1. Introduction
Tumors are composed of cancer cells that, together with other cell types, form a rich microenvironment that greatly contributes to tumor progression. Although tumors are able to evade surveillance by the immune system in many ways, the immune system has an essential function in limiting cancer [
1]. Immune tolerance is fundamental to the development and spread of cancer and can lead to resistance to immunotherapies. For this reason, the discovery of therapeutic approaches to circumvent these immune resistance pathways in various malignancies is of great interest [
2].
In recent years, promising results have been achieved in cancer immunotherapy using immune checkpoint blockade. Programmed cell death protein 1 (PD-1) and its ligand, the transmembrane protein PD-L1, are responsible for the interaction between T lymphocytes and cancer cells, leading to immune evasion and cancer tolerance. Blocking the PD-1/PD-L1 axis would reactivate the immune response and impede tumor progression.
PD-L1 is a small integral glycoprotein (33 kDa) that is present on cancer cells and has several aliases, such as CD274 and B7 homolog 1 (B7-H1). Normally expressed on macrophages, dendritic cells and some activated T cells, in the case of cancer it is expressed on the surface of tumor cells to evade the immune response [
3,
4]. Since PD-L1 is considered a pro-tumorigenic factor, therapeutic antibodies against PD-L1/PD-1 are attracting great attention because they impair tumor progression. Anti-PD-1 antibodies and anti-PD-L1 antibodies are examples of PD-1/PD-L1 checkpoint blockade immunotherapy strategies that have achieved a clinically meaningful anti-tumor effect [
5,
6]. Clinical trials in patients with solid tumors, such as non-small cell lung cancer and melanoma, showed a promising response to anti-PD-1/PD-L1 therapy [
6]. Increased PD-L1 expression has been associated with metastasis, tumor progression and shorter survival rates [
7,
8].
However, immunotherapy with monoclonal antibodies is very expensive, especially as the production of antibodies is both difficult and time-consuming [
9]. In addition, resistance to PD-1/PD-L1 immunotherapy and relatively low response rates in cancer are currently more common. It has been found that the efficacy of PD-1/PD-L1 blockade therapy is only ≤40% in several cancer types [
7]. The reason for this limitation in antibody treatment is that PD-L1 has additional intrinsic regulatory (non-immunological checkpoint) functions that may play a critical role in promoting tumorigenesis and progression [
8]. Genetic intervention using the CRISPR/Cas system therefore represents an alternative to the elimination of PD-1 and PD-L1. This system has been used both in vitro and in vivo, with PD-L1 being knocked out in mice [
10]. In glioblastoma cells, CRISPR/Cas-mediated silencing of PD-L1 using two sgRNA sequences and a homology-directed repair (HDR) template inhibited proliferation and invasion [
11]. Despite the promising results of anti-PD-L1 therapy, a considerable subgroup of patients does not respond to the therapy and develops resistance. Several studies have shown an increase in PD-L1 expression upon activation of the PI3K/AKT and RAS/MAPK signaling pathways, suggesting regulation of PD-L1 expression by extracellular signals such as hypoxia and cytokines that activate these pathways. In a study of triple negative breast cancer cells, blockade of the PD-1/PD-L1 axis led to inhibition of Akt and ERK phosphorylation and upregulation of p21 [
12].
One frequent driver mutation in several cancers is known as the Kirsten rat sarcoma viral oncogene homolog (KRAS) [
9]. The RAS gene family includes KRAS, a gene encoding a tiny membrane-bound GTPase that exists in one of two states: the active GTP-bound state, which significantly stimulates downstream signaling cascades that control essential cellular activities, or the inactive GDP-bound state. KRAS mutations cause constitutively active GTP-bound proteins that activate carcinogenic signaling pathways [
13]. Direct suppression of KRAS by pharmacological agents has proven to be difficult. Nowadays, standard chemotherapy is used to treat KRAS-mutated tumors, although the success rate is often quite low [
13,
14]. A previous study has shown that in lung adenocarcinomas, p-ERK signaling can trigger PD-L1 expression in the presence of a KRAS mutation. In human KRAS-mutated tumors, blocking the PD-1/PD-L1 mechanism could represent an important therapeutic approach [
15].
In this study, CRISPR/Cas9-mediated knockdown of PD-L1 and KRAS was investigated as a therapeutic approach for the treatment of lung cancer. The CRISPR/Cas9 system was used to disrupt PD-L1 and KRAS expression, and the effects of PD-L1 and/or KRAS knockdown on cell migration, apoptotic activity and drug resistance to the chemotherapies paclitaxel and L-asparaginase were investigated.
3. Discussion
Immune checkpoint blockade remains a promising therapy despite the unpredictable possibility of resistance in almost half of lung cancer patients [
19]. Several anti-PD-1/PD-L1 antibodies such as pembrolizumab, atezolizumab and nivolumab have been approved by the FDA for the treatment of non-small cell lung cancer and other cancers such as melanoma, kidney and breast cancer. However, their cost is a limitation, and their therapeutic efficacy has been associated with inflammatory side effects, making specific gene-editing tools such as CRISPR/Cas systems more attractive [
20].
In this study, CRISPR/Cas-mediated knockdown of PD-L1 in A549 cells made them more susceptible to recognition by T lymphocytes and subsequent death (
Figure 1). Lymphocytes cultured with A549 cells with low PD-L1 expression secreted a different set of cytokines that tended to reduce cancer cell cytotoxicity even in the absence of T lymphocytes. As the transfection efficiency was 60–80%, the cytotoxic effect of lymphocytes was ameliorated.
Although immune checkpoint blockade is an attractive therapeutic approach, several mechanisms have been hypothesized as causes for the unsatisfactory response, including the genetic variation landscape in key genes such as STK11/LKB1 and TP53, particularly in KRAS-mutated lung cancer, which accounts for 20–25% of lung cancers [
19]. In addition, the non-immune effects of PD-1 and PD-L1 promote resistance to chemotherapy and drive the cells to metastasize. In kidney cancer, researchers suspect that PD-L1 promotes tumor progression by inducing the stem cell phenotype of cancer cells and thus the epithelial mesenchymal transition (EMT) [
4].
In A549 cells, PD-L1 KD alone also had the strongest inhibitory effect on cell migration (
Figure 5). Surprisingly, the effect of KRAS KD was minimal and attenuated the effect of PD-L1 on dual knockdown. It would be of great interest to transfect cells not only transiently but stably to investigate the long-term effects of KD in lung cancer patients with KRAS mutations. KRAS is known to be a strong driver of primary tumor growth, and the mutations are tumor-specific. In both lung cancer and colorectal cancer, the KRAS mutation pattern is quite heterogeneous between the primary tumor and the corresponding metastases. This heterogeneity requires a more detailed analysis and screening of patient tumors [
21].
Interestingly, in our study, KRAS KD mainly affected apoptosis and the cell cycle, while PD-L1-KD had the strongest inhibitory effect on migration. Since cancer is a multifactorial disease with a plethora of altered signaling, several treatment modalities attempt combination therapy. In renal carcinoma, the oral tyrosine kinase inhibitor (TKI) anlotinib, which targets multiple signaling pathways, namely vascular endothelial growth factor receptor (VEGFR) and fibroblast growth factor receptor (FGFR), has been used in conjunction with anti-PD-L1 antibodies [
22]. Another oral TKI, axitinib, was combined with anti-PD-L1 in hepatocellular carcinoma and achieved encouraging results. Sorafinib was also approved by the FDA together with immune checkpoint inhibitors [
23].
Taken together, targeted inhibition of PD-L1 and KRAS seems very plausible, firstly because immune checkpoint blockade is often more successful in cancers with high tumor burden such as KRAS-mutated tumors. Secondly, these tumors often show immune evasion, as KRAS signaling upregulates immunosuppressive factors such as IL-10 and TGF-ß and activates CD47 [
21,
24]. Consistent with this logic, our results also showed that silencing KRAS significantly decreased proliferation, increased apoptosis and sensitized cells to chemotherapy. Dual targeting of KRAS and PD-L1 could be beneficial in treating tumors with either wildtype or mutant KRAS. Our results in A549 and H460 were consistent and even H1975 was more responsive to chemotherapy upon dual silencing of PD-L1 and KRAS. Targeting oncogenic RAS signaling and PD-L1 expression in adenocarcinomas could overcome immunoresistance [
25]. Interfering with both signaling pathways has potential for the treatment of lung cancer heterogeneity.
4. Materials and Methods
4.1. Cell Culture
The A549 and H1975 cell lines were obtained from the cell culture facility at Center of Excellence for Research in Regenerative Medicine and Applications (CERRMA), Faculty of Medicine, Alexandria University and all cell culture experiments were conducted there. This study was conducted according to the research codes of ethics followed at the Faculty of Medicine, Alexandria University. Lung cancer cell lines H1650, H1299, A427 and H460 were obtained from ATCC and experiments were performed at the cell culture facility at Lung Microenvironmental Niche in Cancerogenesis, Institute for Lung Health (ILH), Justus Liebig University, Giessen, Germany.
All cells were cultured in DMEM (4.5 g/L glucose) media supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution and kept in a humidified incubator with 5% carbon dioxide (CO
2) at 37 °C. Cells were passaged every 2–3 days until they reached about 80–90% confluency. Cells were counted using hemocytometer in presence of 0.4% Trypan blue dye to detect dead cells. Unless otherwise specified, cells were seeded in 96-well plates at a density of 7000 cells/well and in 6-well plates at a density of 3 × 10
5 cells/well [
26].
4.2. Bacterial Transformation Plasmid Purification
4.2.1. Preparation of E. coli Competent Cells
E. coli BL21(DE3)pLysS bacterial glycerol stock was activated overnight in LB broth at 37 °C with shaking (150 rpm). The culture was streaked on an LB plate and incubated overnight to isolate single colonies. A single colony was grown in 1 mL LB broth and used to inoculate 100 mL LB broth at an inoculum size of 1%. The culture was grown with shaking at 37 °C until the optical density at 600 nm reached an absorbance of 0.2–0.4, usually after 2–3 h. The growth was stopped by placing the culture on ice for 30 min. Cells were collected by centrifugation at 2000×
g, at 4 °C for 20 min. The supernatant was decanted, the cells were suspended in 10 mL pre-cooled 0.1 M CaCl
2 and kept on ice for 30 min. Cells were centrifuged again using the same conditions and the cell pellet was resuspended in 1–2 mL pre-cooled 0.1 M CaCl
2. The competent cells were kept at 4 °C until use and for maximum 48 h [
27].
4.2.2. Transformation in E. coli Competent Cell
Three mammalian expression plasmids were amplified in E. coli to be used for the assessment of the gene modulation impact on the cultured cells; two pLentiCRISPR v2 vectors were used to deliver the CRISPR/Cas-9 system together with an empty pLentiCRISPR v2 as empty vector (EV).
The plasmid of interest (1 µL) was added to 50 µL competent cells, and cells were kept on ice for 30–40 min then heated at 42 °C for 40 s in a water bath. After heat shock, cells were kept on ice for 5 min and then 950 µL LB broth was added to the cells and incubated at 37 °C for 2–4 h with shaking. Cells (100–200 µL) were spread on an LB plate with ampicillin (100 µg/mL) and incubated overnight at 37 °C.
4.2.3. Plasmid Preparation
After incubation, single colonies were selected to grow separately in LB broth overnight. The culture from several colonies was centrifuged to collect cell pellets. Cell pellets were resuspended in cell resuspension buffer, then 350 µL cell lysis buffer (0.2 N NaOH, % SDS) was added. After complete cell lysis, 350 µL neutralization buffer (1.32 M potassium acetate pH 4.8) was added, mixed well by vortexing, then put on ice for 10 min. To remove cell debris, the mixture was centrifuged at 7000× g for 10 min and the supernatant was transferred to another Eppendorf tube. Equal volume of isopropanol was added to the supernatant to precipitate plasmid DNA. After centrifugation at 7000× g for 10 min, the supernatant was discarded, and the DNA pellet was washed twice with 500 µL ethanol and left to air-dry. The plasmid was resuspended in 30–50 µL nuclease-free water, and its concentration was measured by Nanodrop (DeNovix, Wilmington, DE, USA).
4.3. Silencing of PD-L1 and KRAS
4.3.1. CRISPR-Cas9 System
The CRISPR-Cas9 system was applied to silence PD-L1 and KRAS genes. We transfected the pLentiCRISPR v2 vector (GenScript, Cat#S58112), which encodes the sgRNA, into cells. The sgRNA sequences for PD-L1 and KRAS were TACCGCTGCATGATCAGCTA and TCTCGACACAGCAGGTCAAG, respectively. qPCR was used to validate gene knockdown.
4.3.2. Plasmid Transfection
Cells were seeded in 96- and 6-well plates at density of 7 × 103 cells/well and 3 × 105 cells/well, respectively, and cultured overnight. When they reached 70–80% confluency, the media was subsequently removed. Cells were transfected with empty vector pLentiCRISPR v2 vector or pLentiCRISPR v2 vector with PD-L1 knockdown (PD-L1 KD), or pLentiCRISPR v2 vector for KRAS knockdown (KRAS KD), respectively, using Lipofectamine® 2000 Transfection Reagent (Thermo Fisher Scientific, Dreieich, Germany) according to the manufacturer’s protocol. Briefly, DNA and Lipofectamine were prepared at a ratio of 1:3 (amount of plasmid DNA in µg:volume of transfection reagent in µL) in serum-free medium and added to the cells. After 24 h, the medium was replaced, and the transfection efficiency was assessed under the microscope according to the GFP expression. It was in the range 70–90% according to the cell line.
4.4. Analysis of Gene Expression by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
For RNA collection, cells were seeded in a 6-well plate and total RNA was isolated from cells using Trizol reagent (Qiagen, Hilden, Germany) following the manufacturer’s protocol. The purity and the concentration of RNA samples were determined using Nanodrop (DeNovix, Wilmington, DE, USA) and integrity of RNA was checked by agarose gel electrophoresis. An amount of 2 µg RNA was transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Darmstadt, Germany) according to the manufacturer’s instructions using random primers. The synthesized cDNA was diluted 1:1 with nuclease-free water before proceeding with qPCR and stored at −20 °C until use.
A real-time qPCR reaction mixture was prepared using Maxima SYBR Green (Thermo Fisher Scientific, Dreieich, Germany) according to the manufacturer’s recommendations using following primers: PD-L1 (CD274) FW: GGACAAGCAGTGACCATCAAG, PD-L1 (CD274) RV: CCCAGAATTACCAAGTGAGTCCT; KRAS FW: CAGTAGACACAAAACAGGCTCAG, KRAS RV: TGTCGGATCTCCCTCACCAATG; NFKB1 FW: GCCACCCGGCTTCAGAATGG, NFKB1 RV: GGCCATCTGCTGTTGGCAGT; KI6 FW: GAGGTGTGCAGAAAATCCAAA, KI67 RV: CTGTCCCTATGACTTCTGGTTGT; CASP3 FW: TTTTTCAGAGGGGATCGTTG, CASP3 RV: CGGCCTCCACTGGTATTTTA; CASP8 FW: CCTGGGTGCGTCCACTTT, CASP8 RV: CAAGGTTCAAGTGACCAACTCAAG; BAX FW: TTCATCCAGGATCGAGCAG, BAX RV: TGAGACACTCGCTCAGCTTC; BCL2 FW: CACCTGTGGTCCACCTGAC, BCL2 RV: ACGCTCTCCACACACATGAC; and HPRT FW: TGACACTGGCAAAACAAT, HPRT RV: GGTCCTTTTCACCAGCAA, which was used as housekeeping gene. The assay was run at 57 °C on an Applied Biosystems StepOneTM Instrument. The expression of genes of interest was normalized to the expression level of reference gene HPRT and fold change of the target gene was calculated relative to the empty vector control sample.
4.5. Cytotoxicity Assay by MTT
Cells were seeded in 96-well plates at density of 7 × 10
3 cells/well and cultured overnight to attach. When they reached 70–80% confluency, the media was removed and replaced with media containing paclitaxel or L-ASNase Pfu at different concentrations. After incubation for 24 h at 37 °C, 10 µL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, 5 mg/mL) was added to each well and cells were incubated for 4 h. The MTT solution was then removed, and the formed formazan crystals were solubilized in 100 μL of DMSO. After shaking the plates for 20 min at room temperature, the optical density (OD) was measured at 570 nm utilizing a microplate reader (Tecan, San Jose, CA, USA). The percentage cell viability was calculated relative to the control native cells and the half-maximal inhibitory concentrations (IC50) were deduced from the respective sigmoidal concentration-response curve plotted using the following equation [
28].
4.6. Expression Analysis by Western Blotting
Cells were transfected with respective plasmids for 48 h before proteins were collected in RIPA buffer supplemented by protease and phosphatase inhibitors. After protein quantification by Lowry assay, 20 µg protein samples were loaded on SDS-PAGE gels for Western blotting using the following antibodies: PD-L1 (#MA5-27896, Invitrogen, Waltham, MA, USA), KRAS (#ab55391, Abcam, Cambridge, UK), CCDN1 (#2978S, Cell Signalling, Danvers, MA, USA) and ACTB (#ab6276, Abcam) as loading controls.
4.7. Migration Assay by Wound-Healing Scratch Assay
For migration assay, cells were seeded in 6-well plates at a density of 3 × 10
5 cells/well and incubated for 24 h. After plasmid transfection, a 200 µL pipette tip was used to make a scratch in the middle of each well. A phase-contrast microscope was used to record the wound areas at 0, 4 and 24 h. Microscopic images were taken at 10× magnification. Cells were cultured overnight at 37 °C for 24 h and again microscopic images were taken to assess the wound closure. The migration capability was evaluated by measuring the migration distance and percentage wound closure. Wound closure was quantified as the percentage by which the initial scratch width has decreased for each given time point [
29]. The experiment was carried out in triplicates and data were represented as mean ± SEM. Images were analyzed using ImageJ software, version 1.51j8, and the percentage wound closure was calculated as follows:
4.8. Apoptosis Detection Using Flow Cytometer
Apoptosis testing was carried out using the Annexin V-Fluorescein Isothiocyanate (FITC) Apoptosis Detection Kit. The control group include cells transfected with empty vector in addition to unstained cells to measure background fluorescence and to determine the gating for the analysis of the upcoming samples. After 48 h of transfection, cells were stained with PI alone, cells stained with annexin VFITC alone, cells stained with both PI and annexin V/FITC [
30]. Cells were seeded at a density of 3 × 10
5 in 6-well plates and incubated overnight at 37 °C and 5% CO
2. The supernatants were decanted, and the cell pellets were washed twice with PBS and once with 1× binding buffer and resuspended in 1 mL 1× binding buffer. One hundred microliters was then transferred to a clean tube and 5 µL of Annexin V-FITC and 5 µL of PI were added and the tubes were incubated at room temperature for 15 min in the dark [
29]. Finally, 400 µL of 1× binding buffer was added. Apoptosis was measured by using BD FACS Calibur flow cytometer and cell sorter and Cell Quest™ software version 5.1 according to the instructions provided by the Annexin V-FITC kit (Becton-Dickinson, Franklin Lakes, NJ, USA).
4.9. Cell Cycle Analysis Using FUCCI Assay
A549 cells were transfected with both CRISPR/Cas9 plasmid with either sgRNA for
PD-L1 or for
KRAS or both, together with ES-FUCCI plasmid, which was a gift from Pierre Neveu (Addgene plasmid #62451;
http://n2t.net/addgene:62451, accessed on 30 November 2020; RRID: Addgene_62451). After 48 h of transfection, cells were fixed and measured by flow cytometry to quantify for mCherry-Cdt1 and citrine-geminin [
31].
4.10. Coculture of A549 with Lymphocytes
Lymphocytes were isolated by Ficoll centrifugation gradient from a human blood sample obtained from a healthy donor. They were collected separately from monocytes and used in their native state. Briefly, following isolation, lymphocytes were cultured in RPMI media and incubated overnight. Subsequently, lymphocytes were cultured with A549 cells having PD-L1 knocked down, or control A549 cells transfected with empty vector. After 24 h, the lymphocyte-conditioned medium (LCM) was harvested and centrifuged to remove lymphocytes. Supernatant was then added to native A549 cells before treatment with paclitaxel (7 µM) in a 96-well plate [
32]. For direct coculture, lymphocytes were directly added to A549 cells after their transfection with the respective plasmids.
4.11. Statistical Analysis
Statistical analyses were performed with GraphPad Prism 9 Software (GraphPad Software, Inc., La Jolla, CA, USA). Student’s t test (two-tailed) was used to compare two groups. When more than two groups were compared, differences among the groups were determined by one-way ANOVA. Data are expressed mean ± SEM; statistical significance was set at p ≤ 0.05. Significance level is noted as follows: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 unless otherwise specified.