De Novo Transcriptome Assembly of Cedar (Cedrela odorata L.) and Differential Gene Expression Involved in Herbivore Resistance
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and RNAseq Sequencing
2.2. De Novo Assembly and Quality Analysis
2.3. Redundancy Reduction and Transcriptome Slimming
2.4. Identification of Herbivore Resistance Genes
2.5. Differential Gene Expression and Gene Ontology
2.6. Validation of Differential Expression
3. Results
3.1. De Novo Assembly and Quality Analysis
3.2. Identification of Herbivore Resistance Genes
3.3. Differential Gene Expression
3.4. Validation of Differential Expression Using qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fan, W.; Fan, L.; Wang, Z.; Yang, L. Limonoids from the Genus Melia (Meliaceae): Phytochemistry, Synthesis, Bioactivities, Pharmacokinetics, and Toxicology. Front. Pharmacol. 2022, 12, 795565. [Google Scholar] [CrossRef] [PubMed]
- Nogueira, T.S.R.; Passos, M.d.S.; Nascimento, L.P.S.; Arantes, M.B.d.S.; Monteiro, N.O.; Boeno, S.I.d.S.; de Carvalho Junior, A.; Azevedo, O.d.A.; Terra, W.d.S.; Vieira, M.G.C.; et al. Chemical Compounds and Biologic Activities: A Review of Cedrela Genus. Molecules 2020, 25, 5401. [Google Scholar] [CrossRef]
- Linnakoski, R.; Forbes, K.M. Pathogens—The Hidden Face of Forest Invasions by Wood-Boring Insect Pests. Front. Plant Sci. 2019, 10, 90. [Google Scholar] [CrossRef] [PubMed]
- Sol-Sánchez, Á.; Hernández Melchor, G.I.; Sánchez Gutiérrez, F. Main Pests and Diseases in Tropical Forest Species in Nursery. In Current and Emerging Challenges in the Diseases of Trees Because; IntechOpen: São Paulo, Brazil, 2012; Volume 1, p. 11. [Google Scholar]
- Rudolph, E.A.; Wiman, N.G. Insights from Specimen Data for Two Economic Chrysobothris Species (Coleoptera: Buprestidae) in the Western United States. Ann. Entomol. Soc. Am. 2023, 116, 195–206. [Google Scholar] [CrossRef]
- Bainsla, N.K.; Meena, H.P. Breeding for Resistance to Biotic Stresses. In Sorghum in the 21st Century: Food–Fodder–Feed–Fuel for a Rapidly Changing World; Springer Singapore: Singapore, 2021; pp. 369–392. [Google Scholar] [CrossRef]
- Chamberland, V.; Robichaud, F.; Perron, M.; Gélinas, N.; Bousquet, J.; Beaulieu, J. Conventional versus Genomic Selection for White Spruce Improvement: A Comparison of Costs and Benefits of Plantations on Quebec Public Lands. Tree Genet. Genomes 2020, 16, 17. [Google Scholar] [CrossRef]
- Lebedev, V.G.; Lebedeva, T.N.; Chernodubov, A.I.; Shestibratov, K.A. Genomic Selection for Forest Tree Improvement: Methods, Achievements and Perspectives. Forests 2020, 11, 1190. [Google Scholar] [CrossRef]
- Long, L.; Gu, L.; Wang, S.; Cai, H.; Wu, J.; Wang, J.; Yang, M. Progress in the Understanding of WRKY Transcription Factors in Woody Plants. Int. J. Biol. Macromol. 2023, 242, 124379. [Google Scholar] [CrossRef]
- Aljbory, Z.; Chen, M.S. Indirect Plant Defense against Insect Herbivores: A Review. Insect Sci. 2016, 25, 2–23. [Google Scholar] [CrossRef] [PubMed]
- An, Y.; Li, Y.; Ma, L.; Li, D.; Zhang, W.; Feng, Y.; Liu, Z.; Wang, X.; Wen, X.; Zhang, X. Transcriptomic Response of Pinus Massoniana to Infection Stress from the Pine Wood Nematode Bursaphelenchus xylophilus. Stress Biol. 2023, 3, 50. [Google Scholar] [CrossRef]
- Müller, N.A.; Kersten, B.; Fladung, M.; Schroeder, H. RNA-Seq of Eight Different Poplar Clones Reveals Conserved up-Regulation of Gene Expression in Response to Insect Herbivory. BMC Genom. 2019, 20, 673. [Google Scholar] [CrossRef]
- Hill, M.S.; Vande Zande, P.; Wittkopp, P.J. Molecular and Evolutionary Processes Generating Variation in Gene Expression. Nat. Rev. Genet. 2021, 22, 203–215. [Google Scholar] [CrossRef] [PubMed]
- Lloyd, J.P.B.; Lister, R. Epigenome Plasticity in Plants. Nat. Rev. Genet. 2022, 23, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Wang, Y.; Li, L.; Li, F.; He, Y.; Wu, J.; Wei, C. Transcriptomic and Phytochemical Analyses Reveal Root-Mediated Resource-Based Defense Response to Leaf Herbivory by Ectropis Oblique in Tea Plant (Camellia sinensis). J. Agric. Food Chem. 2019, 67, 5465–5476. [Google Scholar] [CrossRef] [PubMed]
- Zhong, X.; Feng, P.; Ma, Q.; Zhang, Y.; Yang, Y.; Zhang, J. Cotton Chitinase Gene GhChi6 Improves the Arabidopsis Defense Response to Aphid Attack. Plant Mol. Biol. Rep. 2020, 39, 251–261. [Google Scholar] [CrossRef]
- Huang, X.; Zhang, H.; Li, H.; Wang, M.; Guo, X.; Liu, E.; Han, X.; Zhen, C.; Li, A.; Shi, W.; et al. Functional Characterization of a Terpene Synthase Responsible for (E)-β-Ocimene Biosynthesis Identified in Pyrus betuleafolia Transcriptome after Herbivory. Front. Plant Sci. 2022, 13, 1077229. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Liu, Q.; Zhou, Z.; Yin, H.; Xie, Y.; Wei, Y. Two Terpene Synthases in Resistant Pinus massoniana Contribute to Defence against Bursaphelenchus xylophilus. Plant Cell Environ. 2021, 44, 257–274. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Wang, W.; Chen, Y.; Zhao, Y.; Zhang, S.; Shi, F.; Khalil-Ur-Rehman, M.; Nieuwenhuizen, N.J. Transcriptomics and Antioxidant Analysis of Two Chinese Chestnut (Castanea mollissima BL.) Varieties Provides New Insights Into the Mechanisms of Resistance to Gall Wasp Dryocosmus kuriphilus Infestation. Front. Plant Sci. 2022, 13, 874434. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S.; Krueger, F.; Seconds-Pichon, A.; Biggins, F.; Wingett, S. FastQC. A Quality Control Tool for High Throughput Sequence DATA. Babraham Bioinformatics. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/%0Ahttp://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ (accessed on 6 February 2020).
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Trinity: Reconstructing a Full-Length Transcriptome without a Genome from RNA-Seq Data. Nat Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
- Raghavan, V.; Kraft, L.; Mesny, F.; Rigerte, L. A Simple Guide to de Novo Transcriptome Assembly and Annotation. Brief. Bioinform. 2022, 23, bbab563. [Google Scholar] [CrossRef]
- Seppey, M.; Manni, M.; Zdobnov, E.M. BUSCO: Assessing Genome Assembly and Annotation Completeness. Methods Mol. Biol. 2019, 1962, 227–245. [Google Scholar] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Cerveau, N.; Jackson, D.J. Combining Independent de Novo Assemblies Optimizes the Coding Transcriptome for Nonconventional Model Eukaryotic Organisms. BMC Bioinform. 2016, 17, 525. [Google Scholar] [CrossRef] [PubMed]
- Freedman, A.H.; Clamp, M.; Sackton, T.B. Error, Noise and Bias in de Novo Transcriptome Assemblies. Mol. Ecol. Resour. 2021, 21, 18–29. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.; Niu, B.; Zhu, Z.; Wu, S.; Li, W. CD-HIT: Accelerated for Clustering the next-Generation Sequencing Data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Bateman, A.; Birney, E.; Durbin, R.; Eddy, S.R.; Howe, K.L.; Sonnhammer, E.L.L. The Pfam Protein Families Database. Nucleic Acids Res. 2000, 28, 263–266. [Google Scholar] [CrossRef]
- Buchfink, B.; Reuter, K.; Drost, H.-G. Sensitive Protein Alignments at Tree-of-Life Scale Using DIAMOND. Nat Methods 2021, 18, 366–368. [Google Scholar] [CrossRef] [PubMed]
- Blum, M.; Chang, H.Y.; Chuguransky, S.; Grego, T.; Kandasaamy, S.; Mitchell, A.; Nuka, G.; Paysan-Lafosse, T.; Qureshi, M.; Raj, S.; et al. The InterPro Protein Families and Domains Database: 20 Years On. Nucleic Acids Res. 2021, 49, D344–D354. [Google Scholar] [CrossRef]
- Albà, M.M.; Castresana, J. On Homology Searches by Protein Blast and the Characterization of the Age of Genes. BMC Evol. Biol. 2007, 7, 53. [Google Scholar] [CrossRef]
- Aragón-Magadán, M.; Calvillo-Aguilar, F.; Cruz-Cardenas, C.; Guzmán, L. Optimized Method for Differential Gene Expression Analysis in Non-Model Species: Case of Cedrela odorata L. MethodsX 2023, 11, 102449. [Google Scholar] [CrossRef]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon Provides Fast and Bias-Aware Quantification of Transcript Expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing. In R Foundation for Statistical Computing; R Core Team: Vienna, Austria, 2018. [Google Scholar]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B (Methodol.) 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Ye, J.; Zhang, Y.; Cui, H.; Liu, J.; Wu, Y.; Cheng, Y.; Xu, H.; Huang, X.; Li, S.; Zhou, A.; et al. WEGO 2.0: A Web Tool for Analyzing and Plotting GO Annotations, 2018 Update. Nucleic Acids Res. 2018, 46, W71–W75. [Google Scholar] [CrossRef]
- War, A.R.; Paulraj, M.G.; Ahmad, T.; Buhroo, A.A.; Hussain, B.; Ignacimuthu, S.; Sharma, H.C. Mechanisms of Plant Defense against Insect Herbivores. Plant Signal. Behav. 2012, 7, 1306–1320. [Google Scholar] [CrossRef]
- Howe, G.A.; Jander, G. Plant Immunity to Insect Herbivores. Annu. Rev. Plant Biol. 2008, 59, 41–66. [Google Scholar] [CrossRef]
- Smith, C.M.; Boyko, E.V. The Molecular Bases of Plant Resistance and Defense Responses to Aphid Feeding: Current Status. Entomol. Exp. Appl. 2007, 122, 1–16. [Google Scholar] [CrossRef]
- Velázquez-Márquez, S.; De-la-Cruz, I.M.; Tapia-López, R.; Núñez-Farfán, J. Tropane Alkaloids and Terpenes Synthase Genes of Datura stramonium (Solanaceae). PeerJ 2021, 9, e11466. [Google Scholar] [CrossRef]
- Fürstenberg-Hägg, J.; Zagrobelny, M.; Bak, S. Plant Defense against Insect Herbivores. Int. J. Mol. Sci. 2013, 14, 10242–10297. [Google Scholar] [CrossRef]
- Kliebenstein, D.J. Secondary Metabolites and Plant/Environment Interactions: A View through Arabidopsis thaliana Tinged Glasses. Plant Cell Environ. 2004, 27, 675–684. [Google Scholar] [CrossRef]
- Schuman, M.C.; Baldwin, I.T. The Layers of Plant Responses to Insect Herbivores. Annu. Rev. Entomol. 2016, 61, 373–394. [Google Scholar] [CrossRef]
- Moghe, G.D.; Last, R.L. Something Old, Something New: Conserved Enzymes and the Evolution of Novelty in Plant Specialized Metabolism1. Plant Physiol. 2015, 169, 1512–1523. [Google Scholar] [CrossRef] [PubMed]
- Tholl, D. Biosynthesis and Biological Functions of Terpenoids in Plants. Adv. Biochem. Eng. Biotechnol. 2015, 148, 63–106. [Google Scholar] [CrossRef]
- Schuler, M.A.; Werck-Reichhart, D. Functional Genomics of P450s. Annu. Rev. Plant Biol. 2003, 54, 629–667. [Google Scholar] [CrossRef]
- Pandian, B.A.; Sathishraj, R.; Djanaguiraman, M.; Prasad, P.V.V.; Jugulam, M. Role of Cytochrome P450 Enzymes in Plant Stress Response. Antioxid. 2020, 9, 454. [Google Scholar] [CrossRef]
- Hu, L.; Zhang, X.; Ni, H.; Yuan, F.; Zhang, S. Identification and Functional Analysis of CAD Gene Family in Pomegranate (Punica granatum). Genes 2023, 14, 26. [Google Scholar] [CrossRef]
- Luan, S. Protein Phosphatases in Plants. Annu. Rev. Plant Biol. 2003, 54, 63–92. [Google Scholar] [CrossRef]
- Urao, T.; Yakubov, B.; Satoh, R.; Yamaguchi-Shinozaki, K.; Seki, M.; Hirayama, T.; Shinozaki, K. A Transmembrane Hybrid-Type Histidine Kinase in Arabidopsis Functions as an Osmosensor. Plant Cell 1999, 11, 1743–1754. [Google Scholar] [CrossRef] [PubMed]
- De Pinto, M.C.; Locato, V.; De Gara, L. Redox Regulation in Plant Programmed Cell Death. Plant Cell Environ. 2012, 35, 234–244. [Google Scholar] [CrossRef]
- Jin, Y.; Zhang, C.; Liu, W.; Tang, Y.; Qi, H.; Chen, H.; Cao, S. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns. Front. Plant Sci. 2016, 7, 670. [Google Scholar] [CrossRef] [PubMed]
- Heiling, S.; Schuman, M.C.; Schoettner, M.; Mukerjee, P.; Berger, B.; Schneider, B.; Jassbi, A.R.; Baldwin, I.T. Jasmonate and ppHsystemin Regulate Key Malonylation Steps in the Biosynthesis of 17-Hydroxygeranyllinalool Diterpene Glycosides, an Abundant and Effective Direct Defense against Herbivores in Nicotiana Attenuata. Plant Cell 2010, 22, 273–292. [Google Scholar] [CrossRef] [PubMed]
- Jancewicz, A.L.; Gibbs, N.M.; Masson, P.H. Cadaverine’s Functional Role in Plant Development and Environmental Response. Front. Plant Sci. 2016, 7, 870. [Google Scholar] [CrossRef] [PubMed]
- Bunsupa, S.; Katayama, K.; Ikeura, E.; Oikawa, A.; Toyooka, K.; Saito, K.; Yamazaki, M. Lysine Decarboxylase Catalyzes the First Step of Quinolizidine Alkaloid Biosynthesis and Coevolved with Alkaloid Production in Leguminosae[W][OA]. Plant Cell 2012, 24, 1202–1216. [Google Scholar] [CrossRef]
- Erb, M.; Kliebenstein, D.J. Plant Secondary Metabolites as Defenses, Regulators, and Primary Metabolites: The Blurred Functional Trichotomy1[OPEN]. Plant Physiol 2020, 184, 39–52. [Google Scholar] [CrossRef] [PubMed]
- Matsubayashi, Y.; Yang, H.; Sakagami, Y. Peptide Signals and Their Receptors in Higher Plants. Trends Plant Sci. 2001, 6, 573–577. [Google Scholar] [CrossRef] [PubMed]
- Bruessow, F.; Gouhier-Darimont, C.; Buchala, A.; Metraux, J.-P.; Reymond, P. Insect Eggs Suppress Plant Defence against Chewing Herbivores. Plant J. 2010, 62, 876–885. [Google Scholar] [CrossRef] [PubMed]
- Bruinsma, M.; van Broekhoven, S.; Poelman, E.H.; Posthumus, M.A.; Müller, M.J.; van Loon, J.J.A.; Dicke, M. Inhibition of Lipoxygenase Affects Induction of Both Direct and Indirect Plant Defences against Herbivorous Insects. Oecologia 2010, 162, 393–404. [Google Scholar] [CrossRef] [PubMed]
- Zhu-Salzman, K.; Zeng, R. Insect Response to Plant Defensive Protease Inhibitors. Annu. Rev. Entomol. 2015, 60, 233–252. [Google Scholar] [CrossRef]
- Alicandri, E.; Paolacci, A.R.; Osadolor, S.; Sorgonà, A.; Badiani, M.; Ciaffi, M. On the Evolution and Functional Diversity of Terpene Synthases in the Pinus Species: A Review; Springer US: New York, NY, USA, 2020; Volume 88, ISBN 0-12-345678-9. [Google Scholar]
- Jia, Q.; Brown, R.; Köllner, T.G.; Fu, J.; Chen, X.; Ka-Shu Wong, G.; Gershenzon, J.; Peters, R.J.; Chen, F. Origin and Early Evolution of the Plant Terpene Synthase Family. Proc. Natl. Acad. Sci. USA 2022, 119, e2100361119. [Google Scholar] [CrossRef]
- Camargo, P.O.; Calzado, N.F.; Budzinski, I.G.F.; Domingues, D.S. Genome-Wide Analysis of Lipoxygenase (LOX) Genes in Angiosperms. Plants 2023, 12, 398. [Google Scholar] [CrossRef] [PubMed]
- Viswanath, K.K.; Varakumar, P.; Pamuru, R.R.; Basha, S.J.; Mehta, S.; Rao, A.D. Plant Lipoxygenases and Their Role in Plant Physiology. J. Plant Biol. 2020, 63, 83–95. [Google Scholar] [CrossRef]
- Zhang, Z.; Xing, Y.; Ramakrishnan, M.; Chen, C.; Xie, F.; Hua, Q.; Chen, J.; Zhang, R.; Zhao, J.; Hu, G.; et al. Transcriptomics-based Identification and Characterization of Genes Related to Sugar Metabolism in ‘Hongshuijing’ Pitaya. Hortic. Plant J. 2022, 8, 450–460. [Google Scholar] [CrossRef]
- Lin, L.; Wu, J.; Jiang, M.; Wang, Y. Molecular Sciences Plant Mitogen-Activated Protein Kinase Cascades in Environmental Stresses. Int. J. Mol. Sci. 2021, 22, 1543. [Google Scholar] [CrossRef]
Gene | Secuence (5′-3′) | Amplicon Size (bp) | |
---|---|---|---|
TERS | Forward: | TGTGGACTTGAGTTTGCAGC | 202 |
Reverse: | TCAAAATGCCCTGTGGTGTG | ||
LIPO1 | Forward: | GCGTCTCTCATCAATGCAGG | 204 |
Reverse: | AGCTGGTGGAGGAAAAGTCA | ||
MAPK | Forward: | TAGACAAGGGGCATCCTCTG | 150 |
Reverse: | CCCGAATGTGATTTCCCTTA | ||
UBC | Forward: | AATCGGAAGAACCGCCATGT | 175 |
Reverse: | GAACGTACCTCCGTCCCAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guzmán, L.F.; Tirado, B.; Cruz-Cárdenas, C.I.; Rojas-Anaya, E.; Aragón-Magadán, M.A. De Novo Transcriptome Assembly of Cedar (Cedrela odorata L.) and Differential Gene Expression Involved in Herbivore Resistance. Curr. Issues Mol. Biol. 2024, 46, 8794-8806. https://doi.org/10.3390/cimb46080520
Guzmán LF, Tirado B, Cruz-Cárdenas CI, Rojas-Anaya E, Aragón-Magadán MA. De Novo Transcriptome Assembly of Cedar (Cedrela odorata L.) and Differential Gene Expression Involved in Herbivore Resistance. Current Issues in Molecular Biology. 2024; 46(8):8794-8806. https://doi.org/10.3390/cimb46080520
Chicago/Turabian StyleGuzmán, Luis Felipe, Bibiana Tirado, Carlos Iván Cruz-Cárdenas, Edith Rojas-Anaya, and Marco Aurelio Aragón-Magadán. 2024. "De Novo Transcriptome Assembly of Cedar (Cedrela odorata L.) and Differential Gene Expression Involved in Herbivore Resistance" Current Issues in Molecular Biology 46, no. 8: 8794-8806. https://doi.org/10.3390/cimb46080520