949. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, Y.; Chang, L.; Zhang, T.; An, J.; Liu, Y.; Cao, Y.; Zhao, X.; Sha, X.; Hu, T.; et al. MsZEP, a novel zeaxanthin epoxidase gene from alfalfa (Medicago sativa), confers drought and salt tolerance in transgenic tobacco. Plant Cell Rep. 2016, 35, 439–453. [Google Scholar] [CrossRef]
- Iuchi, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T.; Tabata, S.; Kakubari, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 2001, 27, 325–333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bethmann, S.; Melzer, M.; Schwarz, N.; Jahns, P. The zeaxanthin epoxidase is degraded along with the D1 protein during photoinhibition of photosystem II. Plant Direct. 2019, 3, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eilers, U.; Dietzel, L.; Breitenbach, J.; Büchel, C.; Sandmann, G. Identification of genes coding for functional zeaxanthin epoxidases in the diatom Phaeodactylum tricornutum. J. Plant Physiol. 2016, 192, 64–70. [Google Scholar] [CrossRef]
- Baek, K.; Kim, D.H.; Jeong, J.; Sim, S.J.; Melis, A.; Kim, J.-S.; Jin, E.; Bae, S. DNA-free two-gene knockout in Chlamydomonas reinhardtii via CRISPR-Cas9 ribonucleoproteins. Sci. Rep. 2016, 6, 30620. [Google Scholar] [CrossRef] [PubMed]
- Galpaz, N.; Wang, Q.; Menda, N.; Zamir, D.; Hirschberg, J. Abscisic acid deficiency in the tomato mutant high-pigment 3 leading to increased plastid number and higher fruit lycopene content. Plant J. 2008, 53, 717–730. [Google Scholar] [CrossRef]
- Dong, X.; Huang, L.; Chen, Q.; Lv, Y.; Sun, H.; Liang, Z. Physiological and Anatomical Differences and Differentially Expressed Genes Reveal Yellow Leaf Coloration in Shumard Oak. Plants 2020, 9, 169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Huang, Y.; Xiao, Q.; Huang, X.; Li, C.; Gao, X.; Wang, Q.; Xiang, X.; Zhu, Y.; Wang, J.; et al. Carotenoids modulate kernel texture in maize by influencing amyloplast envelope integrity. Nat. Commun. 2020, 11, 5346. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wong, L.L.; Bruxvoort, C.G.; Cejda, N.I.; Delaney, M.R.; Otero, J.R.; Forsthoefel, D.J. Intestine-enriched apolipoprotein b orthologs are required for stem cell progeny differentiation and regeneration in planarians. Nat. Communs. 2022, 13, 3803. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Fu, M.; Wang, L.; Bai, Y.; Fang, X.; Wang, Q.; He, Y.; Zeng, H. OsSPLs Regulate Male Fertility in Response to Different Temperatures by Flavonoid Biosynthesis and Tapetum PCD in PTGMS Rice. Int. J. Mol. Sci. 2022, 23, 3744. [Google Scholar] [CrossRef] [PubMed]
- Kumar, D.; Yusuf, M.A.; Singh, P.; Sardar, M.; Sarin, N.B. Modulation of antioxidant machinery in α-tocopherol-enriched transgenic Brassica juncea plants tolerant to abiotic stress conditions. Protoplasma 2013, 250, 1079–1089. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.-N.; Lu, L.-X.; Ye, J.-R.; Shi, H.-M. The Endophytic Strain ZS-3 Enhances Salt Tolerance in Arabidopsis thaliana by Regulating Photosynthesis, Osmotic Stress, and Ion Homeostasis and Inducing Systemic Tolerance. Front. Plant Sci. 2022, 13, 820–837. [Google Scholar] [CrossRef]
- He, Y.; Liu, C.; Zhu, L.; Fu, M.; Sun, Y.; Zeng, H. Jasmonic Acid Plays a Pivotal Role in Pollen Development and Fertility Regulation in Different Types of P(T)GMS Rice Lines. Int. J. Mol. Sci. 2021, 22, 7926. [Google Scholar] [PubMed]
Groups | Root Damage | Shading Treatment | Shading Region | Leaf-Colored Characteristic |
---|---|---|---|---|
Shallow Transplanting | Yes | Yes | 2 cm | No |
Deep Transplanting | Yes | Yes | 4 cm | Yes |
Soil Covering | No | Yes | 4 cm | Yes |
Aluminum foil Covering | No | Yes | 4 cm | Yes |
Nontransplanting | No | No | 0 cm | No |
Metabolite | Fully Green Leaf | Alternate Yellow Leaf | Alternate Green Leaf | ||
---|---|---|---|---|---|
Z (μg/g) | 9.43 ± 7.56 | 43.44 ± 8.31 | ** | 25.17 ± 3.19 | |
A (μg/g) | 27.65 ± 11.99 | 48.88 ± 1.98 | * | 52.46 ± 4.36 | * |
V (μg/g) | 80.47 ± 11.98 | 63.59 ± 1.07 | 111.20 ± 3.36 | ** | |
Ratio (%) | 31.54 ± 6.27 | 59.21 ± 1.95 | *** | 41.11 ± 1.22 |
Gene Name | Gene ID | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|---|
OsZEP | LOC_Os04g37619 | TCTAGGAGGAAACAGCACGA | CCAATGCATCGTCATCCTC |
OsVDE | LOC_Os04g31040 | CTCTAAGCAGCATCA | GCCAGCTCTATTCTGCACT |
OsNCED2 | LOC_Os12g24800 | TTGGTGTAAGTGGTC | ACCCTAGACCAAAGTCACGA |
OsAAO | LOC_Os03g57680 | TTGTTGATTCCTCGC | ATACACTGCCTCCCCAGAA |
OsSDR | LOC_Os03g59610 | CACAAACTACTTGG | ACGGTTCTACGCACATCTT |
OsP450 | LOC_Os01g43710 | CTGAAAGAGCACGGGAAACT | CATACGTTACAACTCCGCC |
OsASR | LOC_Os12g29400 | TCGGATGGAACGATGAGC | CAATAGCGACCTGGACAAACT |
OsGAD | LOC_Os03g51080 | GCTGAAACAGGCTGGGACA | GTTGAGGGTGAAGGTGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hao, Q.; Zhang, G.; Zuo, X.; He, Y.; Zeng, H. Cia Zeaxanthin Biosynthesis, OsZEP and OsVDE Regulate Striped Leaves Occurring in Response to Deep Transplanting of Rice. Int. J. Mol. Sci. 2022, 23, 8340. https://doi.org/10.3390/ijms23158340
Hao Q, Zhang G, Zuo X, He Y, Zeng H. Cia Zeaxanthin Biosynthesis, OsZEP and OsVDE Regulate Striped Leaves Occurring in Response to Deep Transplanting of Rice. International Journal of Molecular Sciences. 2022; 23(15):8340. https://doi.org/10.3390/ijms23158340
Chicago/Turabian StyleHao, Qianyi, Guangwang Zhang, Xilong Zuo, Ying He, and Hanlai Zeng. 2022. "Cia Zeaxanthin Biosynthesis, OsZEP and OsVDE Regulate Striped Leaves Occurring in Response to Deep Transplanting of Rice" International Journal of Molecular Sciences 23, no. 15: 8340. https://doi.org/10.3390/ijms23158340