1. Introduction
The CRISPR/Cas9 genome-editing technology enables precise and efficient modification of eukaryotic genomes, representing a pivotal breakthrough in the field of gene editing research [
1]. This system comprises the Cas9 nuclease and a bifunctional single-guide RNA (sgRNA), which directs the Cas9 protein to a complementary target site adjacent to a 5′-NGG protospacer adjacent motif (PAM) sequence. The binding of the PAM and the corresponding target site activates the Cas9 nuclease, leading to the generation of site-specific double-strand breaks (DSBs) within the genomes of diverse eukaryotic species [
2,
3].
DSBs induced by CRISPR/Cas9 are typically repaired via two primary DNA damage repair (DDR) pathways: the error-prone non-homologous end joining (NHEJ) pathway or the more accurate homology-directed repair (HDR) pathway. The HDR pathway utilizes a homologous chromosome or an exogenous DNA template present at the DSB site to achieve precise deletions, insertions, or point mutations. This precise modification is crucial for accurate genome editing. However, the efficiency of HDR tends to be exceedingly modest [
2,
4]. Hence, there remains a profound interest in further refining CRISPR/Cas9-mediated precise genome editing.
Multiple strategies have been developed to enhance the efficiency of CRISPR-Cas9-mediated HDR. Recent studies indicate that the optimization of the donor DNA template design can enhance HDR efficiency [
5,
6]. Specifically, the use of linearized donor plasmids has been demonstrated to significantly increase knock-in (KI) efficiency when compared to supercoiled plasmids [
7]. Research has demonstrated that in vitro linearized donor templates exhibit higher KI efficiency compared to circular donors and achieve high KI efficiency across a range of cell lines [
8,
9,
10]. Additionally, during CRISPR-Cas9-mediated HDR, gene expression from linear plasmid DNA inhibited when it is in its free intracellular form, thereby ensuring that the cells selected through positive screening with antibiotic resistance markers are primarily those in which the exogenous gene has been successfully integrated into the genomic DNA [
11]. Thus, the use of linearized donor templates increases the likelihood of generating stable transfectants suitable for in vivo experimentation. Moreover, the efficiency of HDR can be markedly enhanced by chemical modifications to the donor DNA. The PEG10 modification, which involves attaching polyethylene glycol with functional groups, is commonly used to extend the half-life of protein drugs in the body [
12]. This modification improves the stability of donor DNA by altering the termini of the double-stranded template [
12]. A study comparing various chemical modifications revealed that donor templates modified with the chemical group polyethylene glycol (PEG10) significantly enhanced knock-in (KI) efficiency, showcasing a 5- to 6-fold improvement over unmodified controls. Additionally, these modified templates exhibited enhanced stability and reduced cytotoxicity [
12].
The Cas9 RNP, also referred to as the Cas9 ribonucleoprotein complex, represents an advanced gene editing technique. The formation of the Cas9 RNP complex is crucially dependent on the incubation of the Cas9 protein with in vitro transcribed gRNA. Following introduction into the target cells, the complex serves to facilitate the gene editing process [
13]. The adoption of the Cas9 RNP technique confers numerous benefits. Primarily, it minimizes the likelihood of exogenous gene integration into the host genome, thereby enhancing the safety of gene editing [
14,
15]. Additionally, enhancing the stability of guide RNAs (gRNAs) can mitigate off-target effects that may occur during CRISPR-Cas9-mediated gene editing and this refers to the erroneous editing of genes outside the target sites [
16]. The technique is notable for its simplicity and rapidity. However, challenges remain in the direct delivery of CRISPR/Cas9 nucleases and their associated sgRNAs into cells [
17]. Cell-penetrating peptides (CPPs), brief sequences of fewer than 30 amino acids, can facilitate the entry of proteins, nucleic acids, and other molecules into cells through energy-dependent endocytic pathways [
18,
19]. Studies have demonstrated that the fusion of Cas9 with a peptide sequence, termed Cas9-m9R, which consists of four glycine, four arginine, and four leucine residues, along with sgRNA-9R, is capable of editing endogenous genes in human cells without the need for auxiliary delivery agents [
20]. Additionally, the attachment of multiple nuclear localization signal (NLS) motifs to Cas9 has been demonstrated to enhance the protein’s entry into the cell nucleus [
21]. The peptide-assisted genome editing (PAGE) CRISPR-Cas system, which combines the cell-penetrating peptide HIV Transactivator of Transcription (TAT) with NLS, provides an effective method for the direct delivery of Cas9 protein, thereby supporting the successful implementation of gene editing [
17].
In this study, we utilized a 5′-terminal PEG10 modification to achieve targeted gene integration, resulting in significantly improved integration efficiency compared to unmodified linear templates. Utilizing a 1.8 kb 5′-PEG10-modified double-stranded DNA (dsDNA) donor increased knock-in (KI) efficiency from 26% to 49%. This modification resulted in a 1.9-fold increase in KI efficiency relative to the unmodified dsDNA template. Additionally, we optimized a system to establish a 293T cell line with robust expression of TAT-Cas9-EGFP at the targeted integration site, thereby establishing a platform for protein production. Additionally, the expressed TAT-Cas9 protein exhibited a significant level of editing efficiency.
3. Discussion
For the precision of genome editing, double-strand breaks (DSBs) are typically repaired via the homology-directed repair (HDR) pathway, which is most active during the late S/G2 phases of the cell cycle [
32]. HDR is pivotal for advancements in animal breeding; however, its naturally low efficiency poses a substantial obstacle for the application of CRISPR-Cas9 in targeted genome modification [
29,
30]. One major factor limiting HDR efficiency is the structure of the repair template [
6,
9]. Studies have demonstrated that linearized plasmids can enhance KI efficiency when using CRISPR/Cas9 technology [
7,
8,
9,
10]. Moreover, linearized vectors tend to yield more stable transfected cells, which are more appropriate for in vivo animal studies [
11]. Consequently, this study utilized linearized vectors for HDR to generate site-specific integration cell lines. In this study, the repair template was a linear DNA fragment with a 5′ C6-PEG10 modification. This modification serves to inhibit the concatenation of multiple templates, an occurrence that can lead to the insertion of multiple DNA fragments into the genome when using CRISPR/Cas9 technology [
33]. Furthermore, this approach reduces the likelihood of partial DNA fragment loss during the editing process. The attachment of molecules to the termini of the DNA template aids preventing unintended ligation, minimizing erroneous DNA insertions, and guaranteeing the comprehensive integration of the DNA into the genome [
34,
35]. Additionally, the 5′C6-PEG10 modification shields the DNA termini from degradation by cellular nucleases, thereby enhancing DNA stability and elevating the probability of nuclear import and chromosomal integration [
12]. A recent investigation evaluated the efficacy of diverse chemical modifications and revealed that modification of the 5′ end with a C6-polyethylene glycol (C6-PEG10) moiety significantly enhances KI efficiency, while also demonstrating high stability and reduced cytotoxicity [
12]. The incorporation of the modification has demonstrated an enhancement in stability, ensuring that the gene editing process is maintained with a certain level of precision, without concomitantly increasing the incidence of random transgene insertion. Insertions and deletions (indels) at the KI junction regions are commonly a result of non-homologous end joining (NHEJ)-mediated KI, whereas HDR-mediated KI typically results in accurate editing [
36]. The PEG10 modification does not elevate the NHEJ-KI frequency, thereby maintaining a low rate of random integration events [
12]. The previous study validated the knock-in (KI) efficiency enhancement by PEG10 at various loci including AAVS1, GAPDH, and CCR5 in 293T cells, consistently demonstrating that PEG10 significantly increases KI efficiency [
12]. Compared to other safe harbors, the AAVS1 locus has high and uniform gene expression [
22,
23], which is why the AAVS1 locus was chosen for subsequent experimental research in 293T cells. Experimental data indicate that the utilization of a 1.8 kb dsDNA donor with 50 bp homology arms and a 5′ PEG10 modification at the AAVS1 locus in HEK293T cells augmented KI efficiency from 26% to 49%, corresponding to a 1.9-fold enhancement. This chemical modification bolstered DNA stability and promoted nuclear import. Additionally, incorporating a 50 bp homology arm within PCR primers enables expedited template synthesis through straightforward PCR and diminishes the length of the linear repair template, which may enhance transfection efficiency. The effectiveness of the PEG10 modification for KI of large fragments (6.3 kb) is validated by the establishment of the TAT-Cas9-EGFP cell line, which demonstrates an editing efficiency of 8.82%. However, the efficiency is diminished for extended fragments, a phenomenon that can be attributed to reduced transfection efficacy accompanying increased fragment size [
37] and the complexities inherent in integrating larger DNA segments [
38].
Genetically modified animals with KI transgenes play a significant role in the genetic improvement of livestock. The efficiency of HDR in primary fibroblasts is inherently low [
29,
30], posing significant challenges for targeted genome modifications using CRISPR/Cas9. The addition of PEG10 modification contributes to homologous recombination in goat fibroblasts. In GFF cells, we utilized a 500 bp homology arm length [
39], and incorporated a PEG10 modification, resulting in a KI efficiency of 3.03%. This marks a considerable enhancement over the efficiency observed with unmodified templates. Despite screening 33 clones, only one positive clone was identified, indicating an exceptionally low success rate. The diminished efficiency is hypothesized to correlate with the reduced efficacy of editing at the target locus. Research has indicated that the employment of multiple sgRNAs with overlapping sequences can improve the efficiency of CRISPR/Cas9-mediated knock-in. Consequently, an additional sgRNA was introduced, which overlaps with the initial sgRNA. Following this modification, we isolated a total of 62 clones, of which 16 were positive, resulting in a knock-in success rate of 25.8%. Future research endeavors should concentrate on refining HDR efficiency through various approaches, such as optimizing the length of the homology arm [
40], and incorporating small molecule inhibitors [
41], in order to achieve more precise and effective knock-in results. Prokaryotic expression systems are advantageous for protein production due to their convenience and numerous benefits. Nonetheless, proteins synthesized in these systems may exhibit reduced biological activity and frequently necessitate additional modifications for functionality. Furthermore, prokaryotic systems lack the ability to finely regulate expression timing and levels, and certain proteins may accumulate as inclusion bodies, which can complicate the purification process. In comparison, mammalian cell lines are increasingly favored for the production of recombinant proteins, as they are capable of executing the necessary post-translational modifications (PTMs) [
42]. HEK293 cells are particularly beneficial for recombinant protein production due to their ability to generate human-like glycosylation patterns, thereby minimizing the risk of immunogenic reactions [
43,
44,
45]. Additionally, these cells facilitate the stable yield of recombinant proteins [
43,
46,
47]. Genomic safe harbors (GSHs) are discrete genomic loci that serve as optimal insertion sites for the stable expression of exogenous proteins without interfering with the function of other genes [
22]. The AAVS1 locus, situated within the first intron of the PPP1R12C gene on chromosome 19, is a well-established GSH. The targeting of this site does not impair cellular function and supports the consistent transcription and stable expression of the inserted genetic material [
22]. The AAVS1 site is characterized by high and uniform levels of transgene expression, maintaining stability for approximately three months without the requirement for ongoing selection pressure [
23]. Traditionally, the development of recombinant protein-producing cell lines involves the random integration of the target gene into the host genome, followed by a laborious screening process to isolate clones with high expression levels [
48,
49]. This methodology is not only time-intensive, often extending over a year, but also economically burdensome. Furthermore, the random integration strategy can result in variable expression stability and diminished yields over time, attributable to the unpredictable nature of integration sites and potential genetic instability [
50,
51]. To overcome these challenges, site-specific gene integration technology enables the accurate placement of the target gene within transcriptionally active genomic regions [
52]. Targeting these regions for site-specific integration expedites the creation of high-expression recombinant protein cell lines and obviates the unpredictability inherent in random integration methods [
53,
54]. The generation of site-specific integration cell lines at the AAVS1 locus in 293T cells ensures stable protein expression, furnishes a dependable source for protein production, and lays the groundwork for subsequent experimental procedures. Affinity chromatography, a standard method for purifying recombinant proteins, typically involves the binding of a 6 His tag to nickel-charged NTA ligands. However, certain proteins may exhibit non-specific binding to nickel-based resins, which can lead to reduced yields of 6 His-tagged recombinant proteins. In a study, nickel resin was used to purify rSHI overexpressed by Pseudomonas pelliculosa, and it was found that using a 12 His tag could enhance the affinity between the protein and the nickel resin, making it easier to purify, and no significant amounts of non-specific proteins were observed in any elution [
55]. In this study, a eukaryotic cell line with site-specific integration was established, and the purification of recombinant proteins was achieved through the utilization of an N-terminal 12 His tag. The results indicated that increasing the number of His tags from 6 to 12 further improved specificity, thereby facilitating the purification of the recombinant protein. Furthermore, the incorporation of a linker-tag was found to maintain the protein’s native conformation and was demonstrated to be a versatile strategy for the purification of diverse proteins.
The direct transduction of CRISPR-Cas9 nucleases and their corresponding sgRNAs into cells is frequently hindered by inefficient cellular internalization, attributable to the absence of inherent cell-penetrating properties. A study has shown that Cas9 nucleases, when complexed with polycationic sgRNAs, can associate with cationic liposomes, which enhances their delivery efficiency into mammalian cell lines [
56]. However, components like liposomes can be toxic, highlighting the importance of optimizing direct protein delivery methods. Studies have shown that Cas9, when chemically conjugated with polyarginine peptides, can be internalized by cells through endocytosis [
20]. Furthermore, the addition of multiple nuclear localization signals (NLSs) to Cas9 has been shown to improve its delivery into the cell nucleus [
21]. The Peptide-Assisted Genome Editing (PAGE) CRISPR-Cas system, which comprises core components such as TAT, Cas proteins (including Cas9 or Cas12a), multiple nuclear localization signals, and endosome escape peptides, provides a simple, efficient, and non-toxic approach to genome editing in primary cells [
17]. In contrast to the prokaryotic expression system detailed in the aforementioned publication, a eukaryotic expression system has been constructed for the specific integration of TAT-Cas9-EGFP, leading to the establishment of stable protein expression.
4. Materials and Methods
4.1. Plasmid Construction
The Cas9 and U6-sgRNA co-expression vector backbone pX458 was purchased from Addgene (plasmid ID: 48138). The sgRNA(ACCCCACAGTGGGGCCACTA) was designed using the CRISPR design tool (
https://www.ensembl.org/index.html accessed on 13 December 2024) based on the target site at the AAVS1 locus. To construct the Cas9/gRNA plasmid, the pX458 plasmid was digested with the restriction enzyme BbsI to allow for the cloning of additional sgRNAs. The sgRNA was synthesized, annealed, and cloned into the pX458 backbone vector to form a functional co-expression plasmid [
57].
To construct the HR donor plasmid, an HA corresponding to the target site was designed using the human genomic DNA sequence from NCBI. The homology repair template sequence, from 5′ to 3′, consists of the following elements: a 5′ homology arm sequence, a CMV promoter, a protein-coding gene sequence (Lin28A/Lin28B/Nanog/PouV), an SV40 polyA transcription termination sequence, and a 3′ homology arm sequence. The CMV promoter and SV40 polyA sequence were obtained from the Pmcherry-N1 plasmid. PCR amplification of the Lin28A, Lin28B, Nanog, and PouV sequences was performed using the laboratory’s existing pIRES-cLin28A, pIRES-cLin28B, pIRES-cNanog, and pIRES-cPouV plasmids, respectively. Digestion of the Pmcherry-n1 plasmid with NheI and NotI restriction enzymes was followed by the cloning of the PCR-amplified fragments into the vector backbone. The donor plasmid was constructed using the ClonExpress MultiS One-Step Cloning Kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The 50 bp HA sequence, due to its brevity, can be acquired through the design of specific primers. Modified primers with a 5′ C6-PEG10 modification were used to amplify the circular plasmid, linearizing the donor plasmid with the modification.
To generate an expression vector for the recombinant TAT-Cas9-EGFP protein expression in cells, the components of the expression vector were amplified by PCR. The integrated template sequence, from 5′ to 3′, consists of the following elements: the TAT sequence, 4-c-myc NLS, Cas9, 2-SV40 NLS, EGFP, and a 12-His tag. Cas9 was amplified from the pX330 plasmid (plasmid ID: 42230, Addgene, Watertown, MA, USA), and the elements TAT, 4-c-myc NLS, 2-SV40 NLS, as well as the 20 bp overlap necessary for seamless cloning, were incorporated into Cas9 through a series of primer design and amplification steps. The EGFP sequence was amplified from the pX458 plasmid and modified through multiple amplification steps to include the 12 His tag and the required 20 bp overlap for seamless cloning. Digestion of the pcDNA3.1(+) vector with EcoRI and EcoRV enzymes was performed, followed by the cloning of the aforementioned PCR-amplified fragments into the vector backbone. Construction of the donor plasmid was achieved using the pEASY
®-Basic Seamless Cloning and Assembly Kit (TRAN, Beijing, China), in accordance with the manufacturer’s protocol. Acquisition of the 50 bp homology arm (HA) was facilitated by the design of specific primers, due to its brevity. Amplification of the circular plasmid was performed using modified primers containing a 5′ C6-PEG10 modification, subsequent to which the plasmid was linearized with the same modification. The primers used are listed in
Table S1. The red fluorescent reporter plasmid U6-sgmChe-CBh-mcherry was designed. Its sequence from 5′ to 3′ is as follows: the U6 promoter, an sgRNA targeting mcherry, the CBh promoter, and mcherry. The sequence from 5′ to 3′ encompasses the U6 promoter, an sgRNA directed against mcherry (GGAGCCGTACATGAACTGAG), the CBh promoter, and the mcherry gene. The U6 promoter, CBh promoter, and mcherry gene were derived from the laboratory’s pre-existing pX330-mcherry plasmid. This section was amplified via PCR and subsequently cloned into the pcDNA3.1(+) vector backbone, utilizing EcoRI and EcoRV as the selected restriction enzyme sites. The plasmid was finally digested using the restriction enzyme BbsI to enable the cloning of additional sgRNAs. The primers utilized are detailed in
Table S2.
All components of the plasmids were amplified using PrimeSTAR Max (Takara, Japan) under the following settings: 98 °C for 10 s, 60 °C for 15 s, 72 °C for 5 s per kilobase, for 30 cycles. All donor templates were purified using the DNA purification kit (TIANGEN, Beijing, China) and sequenced by NovaSeq Company (San Diego, CA, USA).
4.2. Cell Culture and Transfection
The human embryonic kidney cell line HEK 293T and Hela cell line are preserved by the Cell Resource Center of the Institute of Basic Medical Sciences, the Chinese Academy of Medical Sciences, and cultured in a cell culture incubator at 37 °C with 5% CO2 humidity. The 293T cells are maintained in high-glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Gibco). Hela cells are maintained in 1640 medium (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin. Goat fetal fibroblast (GFF) cells are derived from the fetuses of Lasoshan dairy goats (Capra hircus) at 6 to 7 weeks of gestation and cultured in complete medium consisting of DMEM/F12 (Gibco), 10% FBS, and 1% penicillin/streptomycin.
Lipofect approximately 10
6 cells with the corresponding amount of pX458-sgRNA and linear donor using Lipofectamine™ 3000 (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions, with the specific ratios of liposome to plasmid detailed in
Table S3. After 48 h of lipofection, the cells were stained with DAPI, and images were captured using an inverted fluorescence microscope. Cell counting was performed using Image J 1.46r.
4.3. T7 Endonuclease I Cleavage Detection Assay
T7 Endonuclease I (T7EI) can recognize and cut small homologous repeat sequences within DNA molecules, and it can be used to quantify the efficiency of gene editing events. CRISPR/Cas9-induced lesions at the endogenous target site was quantified using the T7EN I (NEB) cleavage detection assay to investigate the insertions/deletions (indels) generated by nuclease-mediated non-homologous end joining (NHEJ). The gene fragments of off-target sites were amplified with primers specific to each locus by 30 cycles of PCR. The obtained PCR products were purified using a kit (Tiangen). A quantity of 0.5–1 μg of the purified product was denatured and annealed using a thermocycler, subsequently digested with T7EN I for 15 min and separated with a 2% agarose gel. Electrophoresis was conducted at 100 V for a duration of 30 min. The primers are listed in
Table S4.
4.4. Lysis of Trace Cells and 5′/3′ Junction PCR at Target Region
Cells were sorted by flow cytometry into a 96-well plate 48 h post-lipofection. The cell culture medium was changed every 5 days, and when the wells of the 96-well plate were confluent, positive cell identification could be performed. The microcell lysis buffer system consists of: Tris-HCl (1 M pH = 8.0) 2 mL, Triton X-100 0.45 mL, NP-40 0.45 mL, Proteinase K (20 mg/mL) 1 mL, and sterile ddH2O to a final volume of 50 mL. The lysis procedure is as follows: 65 °C for 30 min; 95 °C for 15 min; 16 °C indefinitely.
The lysate product was taken at a volume of 2 μL for PCR identification. The PCR reaction mix for all samples included template DNA at 20 ng, forward and reverse primers each at 0.5 pmol, PrimeSTAR 12.5 μL, and the volume was brought to 25 μL with sterile double-distilled water. The PCR reaction conditions were as follows: pre-denaturation at 98 °C for 5 min; 30 cycles of denaturation at 98 °C for 10 s, annealing at 59 °C for 15 s, and extension at 72 °C for 5 s per kilobase; a final extension at 72 °C for 5 min; and a final hold at 4 °C. The PCR products were analyzed on a 1% agarose gel. The 5′ primer Left-F was designed outside the 5′ homology arm of the AAVS1 gene, and Left-R was designed within the CMV promoter of the insert fragment, generating a 543 bp amplification product from CRISPR/Cas9-mediated targeted integration cells. The 3′ primer Right-F was designed within the SV40 polyA sequence of the insert fragment, and Right-R was designed outside the 3′ homology arm sequence of the AAVS1 gene, generating a 537 bp amplification product from CRISPR/Cas9-mediated targeted integration cells. The purified 5′/3′ ligated PCR products were sequenced by NovaSeq Company. The detailed DNA sequences used for PCR primers are listed in
Table S5.
4.5. Real-Time Fluorescence Quantitative PCR
To determine the relative copy numbers of genes encoding cLin28A, cLin28B, cNanog, and cPouV, total RNA was extracted using the RNeasy Micro Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized using the PrimeScript RT Kit (Takara, Kusatsu, Japan) following the manufacturer’s protocol. Tubulin was used as a representative housekeeping gene for normalization. For qPCR assays, each 20 μL qPCR reaction mixture contained 2 μL of cDNA (approximately 100 ng of RNA), 0.4 μM of forward and reverse primers, 0.4 μL of Rox Reference Dye II, and 10 μL of SYBR Premix Ex Taq II (Takara). The qPCR reactions were run on an Mx3000P instrument (Agilent Technologies, Santa Clara, CA, USA) with the following conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s. Data analysis was performed using Mx3000P. The relative copy numbers of endogenous target genes in wild-type 293T cells and the related transgenes in site-specific integration-derived reference clones were calculated using the ΔΔCT method: (log
10(2
−ΔΔCT) + 1). The detailed DNA sequences used for qPCR primers are listed in
Table S6.
4.6. Detecting Targeted Protein Expression
After 5′/3′ ligation PCR identification, the expression titers of positive clones were further analyzed using Western blotting. Then, 2.5 × 106 cells were collected, and total protein was extracted using RIPA lysis buffer (Solarbio, Beijing, China). The protein concentration of each extract was quantified using the BCA Protein Assay Kit (cwbio, Taizhou, China) according to the manufacturer’s protocols. Then, mix crude lysate in SDS buffer and incubated at 100 °C for 5 min, equal amounts of the protein samples (about 20–30 μg each) were loaded in separate lanes of 10% gel for SDS–polyacrylamide gel electrophoresis (Bio-Rad, Hercules, CA, USA). After electrophoresis, the proteins were transferred to a PVDF membrane under conditions of 4 °C, 320 mA, and 1.5 h. The PVDF membrane was blocked with 5% non-fat milk at room temperature for 2 h. After washing with TBST, the membrane was incubated with the primary antibody overnight at 4 °C. The antibody used for identification of the His tag was a 1:10,000 dilution of 6 His, His-tag monoclonal antibody (66005-1). The Cas9 antibody used was a 1:1000 dilution of the recombinant anti-CRISPR-Cas9 antibody [EPR18991] (ab189380). Following another wash with TBST, the membrane was incubated with the secondary antibody at room temperature for 1 h. The antibodies are all diluted in TBST. Finally, the target proteins were detected using ECL chemiluminescence (Solarbio, Tongzhou, Beijing, China) and the Azure C300 chemiluminescence imaging system, and the Western blotting results were analyzed.
4.7. EdU Cell Proliferation Assay
The EdU cell proliferation assay was conducted in accordance with the protocol provided by the Cell-Light™ EdU Apollo 567 In Vitro Kit. A 48-well plate was pre-seeded with cells. Reagent A was diluted into the proliferation medium at a ratio of 1000:1 to achieve a final concentration of 50 μM EdU medium. Two hundred microliters of EdU medium was added to each well and incubated in a 37 °C, 5% CO2 incubator for 2 h. The EdU medium was removed, and the cells were subsequently washed 1–2 times with PBS. Subsequently, each well was treated with 200 μL of 4% paraformaldehyde (Solaibao, Beijing, China) for cell fixation at room temperature for 30 min. The fixative was removed, and each well was then treated with 200 μL of a 2 mg/mL glycine solution (Solaibao, Beijing, China) to neutralize the fixative, followed by a 5 min incubation on a decolorization shaker at 200 rpm at room temperature. The glycine solution was discarded, and the cells were subsequently washed with PBS once. Each well was then treated with 200 μL of PBS containing 0.5% Triton X-100 (Solaibao, Beijing, China) for cell permeabilization at room temperature for 10 min, after which the cells were washed once with PBS. Subsequently, 200 μL of 1× Apollo staining reaction solution was added to each well and incubated on a decolorization shaker at 200 rpm for 30 min at room temperature in the dark. The staining reaction solution was removed, and the cells were then washed 1–2 times with PBS. Each well was treated with 200 μL of ready-to-use DAPI solution and incubated at room temperature in the dark for 5 min, followed by 1–2 washes with PBS. Finally, 200 µL of PBS was added to each well, and images were captured using an inverted fluorescence microscope and counted using Image J software.
4.8. Cas9 Protein Purification
Total protein was extracted using non-denaturing WB/IP lysis buffer (Yeasen, Shanghai, China). Purified recombinant protein was obtained through affinity chromatography. The resin (Yeasen) was packed into an appropriate purification column by gravity, and the chromatography column was rinsed with 3–5 times the column volume of deionized water and then equilibrated with at least 5 times the column volume of Lysis Buffer. The sample was added to the equilibrated gravity column, and the retention time was at least 2 min to ensure sufficient contact between the target protein and Ni2+ ions, thereby improving the purification yield. The column was balanced with Wash Buffer, and the flow-through was collected. Elution was performed using 5–10 times the column volume of Elution Buffer, fractionally collected, with one tube per column volume, and each fraction was tested separately. Finally, the resin was washed sequentially with 3 times the column volume of Lysis Buffer and 5 times the column volume of deionized water. The purified protein was finally exchanged into the Cas storage buffer (580 mM KCl, 40 mM Tris–HCl, pH 7.5, 20% glycerol, 2 mM TCEP-HCl, and 2 mM MgCl2). The purified Cas protein was filtered through a 0.22 μm filter, aliquoted, and stored at −80 °C.
4.9. TAT-2.7 Cas9 Direct Delivery
In the experiment delivering TAT-Cas9-EGFP into the nucleus of the 293T cell line, 1 μg of TAT-Cas9-EGFP protein was mixed with 200 μL of fresh complete cell culture medium. The medium in the chamber slide, which was seeded with approximately 3000 cells the day before, was replaced with this mixed medium. After incubation in the incubator for 1 h, imaging was performed using confocal microscopy. Prior to this, an additional PBS washing step was carried out.
For the experiment of TAT-Cas9 delivery to the mChe reporter cell line, 400 ng of TAT-Cas9-EGFP protein in storage buffer was first mixed with 1 mL of fresh complete cell culture medium. The medium of the 24-well plate that was seeded the day before was replaced with the mixed medium, and liposome transfection was performed to deliver the mChe reporter plasmid. The cells were incubated in the incubator for 24 h and then subjected to FACS analysis. Prior to this, additional PBS washing step was carried out to remove any TAT-Cas9 protein bound to the cell surface.
4.10. Fluorescence Microscopy
Cells transfected with the pX458 plasmid were seeded into a 24-well plate, then stained with DAPI for approximately 15 min and washed three times with PBS for 5 min each. Images were captured using a fluorescence-inverted microscope (Nikon, Tokyo, Japan). The excitation light wavelength used for DAPI detection is 490 nm, for FITC detection it is 488 nm, and for TRITC detection it is 550 nm.
Cells delivered with TAT-Cas9-EGFP were seeded into chamber slides and stained with DAPI for approximately 15 min, followed by three washes with PBS, each for 5 min. Imaging was captured using a confocal laser scanning microscope (Nikon). The excitation light wavelength for DAPI detection was 490 nm, and for FITC detection, it was 488 nm.
4.11. Flow Cytometry
To evaluate the gene editing efficiency of TAT-Cas9-EGFP in the mChe reporter cells, the BD Accuri C6 Plus flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) was used to analyze the proportion of red fluorescence in 10,000 cells, in order to monitor the mChe-positive cell population over a period of time.
4.12. Statistical Analysis
All results are presented as the mean ± SEM. Statistical analyses of differences between groups were performed using two-tailed Student’s t test or chi-square test. * p < 0.05, ** p < 0.01, and *** p < 0.001.