Identification and Expression Analysis of bZIP Members under Abiotic Stress in Mung Bean (Vigna radiata)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Treatment
2.2. Identification and Bioinformatics Analysis of bZIP Family Genes in Mung Bean
2.3. Phylogeny of bZIP Proteins in Mung Bean and Arabidopsis Thaliana
2.4. Identification and Bioinformatics Analysis of bZIP Family Genes in Mung BeanRNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis
2.5. Expression Analysis of bZIP Genes in Mung Bean Leaves under Salt Stress
3. Results
3.1. Identification and Physicochemical Property Analysis of bZIP Family Members in Mung Bean
3.2. Phylogenetic Analysis of bZIP Family Proteins in Mung Bean
3.3. Analysis of Conserved Motif and Gene Structure of bZIP Proteins in Mung Bean
3.4. Analysis of Promoter Cis-Acting Elements of bZIP Genes in Mung Bean
3.5. Analysis of Expression Patterns of bZIP Genes in Mung Bean under Salt Stress
3.6. Screening and Metabolic Pathway Analysis of Differentially Expressed bZIP Genes in Mung Bean under Salt Stress
3.7. Responses of bZIP Genes to Abiotic Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, J.; Chen, N.; Chen, F.; Cai, B.; Santo, S.D.; Tornielli, G.B.; Pezzotti, M.; Cheng, Z.M. Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera). BMC Genom. 2014, 15, 281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, K.B.; Foley, R.C.; Luis, O.-S. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef]
- Balogu, M.C.; Eldem, V.; Haijyzadeh, M.; Unver, T. Genome-wide analysis of the bZIP transcription factors in cucumber. PLoS ONE 2014, 9, e96014. [Google Scholar]
- Wei, K.; Chen, J.; Wang, Y.; Chen, Y.; Chen, S.; Lin, Y.; Pan, S.; Zhong, X.; Xie, D. Genome-wide analysis of bZIP-encoding genes in maize. DNA Res. 2012, 19, 463–476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, D.; Fu, F.; Zhang, H.; Song, F. Genome-wide systematic characterization of the bZIP transcriptional factor family in tomato (Solanum lycopersicum L.). BMC Genom. 2015, 16, 771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jakoby, M.; Weisshaar, B.; Droge-Laser, W.; Vicente-Carbajosa, J.; Tiedemann, J.; Kroj, T.; Parcy, F. bZIP transcription factors in Arabidopsis. Trends Plant Sci. 2002, 7, 106–111. [Google Scholar] [CrossRef]
- Wolfgang, D.L.; Snoek, B.L.; Berend, S.; Christoph, W. The Arabidopsis bZIP transcription factor family—An update. Curr. Opin. Plant Biol. 2018, 45, 36–49. [Google Scholar]
- Guan, Y.; Ren, H.; Xie, H.; Ma, Z.; Chen, F. Identification and characterization of bZIP-type transcription factors involved in carrot (Daucus carota L.) somatic embryogenesis. Plant J. 2010, 60, 207–217. [Google Scholar] [CrossRef]
- Alonso, R.; Onate-Sanchez, L.; Weltmeier, F.; Ehlert, A.; Diaz, I.; Dietrich, K.; Vicente-Carbajosa, J.; Droge-Laser, W. A pivotal role of the basic leucine zipper transcription factor bZIP53 in the regulation of Arabidopsis seed maturation gene expression based on heterodimerization and protein complex formation. Plant Cell 2009, 21, 1747–1761. [Google Scholar] [CrossRef] [Green Version]
- Zinsmeister, J.; Lalanne, D.; Terrasson, E.; Chatelain, E.; Vandecasteele, C.; Vu, B.L.; Dubois-Laurent, C.; Geoffriau, E.; Le Signor, C.; Dalmais, M. ABI5 is a regulator of seed maturation and longevity in legumes. Plant Cell 2016, 28, 2735–2754. [Google Scholar] [CrossRef] [Green Version]
- Thurow, C.; Schiermeyer, A.; Krawczyk, S.; Butterbrodt, T.; Nickolov, K.; Gatz, C. Tobacco bZIP transcription factor TGA2.2 and related factor TGA2.1 have distinct roles in plant defense responses and plant development. Plant J. Cell Mol. Biol. 2005, 44, 100–113. [Google Scholar] [CrossRef]
- Silveira, A.B.; Gauer, L.; Tomaz, J.P.; Cardoso, P.R.; Carmello-Guerreiro, S.; Vincentz, M. The Arabidopsis AtbZIP9 protein fused to the VP16 transcriptional activation domain alters leaf and vascular development. Plant Sci. 2007, 172, 1148–1156. [Google Scholar] [CrossRef]
- Hu, W.; Yang, H.; Yan, Y.; Wei, Y.; Tie, W.; Ding, Z.; Zuo, J.; Peng, M.; Li, K. Genome-wide characterization and analysis of bZIP transcription factor gene family related to abiotic stress in cassava. Sci. Rep. 2016, 6, 22783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.T.; Ou, S.J.; Mao, B.G.; Tang, J.Y.; Wang, W.; Wang, H.G.; Cao, S.Y.; Schlappi, M.R.; Zhao, B.Z.; Xiao, G.Y.; et al. Early selection of bZIP73 facilitated adaptation of japonica rice to cold climates. Nat. Commun. 2018, 9, 3302. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. ER-Anchored transcription factors bZIP17 and bZIP28 regulate root elongation. Plant Physiol. 2018, 176, 2221–2230. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.; Yu, T.F.; Maj, J.; Chen, J.; Zhou, Y.B.; Chen, M.; Ma, Y.Z.; Wei, W.L.; Xu, Z.S. The soybean bZIP transcription factor gene GmbZIP2 confers drought and salt resistances in transgenic plants. Int. J. Mol. Sci. 2020, 21, 670. [Google Scholar] [CrossRef] [Green Version]
- Nijhawan, A.; Jain, M.; Tyagi, A.K.; Khurana, J.P. Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice. Plant Physiol. 2008, 146, 333–350. [Google Scholar] [CrossRef] [Green Version]
- Vanitha, J.; Ramachandran, S. Genome-wide expansion and expression divergence of the basic leucine zipper transcription factors in higher plants with an emphasis on sorghum. J. Integr. Plant Biol. 2011, 53, 212–231. [Google Scholar]
- Liu, X.; Chu, Z.Q. Genome-wide evolutionary characterization and analysis of bZIP transcription factors and their expression profiles in response to multiple abiotic stresses in Brachypodium distachyon. BMC Genom. 2015, 16, 227. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.H.; Cheng, K.; Wan, L.Y.; Yan, L.Y.; Jiang, H.F.; Liu, S.Y.; Lei, Y.; Liao, B.S. Genome-wide analysis of the basic leucine zipper (bZIP) transcription factor gene family in six legume genomes. BMC Genom. 2015, 16, 1053. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Xia, R. TBtools-an integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Bi, C.X.; Yang, Y.X.; Yu, Y.H.; Li, D.P.; Shi, F.; Ma, L.; Kong, X.Y.; Zhang, L.C.; Ni, Z.Y. Identification of bZIP Family Transcription Factors of Wheat and Expression Analysis under Salt Stress. Mol. Plant Breed. 2021, 19, 4887–4895. (In Chinese) [Google Scholar]
- Lu, P.; Wu, Y.M.; Wu, Q.Q.; Li, X.Y. Genome-wide Identification and Bioinformatics Analysis of Setaria italica bZIP Transcription Factor Family. J. Shanxi Agric. Sci. 2020, 48, 1361–1370. (In Chinese) [Google Scholar]
- Khaled, M.; Bahman, B.; Soheila, F. Genome-wide identification and characterization of the bZIP gene family in potato (Solanum tuberosum). Plant Gene 2020, 24, 100257. [Google Scholar]
- Long, M.Y.; Rosenberg, C.; Gilbert, W. Intron phase correlations and the evolution of the intron/exon structure of genes. Proc. Natl. Acad. Sci. USA 1996, 92, 12495–12499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rogozin, I.B.; Sverdlov, A.V.; Babenko, V.N.; Koonin, E.V. Analysis of evolution of exon-intron structure of eukaryotic genes. Brief. Bioinform. 2005, 6, 118–134. [Google Scholar] [CrossRef] [Green Version]
- Del Campo, E.M.; Casano, L.M.; Barreno, E. Evolutionary implications of intron-exon distribution and the properties and sequences of the RPL10A gene in eukaryotes. Mol. Phylogenet. Evol. 2013, 66, 857–867. [Google Scholar] [CrossRef]
- Lynch, M. Intron evolution as a population-genetic process. Proc. Natl. Acad. Sci. USA 2002, 99, 6118–6123. [Google Scholar] [CrossRef] [Green Version]
- Hsieh, T.; Li, C.W.; Su, R.C.; Cheng, C.P.; Tsai, Y.C.; Chan, M.T. A tomato bZIP transcription factor, SlAREB, is involved in water deficit and salt stress response. Planta 2010, 231, 1459–1473. [Google Scholar] [CrossRef]
- Liu, C.T.; Mao, B.G.; Ou, S.J.; Wang, W.; Liu, L.C.; Wu, Y.B.; Chu, C.C.; Wang, X.P. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol. Biol. 2014, 84, 19–36. [Google Scholar] [CrossRef]
- Wang, Y.C.; Gao, C.Q.; Liang, Y.N.; Wang, C.; Yang, C.P.; Liu, G.F. A novel bZIP gene from Tamarix hispida mediates physiological responses to salt stress in tobacco plants. J. Plant Physiol. 2010, 167, 222–230. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Lu, G.; Hao, Y.; Guo, H.; Guo, Y.; Zhao, J.; Cheng, H. ABP9, a maize bZIP transcription factor, enhances tolerance to salt and drought in transgenic cotton. Planta 2017, 246, 453–469. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.G.; Lu, X.K.; Malik, W.A.; Chen, X.G.; Wang, J.J.; Wang, D.L.; Wang, S.; Chen, C.; Guo, L.X.; Ye, W.W. Differentially expressed bZIP transcription factors confer multi-tolerances in Gossypium hirsutum L. Int. J. Biol. Macromol. 2020, 146, 569–578. [Google Scholar] [CrossRef]
- Li, P.; Zheng, T.; Li, L.; Wang, J.; Cheng, T.; Zhang, Q. Genome-wide investigation of the bzip transcription factor gene family in prunus mume:classification, evolution, expression profile and low-temperature stress responses. Hortic. Plant J. 2022, 8, 13. [Google Scholar] [CrossRef]
- Garay Farías, L.B.; Litwiniuk, S.; Rojas, C.A. In silico analysis of the entire p. glaucum genome identifies regulatory genes of the bzip family modulated in response pathways to water stress. Am. J. Plant Sci. 2022, 13, 17. [Google Scholar]
- Dayer, S.; Scharwies, J.D.; Ramesh, S.A.; Sullivan, W.; Tyerman, S.D. Comparing hydraulics between two grapevine cultivars reveals differences in stomatal regulation under water stress and exogenous aba applications. Front. Plant Sci. 2020, 11, 705. [Google Scholar] [CrossRef]
- Vysotskii, D.A.; Leeuwen, V.V.; Souer, E.; Babakov, A.V.; Boer, A.H.D. ABF transcription factors of Thellungiella salsuginea. Plant Signal Behav. 2013, 8, e22672. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.L.; Zhu, W.B.; Hu, X.C.; Sun, C.C.; Li, Y.L.; Wang, D.D.; Wang, Q.H.; Pei, G.L.; Zhang, Y.F.; Guo, A.G.; et al. Genome-wide analysis of the bZIP gene family identifies two ABI5-Like bZIP transcription factors, BrABI5a and BrABI5b, as positive modulators of ABA signalling in Chinese cabbage. PLoS ONE 2016, 11, e0158966. [Google Scholar] [CrossRef]
- Uno, Y.; Furihata, T.; Abe, H.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 11632–11637. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
---|---|---|
VrbZIP11 | CCGACTCTTCACTCTGATCCC | CCTGCTCTACCTCCATGGGT |
VrbZIP34 | CCGAGTGCTATCCAGCAAAGT | ATGCCATCATTGCCTGAACC |
VrbZIP39 | GGCAGATTGGAGGATCTCTGG | TGGGAGAGTTGATGGTTTAGTGT |
VrbZIP45 | AGACCGTCGATGATGTCTGG | CGTGAGGGGCATTGGAATCT |
VrbZIP46 | ACACTCCGACCCCTCCTATC | GGTCTGCTCGTTGGGTTTCT |
VrbZIP49 | ACCCTGCAGTTGCTATTGGG | GCCTATTGACATTGCAAGCCC |
VrbZIP55 | TTCTGCGTCTACTCCGATTCC | GCCAGTACAGCATCCTCAGAT |
VrbZIP68 | CCTTCTCAAGTCCATCACCCC | GGTAATAGCCTCGTAGCCCTC |
Tubulin | GATCTTCCGTCCCGACAACT | AATGGCACACCTGAAACCCT |
Gene Number | Gene ID | Structural Domain (aa) | Chromosomal Location (bp) | CDS | Exon Number | Size (aa) | Molecular Weight (D) | PI |
---|---|---|---|---|---|---|---|---|
VrbZIP1 | XM_022785227.1 | 203–248 | Chr1:13412935..13419247 | 822 | 5 | 273 | 30,455.24 | 8.77 |
VrbZIP2 | XM_014666014.2 | 83–134 | Chr1:20775274..20780375 | 1107 | 9 | 368 | 42,188.04 | 6.57 |
VrbZIP3 | XM_014647274.2 | 175–224 | Chr1:25617463..25621921 | 993 | 4 | 330 | 35,793.95 | 6.78 |
VrbZIP4 | XM_014638991.2 | 84–150 | Chr2:2684648..2687499 | 810 | 5 | 269 | 29,320.88 | 6.01 |
VrbZIP5 | XM_014639166.2 | 32–82 | Chr2:3014129..3015546 | 465 | 1 | 154 | 17,267.41 | 6.84 |
VrbZIP6 | XM_014663463.2 | 155–204 | Chr2:3749253..3753899 | 1026 | 5 | 341 | 38,643.78 | 5.99 |
VrbZIP7 | XM_014636031.2 | 186–237 | Chr2:7950275..7957099 | 1470 | 13 | 489 | 53,507.07 | 6.38 |
VrbZIP8 | XM_022775778.1 | 41–105 | Chr2:14961045..14964275 | 369 | 6 | 122 | 13,714.35 | 9.13 |
VrbZIP9 | XM_014638786.2 | 78–128 | Chr2:23139450..23144442 | 1104 | 12 | 367 | 41,473.32 | 7.73 |
VrbZIP10 | XM_022779041.1 | 194–243 | Chr3:16198..23320 | 1458 | 12 | 485 | 54,430.47 | 8.49 |
VrbZIP11 | XM_014640107.2 | 221–272 | Chr3:5971446..5976295 | 1659 | 6 | 552 | 61,659.10 | 5.80 |
VrbZIP12 | XM_014640035.2 | 313–367 | Chr3:6059100..6062822 | 1203 | 5 | 400 | 44,224.20 | 7.83 |
VrbZIP13 | XM_014639652.2 | 24–75 | Chr3:7927174..7928408 | 435 | 1 | 144 | 16,286.58 | 7.87 |
VrbZIP14 | XM_022779735.1 | 318–365 | Chr4:7175101..7177404 | 1224 | 5 | 407 | 46,183.31 | 5.13 |
VrbZIP15 | XM_014641492.2 | 185–235 | Chr4:7182698..7189623 | 1467 | 15 | 488 | 54,141.83 | 6.58 |
VrbZIP16 | XM_014642005.2 | 108–158 | Ch4:7834772..7844639 | 534 | 5 | 177 | 19,966.18 | 9.12 |
VrbZIP17 | XM_014641874.2 | 85–136 | Chr4:18764913..18765929 | 588 | 1 | 195 | 22,548.07 | 5.97 |
VrbZIP18 | XM_022779549.1 | 120–161 | Chr4:19550873..19555055 | 570 | 4 | 189 | 21,465.04 | 9.83 |
VrbZIP19 | XM_014644694.2 | 95–144 | Chr5:8962527..8967419 | 867 | 5 | 288 | 32,103.78 | 5.58 |
VrbZIP20 | XM_014644285.2 | 197–232 | Chr5:17387640..17392584 | 1053 | 6 | 350 | 38,434.06 | 6.00 |
VrbZIP21 | XM_014646167.2 | 67–119 | Chr5:19622815..19625932 | 1059 | 9 | 352 | 39,743.44 | 7.07 |
VrbZIP22 | XM_014644924.2 | 32–82 | Chr5:22507881..22509023 | 438 | 1 | 145 | 16,748.77 | 6.73 |
VrbZIP23 | XM_014645143.2 | 82–134 | Chr5:23096405..23098352 | 456 | 3 | 151 | 16,753.15 | 9.94 |
VrbZIP24 | XM_022781035.1 | 125–170 | Chr5:23101214..23107044 | 525 | 5 | 174 | 19,384.65 | 9.91 |
VrbZIP25 | XM_014644219.2 | 31–81 | Chr5:23895707..23896990 | 486 | 1 | 161 | 17,921.00 | 2.42 |
VrbZIP26 | XM_022781264.1 | 87–146 | Chr5:27052325..27054044 | 753 | 1 | 250 | 27,593.56 | 6.45 |
VrbZIP27 | XM_014644051.1 | 85–130 | Chr5:32963429..32964608 | 468 | 3 | 155 | 18,058.3 | 9.76 |
VrbZIP28 | XM_014643422.2 | 185–235 | Chr5:36130216..36133900 | 1008 | 4 | 335 | 37,231.73 | 7.13 |
VrbZIP29 | XM_014647356.2 | 195–244 | Chr6:8284132..8287012 | 1179 | 4 | 392 | 42,404.86 | 6.17 |
VrbZIP30 | XM_014648236.2 | 147–198 | Chr6:22056898..22061393 | 930 | 5 | 309 | 33,621.12 | 5.52 |
VrbZIP31 | XM_014648797.2 | 58–107 | Chr6:34234862..34235691 | 432 | 1 | 143 | 16,954.40 | 10.00 |
VrbZIP32 | XM_014649544.2 | 397–469 | Chr6:37159446..37162882 | 1659 | 4 | 552 | 60,573.71 | 7.68 |
VrbZIP33 | XM_014649426.2 | 25–75 | Chr6:37413761..37414807 | 447 | 1 | 148 | 17,238.53 | 9.88 |
VrbZIP34 | XM_014654477.1 | 256–320 | Chr7:1009773..1015431 | 1017 | 13 | 338 | 35,872.42 | 5.61 |
VrbZIP35 | XM_022784411.1 | 126–170 | Chr7:2596882..2598280 | 588 | 3 | 195 | 22,141.67 | 9.96 |
VrbZIP36 | XM_014654593.2 | 277–341 | Chr7:3911347..3918361 | 978 | 13 | 325 | 34,708.98 | 6.18 |
VrbZIP37 | XM_022783046.1 | 335–359 | Chr7:7218005..7221483 | 1113 | 7 | 370 | 40,329.16 | 9.75 |
VrbZIP38 | XM_014652907.2 | 67–118 | Chr7:29027489..29028876 | 516 | 1 | 171 | 19,912.60 | 9.56 |
VrbZIP39 | XM_022783646.1 | 28–76 | Chr7:39214969..39218506 | 405 | 3 | 134 | 15,177.45 | 10.17 |
VrbZIP40 | XM_022785077.1 | 203–255 | Chr8:3177802..3184606 | 1485 | 13 | 494 | 55,564.89 | 8.45 |
VrbZIP41 | XM_014656816.2 | 126–176 | Chr8:4647521..4650104 | 852 | 3 | 283 | 32,145.49 | 4.99 |
VrbZIP42 | XM_022784953.1 | 339–393 | Chr8:11690917..11695588 | 1296 | 5 | 431 | 47,609.15 | 8.76 |
VrbZIP43 | XM_014656646.2 | 24–74 | Chr8:28860359..28861556 | 450 | 1 | 149 | 16,846.00 | 5.17 |
VrbZIP44 | XM_014658810.2 | 224–275 | Chr8:32908849..32915369 | 1278 | 6 | 425 | 45,352.42 | 5.56 |
VrbZIP45 | XM_014658845.2 | 160–206 | Chr8:39715305..39718710 | 723 | 7 | 240 | 26,862.45 | 5.77 |
VrbZIP46 | XM_014657502.2 | 166–217 | Chr8:39904582..39909649 | 996 | 4 | 331 | 36,551.30 | 6.22 |
VrbZIP47 | XM_014657576.2 | 175–222 | Chr8:43736639..43740175 | 1389 | 11 | 462 | 51,367.35 | 5.87 |
VrbZIP48 | XM_014658700.2 | 159–211 | Chr8:45394513..45403111 | 1335 | 13 | 444 | 49,199.02 | 5.76 |
VrbZIP49 | XM_022786075.1 | 280–343 | Chr9:4847038..4851468 | 1278 | 13 | 425 | 45,488.38 | 6.13 |
VrbZIP50 | XM_014661380.2 | 181–218 | Chr10:12460328..12462574 | 1041 | 6 | 346 | 38,098.65 | 8.24 |
VrbZIP51 | XM_022787071.1 | 79–125 | Chr10:20273437..20275469 | 480 | 5 | 159 | 18,946.57 | 9.65 |
VrbZIP52 | XM_014665009.2 | 76–127 | Chr11:3702486..3703453 | 525 | 1 | 174 | 20,395.12 | 10.23 |
VrbZIP53 | XM_022775736.1 | 126–180 | Chr11:6665593..6667255 | 588 | 3 | 195 | 21,724.44 | 9.61 |
VrbZIP54 | XM_014665463.2 | 301–365 | Chr11:9335409..9346704 | 1221 | 14 | 406 | 43,311.45 | 5.90 |
VrbZIP55 | XM_022787574.1 | 213–263 | Chr11:16235928..16242653 | 888 | 12 | 295 | 33,681.97 | 5.67 |
VrbZIP56 | XM_014664829.2 | 85–136 | Chr11:17665574..17666561 | 591 | 1 | 196 | 22,601.39 | 5.73 |
VrbZIP57 | XM_022775592.1 | 178–230 | Chr11:18570078..18573912 | 1251 | 11 | 416 | 46,556.78 | 8.85 |
VrbZIP58 | XM_014666437.2 | 222–271 | Un:200900..204545 | 1269 | 5 | 422 | 45,733.68 | 6.02 |
VrbZIP59 | XM_022776281.1 | 201–243 | Un:338441..342976 | 834 | 7 | 277 | 30,704.20 | 8.63 |
VrbZIP60 | XM_014666719.2 | 84–135 | Un:100382..101241 | 603 | 1 | 200 | 23,348.69 | 6.35 |
VrbZIP61 | XM_014667969.2 | 31–79 | Un:751945..753186 | 480 | 1 | 159 | 17,967.15 | 5.25 |
VrbZIP62 | XM_014668844.2 | 407–458 | Un:82484..86411 | 1686 | 6 | 561 | 61,233.58 | 6.40 |
VrbZIP63 | XM_022777041.1 | 78–130 | Un:2899..7283 | 1110 | 9 | 369 | 41,858.61 | 6.09 |
VrbZIP64 | XM_014668893.2 | 216–266 | Un:732692..736307 | 1044 | 5 | 347 | 39,271.21 | 5.48 |
VrbZIP65 | XM_014669108.2 | 182–234 | Un:539901..550192 | 1404 | 14 | 467 | 51,734.69 | 5.85 |
VrbZIP66 | XM_014634139.2 | 185–234 | Un:836261..839909 | 1152 | 4 | 383 | 41,168.21 | 5.69 |
VrbZIP67 | XM_014634274.2 | 158–210 | Un:36374..42709 | 1332 | 13 | 443 | 49,224.19 | 8.85 |
VrbZIP68 | XM_014634567.2 | 167–207 | Un:459429..462604 | 690 | 4 | 229 | 24,935.03 | 6.61 |
VrbZIP69 | XM_014634801.2 | 242–293 | Un:339325..343251 | 954 | 7 | 317 | 34,504.7 | 5.36 |
VrbZIP70 | XM_014635820.2 | 277–328 | Un:551612..555030 | 2337 | 2 | 778 | 84,495.52 | 5.51 |
VrbZIP71 | XM_014635912.2 | 246–291 | Un:1137071..1141720 | 951 | 3 | 316 | 35,017.23 | 6.77 |
VrbZIP72 | XM_022777814.1 | 281–344 | Un:765888..774164 | 1134 | 18 | 377 | 40,660.25 | 8.56 |
VrbZIP73 | XM_014636225.2 | 194–244 | Un:1420575..1423756 | 939 | 4 | 312 | 35,868.76 | 6.03 |
VrbZIP74 | XM_014636721.2 | 267–312 | Un:83487..88340 | 1014 | 4 | 337 | 37,124.07 | 6.87 |
VrbZIP75 | XM_014637147.1 | 214–258 | Un:53900..69849 | 990 | 3 | 329 | 37,431.81 | 6.86 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, W.; Ye, S.; Du, Y.; Zhao, Q.; Du, J.; Zhang, Q. Identification and Expression Analysis of bZIP Members under Abiotic Stress in Mung Bean (Vigna radiata). Life 2022, 12, 938. https://doi.org/10.3390/life12070938
Zhang W, Ye S, Du Y, Zhao Q, Du J, Zhang Q. Identification and Expression Analysis of bZIP Members under Abiotic Stress in Mung Bean (Vigna radiata). Life. 2022; 12(7):938. https://doi.org/10.3390/life12070938
Chicago/Turabian StyleZhang, Wenhui, Shijia Ye, Yanli Du, Qiang Zhao, Jidao Du, and Qi Zhang. 2022. "Identification and Expression Analysis of bZIP Members under Abiotic Stress in Mung Bean (Vigna radiata)" Life 12, no. 7: 938. https://doi.org/10.3390/life12070938