Next Article in Journal
Sap Flow Density of the Prevailing Tree Species in a Hemiboreal Forest under Contrasting Meteorological and Growing Conditions
Previous Article in Journal
Does Host-Guest Interaction Stimulate Tourists’ Citizenship Behavior? A Combination of Social Exchange Theory and Cognitive Appraisal Theory
Previous Article in Special Issue
Effects of Antheraea pernyi on Parasitization of Kriechbaumerella dendrolimi by Using Immunology and Metabolomics
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 15
Issue 7
10.3390/f15071157
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Characterization of Abdominal-A in the Pine Caterpillar Moth, Dendrolimus punctatus

by
Huihui Liu
1,*,
Lin Chen
1,
Qinghua Ma
1,
Xinghong Wang
1,
Sufang Zhang
2,* and
Xuguo Zhou
3,*
1
National Permanent Scientific Research Base for Warm Temperate Zone Forestry of Jiulong Mountain in Beijing, Experimental Center of Forestry in North China, Chinese Academy of Forestry, Beijing 102300, China
2
Key Laboratory of Forest Protection of National Forestry and Grassland Administration, Ecology and Nature Conservation Institute, Chinese Academy of Forestry, Beijing 100091, China
3
Department of Entomology, School of Integrative Biology, College of Liberal Arts & Sciences, University of Illinois Urbana-Champaign, Urbana, IL 61801, USA
*
Authors to whom correspondence should be addressed.
Forests 2024, 15(7), 1157; https://doi.org/10.3390/f15071157
Submission received: 5 June 2024 / Revised: 29 June 2024 / Accepted: 1 July 2024 / Published: 3 July 2024
(This article belongs to the Special Issue Advances in Biological Control of Forest Diseases and Pests)
Browse Figures
Review Reports Versions Notes

Abstract

:
Hox genes, specifically the bithorax complex (ubx, abdominal-a, and abdominal-b), play a crucial role in specifying posterior abdominal development and serve as key regulators of germline gene development in insects. However, the function of the bithorax complex in the pine caterpillar moth, Dendrolimus punctatus, a major pine tree defoliator in China, remains largely unknown. Specifically, Abdominal-A (Abd-a) controls regional variation in abdominal segmentation in model insects such as Drosophila and Tribolium; however, its role in D. Punctatus remains unexplored. In this study, CRISPR/Cas9 was used to functionally characterize Abd-a in D. punctatus. Two target sites were selected, and the genotypes and phenotypes of the G0 and G1 generations were evaluated. Our findings indicate that knocking out Abd-a led to an abnormality in the posterior segments A2–A7, as well as the loss of appendages, mainly prolegs, and affected the thoracic T3 segmentation as well as wing development. Moreover, mutation in Abd-a also impacted anal and reproductive development. Taken together, these results demonstrate that DpAbd-a is essential for embryonic and reproductive development in D. punctatus and could be a promising target for genetic control of this devastating conifer defoliator.

1. Introduction

Dendrolimus punctatus, widely known as the pine caterpillar moth, poses a significant threat to conifer forests in Southeast China. Its periodic outbreaks have resulted in substantial damage, affecting hundreds of thousands of hectares of pine trees, and resulting in economic losses of USD tens of millions [1,2]. The moth’s wide distribution in mountainous regions has rendered conventional methods challenging, while the use of chemical pesticides can be detrimental to beneficial insects and other organisms, ultimately leading to the erosion of biodiversity. This underscores the need for environmentally sustainable and species-specific pest management approaches. In recent years, RNA interference (RNAi) has gained significant attention as a species-specific promising strategy for pest control. Unlike traditional chemical pesticides, RNAi is highly specific and precise, targeting only pest genes without harming other organisms. Additionally, its durability and non-residual nature ensure long-term pest control, while minimizing the environmental impact [3,4,5,6,7]. RNAi has shown promising results in managing various pests, including flies (Drosophila melanogaster), mosquitos (genera Anopheles, Aedes, and Culex), armyworms (Spodoptera frugiperda), and cotton bollworms (Helicoverpa armigera) [8,9,10,11]. With the advent of nanoparticle-mediated RNAi technology, these strategies have become even more effective, enabling targeted delivery of RNAi triggers to pest species [12]. Successful assessments of RNAi technology using nanoparticle-SPc coatings have been conducted in pests like the planthopper Sogatella furcifera, targeting genes such as Abd-a [9]. These studies demonstrate the potential of RNAi technology in pest management. Therefore, the functional characterization of critical genes like Abd-a in D. punctatus is crucial for advancing RNAi-based pest control strategies and developing effective methods to manage this destructive pest (Figure 1).
Arthropod embryogenesis, encompassing a diverse range of invertebrate organisms, is governed by intricate developmental processes. Among these, segmentation stands as a pivotal event that shapes the fundamental body plan of the organism. Despite extensive research, the mechanisms underlying the variation in segmental patterning remain incompletely understood [13,14,15]. In insects, the long germ segmentation model has garnered significant attention due to its unique developmental paradigm. This model, extensively studied in the model organism Drosophila, outlines a synchronous process, where all segments are established simultaneously during the early blastoderm stage [15,16,17,18]. This intricate cascade involves maternal gradients, zygotic gap genes, pair rule genes, segmentation genes, and, ultimately, homeotic (Hox) genes, which orchestrate the segmental patterning. Of particular interest are the Hox genes, which occupy a pivotal position in determining the morphology, appendage number, and distribution of the segments present in all holometabolous insects [14]. These genes are arranged in two complexes: the antennapedia (ANT-C) and bithorax (BX-C) complexes. These complexes specify segmental refinement along the anteroposterior (A-P) body axis, providing positional information that guides cell fate determination [19]. Within the BX-C complex, Ultrabithorax (Ubx), Abdominal-a (Abd-a), and Abdominal-b (Abd-b) are particularly crucial. They play defining roles in determining the identity of the thorax and the entire abdomen, highlighting the significance of Hox genes in segmental specification.
The Abd-a gene exhibits distinct roles in specifying the morphology of abdominal segments across insect species, despite their close evolutionary ties. In this context, the study of its function in Drosophila melanogaster provides a robust foundation for understanding its broader significance. Specifically, the Abd-a gene is required to specify the identity of abdominal segments A2–A8 and orchestrate the development of various organs, including the abdominal epithelia, fat bodies, midgut, heart, neurons, and gonads. Additionally, it plays a critical role in remodeling segment boundaries and promoting neuron proliferation [20,21,22,23,24,25,26]. Furthermore, Abd-a has been shown to influence histone biogenesis, which in turn affects body plan morphogenesis [27]. Mutations in Abd-a lead to notable phenotypic alterations. In Drosophila, such mutations cause posteriorization of abdominal segments and break the posterior prevalence rule of abdominal epithelia [28]. Comparable phenotypes have been observed in other insects, including Tribolium, Bombyx mori, Plutella xylostella, and Ostrinia furnacalis, where Abd-a knockdown leads to the absence of abdominal appendages [29,30,31,32]. Specifically, in lepidopteran insects, loss-of-function mutations in Abd-a affect pigmentation or color patterns and can even lead to sterility [33,34]. Given the significance of Abd-a in abdominal segmentation and development, a thorough understanding of its function is crucial for elucidating the evolutionary history of this gene and its contribution to species differentiation. This is particularly pertinent in the context of D. punctatus, where the role of Abd-a in segmentation remains to be elucidated.
CRISPR/Cas9 is a powerful tool for precise genome editing, including the induction of gene knockout. Our previous work utilized this system to successfully achieve gene loss of function in D. punctatus [35]. This ability to manipulate specific genes has opened new avenues for investigating the biological functions of Abd-a. Prior research in other lepidopteran insects, such as Spodoptera litura, Plutella xylostella, Spodoptera frugiperda, and Ostrinia furnacalis, have demonstrated that the knockout of Abd-a led to profound phenotypic effects, including sterility or lethality [29,31,33,36]. Given these findings, we hypothesized that disrupting Abd-a during embryogenesis in D. punctatus, using the CRISPR/Cas9 system, might also have profound implications for the survival and development of the offspring.
Therefore, the objective of the present study was to examine the consequences of Abd-a gene knockout on embryogenesis in D. punctatus. Our findings reveal that Abd-a is indispensable for the specification of posterior abdominal segments, ranging from A2 to A7, as well as for the proper development of T3 thoracic legs and prolegs. These findings not only advance our understanding of embryogenesis in D. punctatus but also point to potential candidate genes for RNAi-based control strategies, which merits further research.

2. Results

2.1. cDNA Cloning, Sequence Analysis, and Expression Pattern of the DpAbd-a Gene

The nucleotide sequence of DpAbd-a (KU663672) was cloned from the transcriptome of D. punctatus using specific primers. Sequence analysis revealed the presence of three splice variants of the DpAbd-a gene, differing in the lengths of their coding sequences. Specifically, we identified splice variants with coding sequences of lengths 1032 bp, 1044 bp, and 1059 bp, encoding proteins of 344, 348, and 353 amino acids, respectively. All three variants exhibit a conserved genomic structure with three exons. Notably, the differences between the splice variants are concentrated in the second exon. DpAbd-a contains two important motifs: a DNA binding motif known as the homeodomain (HD) and a hexapeptide motif (HX) with the sequence YPWM (Figures S1 and S2). These motifs are crucial for the functional activity of the encoded proteins.
Phylogenetic analysis showed that DpAbd-a clusters closely with homologs from lepidopteran insects, exhibiting a clear divergence from homologs in other insects and non-insect arthropods, as depicted in Figure S3A. A comparison analysis of the amino acid sequences of DpAbd-a and those of other species underscored a remarkable degree of conservation, particularly within the helix-turn-helix HD domain, the YPWM motif, and several other amino acid regions (Figures S1 and S3B). Notably, the nucleotide sequences of DpAbd-a exhibited over 95% identity with those of lepidopteran insects across the entire amino acid sequence (Figure S3). Specifically, within the homeodomain region, DpAbd-a was 100% identical to homologs from other species, except for Microplitis demolitor and Gryllus bimaculatus, which possessed a partial amino acid sequence (Figure S3B). These findings strongly suggest that Abd-a encodes conserved functional roles among lepidopteran insects.
To elucidate the expression pattern of DpAbd-a during embryonic development, qRT-PCR was performed at various developmental stages. Our results indicated that the expression of DpAbd-a gradually increased during the early embryonic development, peaking at day 6, followed by a steep decline. This expression pattern aligns with previous studies that have highlighted the crucial roles played by Hox genes in defining the body plan during late embryonic development [18], as depicted in Figure 2.

2.2. CRISPR/Cas9-Mediated Mutations in the DpAbd-a Gene in the G0 and G1 Generation of D. punctatus

The CRISPR/Cas9 system was successfully employed in this study for functional characterization of Abd-a in the pine moth, D. punctatus. To investigate the potential impact of disrupting DpAbd-a on the abdominal segment development of the pine moth, we performed embryonic gene knockout experiments. Specifically, a total of 480 eggs were injected with a mixture containing 500 ng/μL of DpAbd-a sgRNA and 500 ng/μL of Cas9 mRNA. As a control, 240 eggs were injected with Cas9 mRNA/EGFP sgRNA at the same concentrations (Figure 3A; Table 1). The loss of DpAbd-a function led to a high rate of embryonic mortality, reaching up to 70.4%. In comparison, the mortality in the control group was significantly lower, at 35.8%. Zygotic injection of DpAbd-a sgRNA/Cas9 induced somatic deletion mutations at both targeted sites (sgRNA a, b) (Figure 3A). In these deletion events, the fragment spanning the two targeted sites and varying lengths of flanking sequences were deleted. Analysis of the resulting clones revealed that 50% (five out of ten clones) exhibited deletions at target sites, which were attributed to CRISPR/Cas9-induced non-homologous end joining (NHEJ) (Figure 3B,C).
During the phenotype screening of hatched and unhatched individuals, the treatment group showed an overall mutagenesis frequency of 17.5% in the injected generation. Among the hatched larvae and dissected embryos, 23.8% (10 of 42) and 22.6% (56 of 248), respectively, displayed abnormalities in the anterior–posterior axis and segmental phenotypes, such as the loss of appendages (Table 1, Figure 4). Notably, only 42 of the 480 eggs hatched normally. Among these, 10 larvae exhibited fused segment phenotypes; eight of them died at the early larval stage, while the remaining two pupated and emerged as adults. Remarkably, one of these adults successfully mated with wild-type females, resulting in production of the G1 generation (Figure 5, Figure 6 and Figure 7). In the G1 generation, 28.6% (93 of 325) of the hatched larvae showed disrupted abdominal segments, and most of them died at an early embryonic stage (Figure S4). Furthermore, a T7EI assay performed on four third-instar larvae revealed cleavage products, indicating an indel frequency of 28.6% (Figure S4). Direct sequencing of randomly selected positive clones carrying indel mutations at the Abd-a locus confirmed that the CRISPR/Cas9 system had successfully disrupted the DpAbd-a gene sequence.

2.3. Roles of DpAbd-a in Posterior Segmentation and Appendage Development

CRISPR/Cas9-induced somatic mutagenesis of Abd-a led to significantly high lethality rates. These mutant individuals displayed abnormal anterior–posterior axis patterning and modifications in segment formation (as shown in Figure 4, Figure 5 and Figure 6). Specifically, compared to wild-type and control individuals, larval Abd-a mutants exhibited fusion of the dorsal groove in abdominal segments A2 to A7 (Figure 4B–D). Furthermore, among the lethal embryos, defective thoracic legs, abdominal prolegs, and anal prolegs were observed (Figure 4D), indicating a crucial role for Abd-a in appendage development.
Knockout of Abd-a led to anteriorization of segments A2 to A7 in hatched individuals, with less severe effects observed in other segments, as evident in the mutant phenotypes depicted in Figure 4, Figure 5 and Figure 6. In mildly affected mutants, we also observed disrupted A-P axis patterning (as shown in mutants depicted in Figure 5 and Figure 6). These findings indicate that Abd-a plays a significant role in both patterning of the anterior–posterior (A-P) axis and identification of abdominal segments.
Furthermore, the absence of Abd-a resulted in defects in the development of abdominal prolegs, some of which were completely missing. Rarely, defects were also observed in the third thoracic legs and anal prolegs, as demonstrated in Figure 4. These results indicate that Abd-a is essential for the development of all prolegs, including the third thoracic legs. Furthermore, a few mutants exhibited malformed anuses, hinting at the potential role of Abd-a in the development of sex organs.
Moreover, the majority of larvae with Abd-a knockout died during the first-instar stage, with only two individuals surviving to pupate. Of these two pupae, only one was able to produce heritable offspring, while the other exhibited reduced wing size and was unable to mate with wild-type individuals (as shown in Figure S5). Significant differences in the width of the deformed forewings and hindwings were observed, though the specific wing spots patterns remained unchanged. These results suggest that Abd-a may contribute to wing development in D. punctatus.

2.4. Pleiotropic Effects of DpAbd-a Knockout

Previous studies have shown that the antennapedia complex (ANT-C), consisting of genes such as Labial (Lab), Proboscipedia (pb), Deformed (Dfd), Sex combs reduced (Scr), Antennapedia (Antp) and the bithorax complex (BX-C) components, Ultrabithorax (Ubx), Abdominal-b (Abd-b), and Abdominal-a (Abd-a), each exhibit distinct functions that correspond precisely to their respective expression patterns. To evaluate the interaction between Abd-a and other Hox genes in D. punctatus, qRT-PCR experiments were conducted. Our results showed that disrupting Abd-a resulted in a minor upregulation of Abd-b and Dfd. This observation suggests a potential compensatory mechanism where other Hox genes may be upregulated to maintain developmental homeostasis.
In contrast, we observed a significant downregulation in the expression of Abd-a itself, indicating a negative autoregulatory loop. Additionally, Wnt-1, Dll (a known limb-promoting gene), Lab, and Pb expressions were also downregulated upon disruption of Abd-a. This downregulation of Wnt-1 and Dll is particularly noteworthy, given their crucial role in wing and limb development, respectively. It suggests that Abd-a may play an indirect role in regulating wing and limb development by modulating Wnt-1 and Dll expression.
However, the effects on Ubx, Scr, and Antp expressions were negligible. This indicates that these genes are likely not directly regulated by Abd-a or are part of a separate regulatory pathway (Figure 7).

3. Discussion

3.1. CRISPR/Cas9 System for Abd-a Loss of Function

The CRISPR/Cas9 system has revolutionized gene functional research in diverse organisms, including D. punctatus. In this study, zygotic co-injection of Abd-a sgRNAs and Cas9 mRNA effectively induced DNA damage in germline cells, resulting in high frequency transformation of posterior abdominal segments to anterior abdominal segments. While this approach can induce phenotypic variations and generate mutant G1 individuals in D. punctatus, it is not as stable or straightforward as traditional transgenic techniques. The screening process to identify positive individuals within a generation can be tedious. Moreover, long-term stable breeding of D. punctatus remains a significant challenge, limiting further functional research. Despite these limitations, CRISPR/Cas9 remains a valuable tool for gene functional research in D. punctatus. Future efforts could focus on exploring more efficient and stable methods for gene knockout in this species. Potential avenues include optimizing the delivery system to enhance accuracy and efficiency, as well as developing stable transgenic lines to facilitate long-term functional studies. By addressing these challenges, we can harness the full potential of CRISPR/Cas9 in D. punctatus research.

3.2. Characterization of the DpAbd-a Homolog

In this study, we characterized the DpAbd-a homolog in D. punctatus and compared it with homologs in other lepidopteran insects. Our results showed that, like homologs in other lepidopterans, the DpAbd-a gene exhibits multiple isoforms (Figure S3A). As seen in B. mori, there are three isoforms, A, B, and C, whose expression commences at the early embryonic stage and intensifies throughout embryonic development [32,37]. Interestingly, the length of cDNA encoding the Abd-a protein in lepidopteran insects is comparatively shorter than that observed in most dipteran and hymenopteran insects, potentially suggesting a higher evolutionary rate among lepidopterans (Figure S3A). Despite the subtle variations between the splicing variants, the deduced amino acid sequence of DpAbd-a revealed a highly conserved homologous domain and YPWM motif, which is commonly found in insects (Figure S3B). This YPWM motif is well-known for its role in mediating the interaction of certain Hox proteins in Drosophila [38].
The expression patterns of Abd-a during segmentation vary across insects, depending on their segmentation mechanisms. In insects with long-germ segmentation, such as Drosophila, Abd-a is expressed in parasegments 7–13 [39]. Conversely, in insects with short-germ segmentation, like Tribolium, Bombyx mori, and Gryllus bimaculatus, Abd-a expression extends across posterior abdominal segments A1–A10 [40,41,42]. However, due to a scarcity of immunohistochemical data, the precise spatial expression pattern of Abd-a in D. punctatus remains unclear. Future research could focus on elucidating the temporal and spatial expression patterns of DpAbd-a during embryonic development in D. punctatus to gain a deeper understanding of its functional significance.

3.3. Abd-a Is Involved in the Determination of Posterior Segments

In this study, we investigated the function of DpAbd-a in specifying segmental identity and appendage development in D. punctatus. Our results demonstrate that disruption of DpAbd-a leads to transformation of abdominal segments and a loss of abdominal appendages, suggesting that DpAbd-a acts to specify A2–A7 segment identity and promote the development of A3-A6 prolegs. These findings align with previous studies in S. litura, P. xylostella, and O. furnacalis [29,31,33]. However, our results contrast with those reported in B. mori, where knockdown Abd-a did not affect the development of abdominal segments [32,37] or leg formation in S. litura and O. furnacalis [29,33]. This disparity suggests that Abd-a functions in a species-specific manner, regulating different genes and developmental processes in different insects. Furthermore, we observed a direct relationship between the transformation of abdominal segments induced by DpAbd-a deficiency and epithelial formation, resembling findings in Drosophila [28]. These phenotypes variations are attributed to role of Abd-a as a transcription factor that modulates the expression of various genes in different species. Abd-a has been implicated in the evolutionary diversification of appendage development, especially in concert with the Ubx gene [43,44]. In Drosophila, HOX and other genes are integrated by cis-regulatory modules (CRM) to regulate cell-specific gene expression. For instance, the Distal-less Conserved Regulatory Element (DCRE) CRM recruits Ubx/Abd-A/(Extradenticle)Exd/(Homothorax)Hth complexes to regulate leg development, whereas the rhomboid-Abd-a conserved (RhoA) CRM recruits Abd-A/Exd/Hth complexes to stimulate epidermal growth [45]. In addition, Abd-a may target the histone gene array to influence embryo morphogenesis [27]. In Gryllus bimaculatus, Abd-A, along with other Hox genes such as Sex-combs reduced (Scr), Antennapedia (Antp), and Ultrabithorax (Ubx), jointly regulate primordial germ cell (PGC) development [42]. In Bicyclus anynana, Abd-a plays a crucial role in the development of larval prolegs not the thoracic leg [46]. In Panorpa liui, Abd-a acts alongside Distal-less to regulate segment and proleg development [47]. These studies suggest that Abd-a possesses an ancestrally conserved role in abdominal segment specification and appendage arrangement.
In addition, we noted a phenotype characterized by a reduction in wing width, prompting us to inquire about the potential role of Abd-a in regulating wing development. Previous reports in silkworms have demonstrated that BmAbd-a’s homeobox domain and LCR2 interact with BmPOUM2 to regulate the expression of BmWCP4, a gene encoding a wing disc cuticle protein, through binding to its regulatory element [48,49]. These studies provide potential parallels for how Abd-a might regulate wing development in D. punctatus. Our previous work also suggested that Wnt-1, a critical gene for embryo segmentation, might cooperate with members of the Hox family in D. punctatus [35]. To further investigate the potential role of Abd-a in wing and limp development, we conducted qRT-PCR experiments and discovered that the expression of Wnt-1, a gene crucial for wing disc formation, and Dll, a gene involved in limb promotion, was significantly downregulated in Abd-a mutants. This finding supports our hypothesis that Abd-a may play a role in wing and limb development in D. punctatus.
Finally, our results revealed that in the G1 generation, 32.3% of embryos failed to hatch, indicating a potential influence of Abd-a on germline development. This finding aligns with previous studies in Drosophila, where Abd-a and Abd-b are essential for genitalia development [22,50]. In silkworms, Abd-b is known to regulate chitin plate development in females, but the specific role of Abd-a in this species has not been reported [51]. Interestingly, in P. xylostella, Abd-a participates in testis development [31]. However, the regulatory mechanism governing the body plans of various species is intricate and warrants further investigation. Our current study suggests that DpAbd-a plays a critical role in modulating the segmentation of abdominal segments and divergent arrangement of abdominal appendages in D. punctatus. This study advances our understanding of segmentation mechanisms in Lepidoptera and lays the foundation for future studies exploring the role of Abd-a and other Hox genes in this diverse insect group.

4. Materials and Methods

4.1. Insect Rearing

The D. punctatus used in this study were originally obtained from Xing’an County of Guilin city, Guangxi province, China. Larvae were reared on Masson’s pine branches and maintained in a growth chamber at 27 ± 1 °C with a photoperiod of 16 h/8 h light/dark. Newly emerged adults were selected for mating and egg collection.

4.2. Gene Identification and Phylogenetic Analyses

Total RNA was extracted from a single pine moth pupae using Trizol Reagent (Invitrogen, Waltham, MA, USA). Subsequently, the RNA was then purified through a phenol/chloroform/isopropanol mixture (Thermo, Waltham, MA, USA) at a ratio of 25:24:1, followed by an additional purification step using chloroform (Thermo, Waltham, MA, USA). After precipitation with isopropanol, the RNA was washed with 75% ethanol (Aladdin, Shanghai, China) and ultimately dissolved in nuclear free water. Subsequently, reverse transcription was carried out to convert the RNA into cDNA using the Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo, Waltham, MA, USA). Using the local BLAST (Basic Local Alignment Search Tool), the nucleotide sequences that significantly matched the transcriptome data from D. punctatus were identified from protein alignments of B. mori (GenBank accession #: NM_001173338.1, NM_001173337.1, NM_001114159.2). The DpAbd-a cDNAs (KU663672.1) were amplified by PCR with primers Abd-a-ORF-F and Abd-a-ORF-R (Table S1) based on the predicted DpAbd-a gene identified in the transcriptome data. PCR was performed using KOD-plus polymerase (TOYOBO, Osaka, Japan) under the following conditions: an initial denaturation at 94 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 68 °C for 90 s, with a final extension step at 68 °C for 10 min. PCR products were analyzed on 1% agarose gel, and the extracted products were ligated into a blunt-end pCR-Blunt vector (Thermo Fisher, Waltham, MA, USA) using the T4 DNA ligase (NEB, Ipswich, MA, USA). Subsequently, the ligation products were transformed into DH5α cells, and the positive clones were selected for sequencing. Phylogenetic analysis was constructed with MEGA 11 (https://www.megasoftware.net/ (accessed on 17 May 2023)) [52]. Bootstrap with 1000 replications was used to construct a neighbor-joining tree from 29 Abd-a sequences (shown in Figure S3).

4.3. Real Time Quantitative PCR

Considering the small differences among the spliced variants of DpAbd-a, suitable primers for detecting three transcription levels were not available. Relative quantification of DpAbd-a, DpAbd-b, DpUbx, DpLab, DpPb, DpDfd, DpScr, DpAntp, DpDll, and DpWnt-1 in DpAbd-a mutants was performed using qPCR with SYBR Green QPCR Master Mix (TOYOBO, Osaka, Japan). cDNA was synthesized from wild-type embryos (day 1 to day 8) and first-instar larvae of DpAbd-a and DpWnt-1 mutants. PCR was performed with an initial denaturation step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s. Primers were used as follows: Abd-a-F, “GGGAGGAGCAGGAGAGAATG”, Abd-a-R, “CTTTGAGTAGGTCGTTGGA”. Ubx-F, “ATTTTGAGCAGGGTGG CTTT”, Ubx-R, “GAGGCTGGGCATAGGTGAG”. Abd-b-F, “GTGGCGAAGAACGGCG GACA”, Abd-b-R, “GAAGAACCGCAGCCGACCCC”. Scr-F, “GTAGAGCAAACGGGGC ATC”, Scr-R, “TGCGGTGGCGAGTAACAA”. Antp-F, “CGTATGAAGTGGAAGAA GGAGAA”, Antp-R, “TATTGTGGCGAGGTTGGTG”. Dfd-F, “GCTGGAGTCACCACCA CGGC”, Dfd-R, “TGCCCACCGACGCAATGCAA”. Lab-F, “GATACCGCCCGCA GAGTT”, Lab-R, “TGTTGTTGAGATTTAGGAGTGG”. Pb-F, “AGTGGAACGCAAAAC ACAAA”, Pb-R, “GAAGTGGAAGTCTGAGGAGGAG”. Wnt-1-F, “TGTCCGTGGTTG TTTGTGTT”, Wnt-1-R, “TATTTGGTTCTCCCGCTTTG”. Dll-F, “GGTCCTTGGGAC ATGAAGGG”, Dll-R, “CGTGTCCGCGATGTCATTTC”. Rp32-F, “ATGGCAATCAGACC TGTGTACAG”, Rp32-R, “GACGGGTCTTCTTGTTTGATCCGT”. The relative mRNA level of the target genes was calculated using the 2−ΔΔCt method, where the expression of the target gene was normalized to an internal reference, Rp32. Three independent replications were performed for each sample.

4.4. In Vitro Transcription and Purification of Cas9 and sgRNA

The Cas9 mRNA and sgRNAs were synthesized in vitro using the mMESSAGE mMACHINE® T7 Kit and MEGAscript® T7 Kit (Ambion, Austin, TX, USA), respectively, following the protocol described by Wang [53]. The purified sgRNAs and Cas9 mRNA were stored at −80 °C until use.
Based on the differences between DpAbd-a and BmAbd-a isoforms, it is inferred that DpAbd-a has three predicted exons, with the primary variation occurring in the deduced second exon. Two sgRNA targeting sites for DpAbd-a were selected based on their locations within nucleotides 356–378 bp and 512–534 bp of the deduced exon-1 (Figure S2A and Table S1). Control sgRNAs were used, as described in our previous report [35].

4.5. Embryonic Microinjection

Fertilized eggs were collected within 2 h after oviposition, and microinjection was carried out as previously described [35]. Cas9 mRNA (500 ng/µL) and Dpabd-a sgRNAs (sgRNA-a and sgRNA-b, 500 ng/µL, each) were co-injected into preblastoderm embryos. Controls were injected with either an exogenous gene, EGFP, with an equal amount of Cas9 mRNA, or with nuclear free water. The injected eggs were maintained at 25 ± 1 °C for 8–10 days until hatching.

4.6. Screening and Analysis of Cas9/sgRNA-Induced Mutations

Images of hatched larvae, pupae, and adults were captured using NRK-D90 (B) digital cameras (Nikon, Tokyo, Japan). To confirm the gene alteration efficiency of the DpAbd-a locus in the injected generation (G0), identification of somatic mutations was performed using GBdirect PCR (GBI, Shanghai, China). The DNA fragment spanning the targeting-sgRNAs was amplified directly from genomic DNA of embryos and larvae using DpAbd-a-specific-F1 and DpAbd-a-specific-R1 primers (Table S1). Somatic mutations in DpAbd-a were confirmed by sequencing.
Mutagenesis of the DpAbd-a locus in the G1 generation was confirmed using the T7 endonuclease I assay, as previously described [54]. Genomic DNA was extracted from first-instar mutant and wild-type individuals using a genomic DNA extraction kit (CWBio, Taizhou, China). PCR was performed to amplify a 498 bp fragment from genomic DNA of samples using DpAbd-a-specific-F2 and DpAbd-a-specific-R2 primers (Table S1). After the T7EI assay, the mixture was analyzed by gel electrophoresis, with fragments resolved on a 2% agarose gel. The PCR products for mutation validation were ligated into a pCR-Blunt vector for further sequencing.

5. Conclusions

The CRISPR/Cas9-mediated knockout of Abd-a in D. punctatus revealed its crucial role in posterior abdominal, proleg, wing, anal, and reproductive development. These findings underscore the pivotal role of Abd-a in the embryonic and reproductive development of this pest, thus highlighting its immense potential as a prime target for genetic control measures. Additionally, it could be harnessed to enhance the efficacy of the SIT (sterile insect technique), effectively diminishing the pest’s reproductive potential. Future studies could further explore the molecular mechanisms underlying Abd-a’s regulation of developmental processes in D. punctatus and evaluate the efficacy of targeting this gene for pest management strategies. Additionally, delving into the functional roles played by other Hox genes within the bithorax complex of this species would not only enhance our comprehensive understanding of the genetic basis of insect development but also facilitate cross-species comparisons, potentially uncovering novel universal targets for enhanced pest management.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f15071157/s1, Table S1. Primer sets used in this study. Figure S1. Analysis of D. punctatus Abd-a gene sequence. Figure S2. Motif analysis of Abd-a gene from 13 insect species. Figure S3. Phylogenetic relationships by hierarchical cluster analysis based on the amino acid sequences of Abd-a proteins from different species. Figure S4. G1 generation of DpAbd-a mutants. Figure S5. Wings of DpAbd-a mutants and wildtype.

Author Contributions

H.L. designed and conceived the study. X.Z. and H.L. analyzed the data. H.L., X.Z., L.C., Q.M., X.W. and S.Z. contributed to the interpretation of the results. H.L. drafted and X.Z. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (32371895) and the Fundamental Research Funds for the Central Non-profit Research Institution of CAF (CAFYBB2020QC001).

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author (H.L.).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zeng, J.; Ge, F.; Su, J.; He, Z. Researches on the occurrences of major forest insect pests of pine caterpillar Dendrolimus spp. in China. Chin. Bull. Entomol. 2010, 47, 451–459. [Google Scholar]
  2. Zhang, S.; Shen, S.; Peng, J.; Zhou, X.; Kong, X.; Ren, P.; Liu, F.; Han, L.; Zhan, S.; Huang, Y.; et al. Chromosome-level genome assembly of an important pine defoliator, Dendrolimus punctatus (Lepidoptera; Lasiocampidae). Mol. Ecol. Resour. 2020, 20, 1023–1037. [Google Scholar] [CrossRef] [PubMed]
  3. Horak, K.E. RNAi: Applications in Vertebrate Pest Management. Trends Biotechnol. 2020, 38, 1200–1202. [Google Scholar] [CrossRef] [PubMed]
  4. He, L.; Huang, Y.N.; Tang, X.M. RNAi-based pest control: Production, application and the fate of dsRNA. Front. Bioeng. Biotechnol. 2022, 29, 1080576. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, Y.M.; De Schutter, K. Biosafety aspects of RNAi-based pests control. Pest Manag. Sci. 2024. [Google Scholar] [CrossRef] [PubMed]
  6. Dalakouras, A.; Koidou, V.; Papadopoulou, K. DsRNA-based pesticides: Considerations for efficiency and risk assessment. Chemosphere 2024, 352, 141530. [Google Scholar] [CrossRef]
  7. Zhu, K.Y.; Palli, S.R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef]
  8. Jaiwal, A.; Natarajaswamy, K.; Rajam, M.V. RNA silencing of hormonal biosynthetic genes impairs larval growth and development in cotton bollworm, Helicoverpa armigera. J. Biosci. 2020, 45, 109. [Google Scholar] [CrossRef]
  9. Kebede, M.; Fite, T. RNA interference (RNAi) applications to the management of fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae): Its current trends and future prospects. Front. Mol. Biosci. 2022, 9, 944774. [Google Scholar] [CrossRef]
  10. Swevers, L.; Liu, J.; Smagghe, G. Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi. Viruses 2018, 10, 230. [Google Scholar] [CrossRef]
  11. Wiltshire, R.M.; Duman-Scheel, M. Advances in oral RNAi for disease vector mosquito research and control. Curr. Opin. Insect Sci. 2020, 40, 18–23. [Google Scholar] [CrossRef] [PubMed]
  12. Yan, S.; Yin, M.Z.; Shen, J. Nanoparticle-based nontransformative RNA insecticides for sustainable pest control: Mechanisms, current status and challenges. Entomol. Generalis. 2023, 43, 21–30. [Google Scholar] [CrossRef]
  13. Clark, E.; Peel, A.D.; Akam, M. Arthropod segmentation. Development 2019, 146, dev170480. [Google Scholar] [CrossRef] [PubMed]
  14. Peel, A.D.; Chipman, A.D.; Akam, M. Arthropod segmentation: Beyond the Drosophila paradigm. Nat. Rev. Genet. 2005, 6, 905–916. [Google Scholar] [CrossRef] [PubMed]
  15. Ten Tusscher, K.H. Mechanisms and constraints shaping the evolution of body plan segmentation. Eur. Phys. J. E Soft. Matter. 2013, 36, 54. [Google Scholar] [CrossRef] [PubMed]
  16. Johnston, D.S.; Nüsslein-Volhard, C. The origin of pattern and polarity in the drosophila embryo. Cell 1992, 68, 201–219. [Google Scholar] [CrossRef] [PubMed]
  17. Karch, F.; Weiffenbach, B.; Peifer, M.; Bender, W.; Duncan, I.; Celniker, S.; Crosby, M.; Lewis, E.B. The abdominal region of the bithorax complex. Cell 1985, 43, 81–96. [Google Scholar] [CrossRef] [PubMed]
  18. Maeda, R.K.; Karch, F. The ABC of the BX-C: The bithorax complex explained. Development 2006, 133, 1413–1422. [Google Scholar] [CrossRef] [PubMed]
  19. Pace, R.M.; Grbic, M.; Nagy, L.M. Composition and genomic organization of arthropod Hox clusters. Evodevo 2016, 7, 11. [Google Scholar] [CrossRef]
  20. Bilder, D.; Graba, Y.; Scott, M.P. Wnt and TGFbeta signals subdivide the AbdA Hox domain during Drosophila mesoderm patterning. Development 1998, 125, 1781–1790. [Google Scholar] [CrossRef] [PubMed]
  21. Estacio-Gomez, A.; Moris-Sanz, M.; Schafer, A.K.; Perea, D.; Herrero, P.; Diaz-Benjumea, F.J. Bithorax-complex genes sculpt the pattern of leucokinergic neurons in the Drosophila central nervous system. Development 2013, 140, 2139–2148. [Google Scholar] [CrossRef] [PubMed]
  22. Foronda, D.; Estrada, B.; de Navas, L.; Sanchez-Herrero, E. Requirement of Abdominal-A and Abdominal-B in the developing genitalia of Drosophila breaks the posterior downregulation rule. Development 2006, 133, 117–127. [Google Scholar] [CrossRef] [PubMed]
  23. Roumengous, S.; Rousset, R.; Noselli, S. Polycomb and Hox Genes Control JNK-Induced Remodeling of the segment boundary during Drosophila morphogenesis. Cell Rep. 2017, 19, 60–71. [Google Scholar] [CrossRef] [PubMed]
  24. McGinnis, W.; Krumlauf, R. Homeobox genes and axial patterning. Cell 1992, 68, 283–302. [Google Scholar] [CrossRef] [PubMed]
  25. Kannan, R.; Berger, C.; Myneni, S.; Technau, G.M.; Shashidhara, L.S. Abdominal-A mediated repression of Cyclin E expression during cell-fate specification in the Drosophila central nervous system. Mech. Dev. 2010, 127, 137–145. [Google Scholar] [CrossRef] [PubMed]
  26. Marchetti, M.; Fanti, L.; Berloco, M.; Pimpinelli, S. Differential expression of the Drosophila BX-C in polytene chromosomes in cells of larval fat bodies: A cytological approach to identifying in vivo targets of the homeotic Ubx, Abd-A and Abd-B proteins. Development 2003, 130, 3683–3689. [Google Scholar] [CrossRef]
  27. Hodkinson, L.J.; Smith, C.; Comstra, H.S.; Ajani, B.A.; Albanese, E.H.; Arsalan, K.; Daisson, A.P.; Forrest, K.B.; Fox, E.H.; Guerette, M.R.; et al. A bioinformatics screen reveals hox and chromatin remodeling factors at the Drosophila histone locus. BMC Genom. Data. 2023, 24, 54. [Google Scholar] [CrossRef]
  28. Singh, N.P.; Mishra, R.K. Role of Abd-A and Abd-B in development of abdominal epithelia breaks posterior prevalence rule. PLoS Genet. 2014, 10, e1004717. [Google Scholar] [CrossRef]
  29. Bi, H.; Merchant, A.; Gu, J.; Li, X.; Zhou, X.; Zhang, Q. CRISPR/Cas9-mediated mutagenesis of Abdominal-A and Ultrabithorax in the Asian Corn Borer, Ostrinia furnacalis. Insects 2022, 13, 384. [Google Scholar] [CrossRef] [PubMed]
  30. Lewis, D.L.; DeCamillis, M.; Bennett, R.L. Distinct roles of the homeotic genes Ubx and abd-A in beetle embryonic abdominal appendage development. Proc. Natl. Acad. Sci. USA 2000, 97, 4504–4509. [Google Scholar] [CrossRef] [PubMed]
  31. Huang, Y.; Chen, Y.; Zeng, B.; Wang, Y.; James, A.A.; Gurr, G.M.; Yang, G.; Lin, X.; Huang, Y.; You, M. CRISPR/Cas9 mediated knockout of the abdominal-A homeotic gene in the global pest, diamondback moth (Plutella xylostella). Insect Biochem. Mol. Biol. 2016, 75, 98–106. [Google Scholar] [CrossRef] [PubMed]
  32. Pan, M.H.; Wang, X.Y.; Chai, C.L.; Zhang, C.D.; Lu, C.; Xiang, Z.H. Identification and function of Abdominal-A in the silkworm, Bombyx mori. Insect Mol. Biol. 2009, 18, 155–160. [Google Scholar] [CrossRef] [PubMed]
  33. Bi, H.L.; Xu, J.; Tan, A.J.; Huang, Y.P. CRISPR/Cas9-mediated targeted gene mutagenesis in Spodoptera litura. Insect Sci. 2016, 23, 469–477. [Google Scholar] [CrossRef]
  34. Diaz-Cuadros, M.; Pourquie, O.; El-Sherif, E. Patterning with clocks and genetic cascades: Segmentation and regionalization of vertebrate versus insect body plans. PLoS Genet. 2021, 17, e1009812. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, H.; Liu, Q.; Zhou, X.; Huang, Y.; Zhang, Z. Genome Editing of Wnt-1, a Gene Associated with Segmentation, via CRISPR/Cas9 in the Pine Caterpillar Moth, Dendrolimus punctatus. Front. Physiol. 2016, 7, 666. [Google Scholar] [CrossRef]
  36. Wu, K.; Shirk, P.D.; Taylor, C.E.; Furlong, R.B.; Shirk, B.D.; Pinheiro, D.H.; Siegfried, B.D. CRISPR/Cas9 mediated knockout of the abdominal-A homeotic gene in fall armyworm moth (Spodoptera frugiperda). PLoS ONE 2018, 13, e0208647. [Google Scholar] [CrossRef] [PubMed]
  37. Tong, X.L.; Fu, M.Y.; Chen, P.; Chen, L.; Xiang, Z.H.; Lu, C.; Dai, F.Y. Ultrabithorax and abdominal-A specify the abdominal appendage in a dosage-dependent manner in silkworm, Bombyx mori. Heredity 2017, 118, 578–584. [Google Scholar] [CrossRef] [PubMed]
  38. Johnson, F.B.; Parker, E.; Krasnow, M.A. Extradenticle protein is a selective cofactor for the Drosophila homeotics Role of the homeodomain and YPWM amino acid motif in the interaction. Proc. Natl. Acad. Sci. USA 1995, 92, 739–743. [Google Scholar] [CrossRef] [PubMed]
  39. Karch, F.; Bender, W.; Weiffenbach, B. abdA expression in Drosophila embryos. Genes Dev. 1990, 4, 1573–1587. [Google Scholar] [CrossRef] [PubMed]
  40. Nagy, L.M.; Booker, R.; Riddiford, L.M. Isolation and embryonic expression of an abdominal-A-like gene from the lepidopteran, Manduca sexta. Development 1991, 112, 119–129. [Google Scholar] [CrossRef]
  41. Shippy, T.D.; Brown, S.J.; Denell, R.E. Molecular characterization of the Tribolium abdominal-A ortholog and implications for the products of the Drosophila gene. Dev. Genes. Evol. 1998, 207, 446–452. [Google Scholar] [CrossRef] [PubMed]
  42. Zhang, H.; Shinmyo, Y.; Mito, T.; Miyawaki, K.; Sarashina, I.; Ohuchi, H.; Noji, S. Expression patterns of the homeotic genes Scr, Antp, Ubx, and abd-A during embryogenesis of the cricket Gryllus bimaculatus. Gene Expr. Patterns. 2005, 5, 491–502. [Google Scholar] [CrossRef] [PubMed]
  43. Palopoli, M.F.; Patel, N.H. Evolution of the interaction between Hox genes and a downstream target. Curr. Biol. 1998, 8, 587–590. [Google Scholar] [CrossRef] [PubMed]
  44. Zheng, Z.; Khoo, A.; Fambrough, D., Jr.; Garza, L.; Booker, R. Homeotic gene expression in the wild-type and a homeotic mutant of the moth Manduca sexta. Dev. Genes Evol. 1999, 209, 460–472. [Google Scholar] [CrossRef] [PubMed]
  45. Zandvakili, A.; Uhl, J.D.; Campbell, I.; Salomone, J.; Song, Y.C.; Gebelein, B. The cis-regulatory logic underlying abdominal Hox-mediated repression versus activation of regulatory elements in Drosophila. Dev. Biol. 2019, 445, 226–236. [Google Scholar] [CrossRef] [PubMed]
  46. Matsuoka, Y.; Murugesan, S.N.; Prakash, A.; Monteiro, A. Lepidopteran prolegs are novel traits, not leg homologs. Sci. Adv. 2023, 9, eadd9389. [Google Scholar] [CrossRef]
  47. Liu, B.P.; Hua, B.Z. Distinct roles of the Hox genes Ultrabithorax and abdominal-A in scorpionfly embryonic proleg development. Insect Mol. Biol. 2024, 33, 69–80. [Google Scholar] [CrossRef] [PubMed]
  48. Deng, H.; Zhang, J.; Li, Y.; Zheng, S.; Liu, L.; Huang, L.; Xu, W.H.; Palli, S.R.; Feng, Q. Homeodomain POU and Abd-A proteins regulate the transcription of pupal genes during metamorphosis of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2012, 109, 12598–12603. [Google Scholar] [CrossRef]
  49. He, Y.; Deng, H.; Hu, Q.; Zhu, Z.; Liu, L.; Zheng, S.; Song, Q.; Feng, Q. Identification of the binding domains and key amino acids for the interaction of the transcription factors BmPOUM2 and BmAbd-A in Bombyx mori. Insect Biochem. Mol. Biol. 2017, 81, 41–50. [Google Scholar] [CrossRef]
  50. Foronda, D.; Martin, P.; Sanchez-Herrero, E. Drosophila Hox and sex-determination genes control segment elimination through EGFR and extramacrochetae activity. PLoS Genet. 2012, 8, e1002874. [Google Scholar] [CrossRef] [PubMed]
  51. Duan, J.; Xu, H.; Ma, S.; Guo, H.; Wang, F.; Zhang, L.; Zha, X.; Zhao, P.; Xia, Q. Ectopic expression of the male BmDSX affects formation of the chitin plate in female Bombyx mori. Mol. Reprod. Dev. 2014, 81, 240–247. [Google Scholar] [CrossRef] [PubMed]
  52. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, Y.Q.; Li, Z.Q.; Xu, J.; Zeng, B.S.; Ling, L.; You, L.; Chen, Y.Z.; Huang, Y.P.; Tan, A.J. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 2013, 23, 1414–1416. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, Z.; Aslam, A.F.; Liu, X.; Li, M.; Huang, Y.; Tan, A. Functional analysis of Bombyx Wnt1 during embryogenesis using the CRISPR/Cas9 system. J. Insect Physiol. 2015, 79, 73–79. [Google Scholar] [CrossRef] [PubMed]
Forests 15 01157 g001
Figure 1. Life cycle of Dendrolimus punctatus. (A) Egg stage, (B) Larva stage, (C) Pupa stage, (D) Male adult, and (E) Female adult in the process of laying eggs.
Figure 1. Life cycle of Dendrolimus punctatus. (A) Egg stage, (B) Larva stage, (C) Pupa stage, (D) Male adult, and (E) Female adult in the process of laying eggs.
Forests 15 01157 g001
Forests 15 01157 g002
Figure 2. Temporal expression profile of DpAbd-a. The relative mRNA levels of DpAbd-a in embryos from day 1 to 8 (E1–E8). Rp32 was used as a control for normalization. The data are shown as mean values ± S.E.M. (n = 3).
Figure 2. Temporal expression profile of DpAbd-a. The relative mRNA levels of DpAbd-a in embryos from day 1 to 8 (E1–E8). Rp32 was used as a control for normalization. The data are shown as mean values ± S.E.M. (n = 3).
Forests 15 01157 g002
Forests 15 01157 g003
Figure 3. Abd-a mutation events. (A): Schematic representation of Abd-a sgRNA targeting sites. The diagram depicts the three deduced exons of DpAbd-a, with boxes representing the exons and the black line indicating non-translated regions including the 5′ UTR, introns, and 3′ UTR. The blue and yellow boxes highlight differences between the three splice variants. The sgRNA targeting sequence is shown in blue, while the protospacer adjacent motif (PAM) sequence is highlighted in yellow. (B,C): CRISPR/Cas9-induced mutagenesis of DpAbd-a. (B): Electrophoretogram analysis of PCR products in G0-injected embryos. (C): Confirmation of mutation events by sequencing. The number of deleted sequences is noted on the right.
Figure 3. Abd-a mutation events. (A): Schematic representation of Abd-a sgRNA targeting sites. The diagram depicts the three deduced exons of DpAbd-a, with boxes representing the exons and the black line indicating non-translated regions including the 5′ UTR, introns, and 3′ UTR. The blue and yellow boxes highlight differences between the three splice variants. The sgRNA targeting sequence is shown in blue, while the protospacer adjacent motif (PAM) sequence is highlighted in yellow. (B,C): CRISPR/Cas9-induced mutagenesis of DpAbd-a. (B): Electrophoretogram analysis of PCR products in G0-injected embryos. (C): Confirmation of mutation events by sequencing. The number of deleted sequences is noted on the right.
Forests 15 01157 g003
Forests 15 01157 g004
Figure 4. Ventral view of Cas9/Abd-a sgRNA-induced mutations at the Abd-a locus in newly hatched and unhatched larvae. (A): Wild-type embryo. (B,C): Mildly affected larvae after sgRNA and Cas9 mRNA injection. (B): Arrows indicate a partial absence and ossification of the third pair of thoracic legs. (C): The arrows show that the anus is turned into a structure resembling an adult sex organ. (D–F): Severely affected larvae after sgRNA and Cas9 mRNA injection. (D): Depicts a mutant larva with missing prolegs. (E,F): The ventral segments of the mutant larvae are fused with each other through the epidermis, resulting in the absence of abdominal prolegs and anal prolegs. Scale bars: 1 mm for (A–D) and (E,F).
Figure 4. Ventral view of Cas9/Abd-a sgRNA-induced mutations at the Abd-a locus in newly hatched and unhatched larvae. (A): Wild-type embryo. (B,C): Mildly affected larvae after sgRNA and Cas9 mRNA injection. (B): Arrows indicate a partial absence and ossification of the third pair of thoracic legs. (C): The arrows show that the anus is turned into a structure resembling an adult sex organ. (D–F): Severely affected larvae after sgRNA and Cas9 mRNA injection. (D): Depicts a mutant larva with missing prolegs. (E,F): The ventral segments of the mutant larvae are fused with each other through the epidermis, resulting in the absence of abdominal prolegs and anal prolegs. Scale bars: 1 mm for (A–D) and (E,F).
Forests 15 01157 g004
Forests 15 01157 g005
Figure 5. Dorsal view of newly hatched larvae exhibiting Cas9/sgRNA-induced mutations at the Abd-a locus. (A,E): Control embryos injected with EGFP-specific sgRNA and Cas9 mRNA, displaying normal segmentation. (B–D,F–H): Larvae mildly affected by Abd-a sgRNA and Cas9 mRNA injection. Arrows indicate transformations of abdominal segments, reflecting the anteriorization of posterior segments. (B,G): Type I mutant larvae with fusion of A3 and A4 segments; (C,F): Type II mutant larvae exhibiting fusion of A2 and A3 segments along with disturbances in the anterior–posterior axis. (D,H): Type III mutant larvae, where A3 to A6 are fused and transformed into a fan shape. Scale bars: 1 mm for (A–D) and 0.5 mm for (E–H). A1–A10 represent the 1st–10th abdominal segments.
Figure 5. Dorsal view of newly hatched larvae exhibiting Cas9/sgRNA-induced mutations at the Abd-a locus. (A,E): Control embryos injected with EGFP-specific sgRNA and Cas9 mRNA, displaying normal segmentation. (B–D,F–H): Larvae mildly affected by Abd-a sgRNA and Cas9 mRNA injection. Arrows indicate transformations of abdominal segments, reflecting the anteriorization of posterior segments. (B,G): Type I mutant larvae with fusion of A3 and A4 segments; (C,F): Type II mutant larvae exhibiting fusion of A2 and A3 segments along with disturbances in the anterior–posterior axis. (D,H): Type III mutant larvae, where A3 to A6 are fused and transformed into a fan shape. Scale bars: 1 mm for (A–D) and 0.5 mm for (E–H). A1–A10 represent the 1st–10th abdominal segments.
Forests 15 01157 g005
Forests 15 01157 g006
Figure 6. Abd-a is required for abdominal segment development throughout all life stages in D. punctatus. (A–C): Phenotypes observed in larval, pupal, and adult stages after injection of Abd-a sgRNA and Cas9 mRNA. WT denotes the wild-type phenotype. The blue box represents the phenotypic characteristics of the mutant region from larva to adult. (A): Comparison of fifth-instar larvae from G0 Abd-a mutants and wild-type individuals. (B): Pupae from Abd-a mutant and wild-type individuals. (C): Adults from Abd-a and wild-type individuals. Scale bars represent 1 mm.
Figure 6. Abd-a is required for abdominal segment development throughout all life stages in D. punctatus. (A–C): Phenotypes observed in larval, pupal, and adult stages after injection of Abd-a sgRNA and Cas9 mRNA. WT denotes the wild-type phenotype. The blue box represents the phenotypic characteristics of the mutant region from larva to adult. (A): Comparison of fifth-instar larvae from G0 Abd-a mutants and wild-type individuals. (B): Pupae from Abd-a mutant and wild-type individuals. (C): Adults from Abd-a and wild-type individuals. Scale bars represent 1 mm.
Forests 15 01157 g006
Forests 15 01157 g007
Figure 7. Differential expression of candidate genes in the DpAbd-a mutants first-instar larvae. The candidate gene in (A) represents Abd-a, Abd-b in (B), Ubx in (C), Wnt-1 in (D), Dll in (E), Labial (Lab) in (F), Proboscipedia (Pb) in (G), Deformed (Dfd) in (H), Sex combs reduced (Scr) in (I) and Antennapedia (Antp) in (J). The Rp32 gene was used as a control to generate normalization results. The data shown are mean values ± S.E.M. (n = 3). An asterisk (*) signifies p ≤ 0.05, double asterisks (**) indicate p ≤ 0.01, triple asterisks (***) denote p ≤ 0.001, while ‘ns’ stands for not significant, indicating p > 0.05.
Figure 7. Differential expression of candidate genes in the DpAbd-a mutants first-instar larvae. The candidate gene in (A) represents Abd-a, Abd-b in (B), Ubx in (C), Wnt-1 in (D), Dll in (E), Labial (Lab) in (F), Proboscipedia (Pb) in (G), Deformed (Dfd) in (H), Sex combs reduced (Scr) in (I) and Antennapedia (Antp) in (J). The Rp32 gene was used as a control to generate normalization results. The data shown are mean values ± S.E.M. (n = 3). An asterisk (*) signifies p ≤ 0.05, double asterisks (**) indicate p ≤ 0.01, triple asterisks (***) denote p ≤ 0.001, while ‘ns’ stands for not significant, indicating p > 0.05.
Forests 15 01157 g007
Table 1. Embryonic mutagenesis induced by Cas9/sgRNA targeting DpAbd-a.
Table 1. Embryonic mutagenesis induced by Cas9/sgRNA targeting DpAbd-a.
Cas9/sgRNA
Concentration
(ng/μL)		Treatment Number
(n)		G0 aG1 a
Embryo
Mortality (%)		Defective Larvae b (%)Pupae (n)Adults
(n)		Embryo
Mortality (%)		Defective Larvae b (%)Pupae (n)Adults
(n)
Abd-a 500/50048070.417.53232.328.600
EGFP 500/50012035.80282317.603728
WT 0/012038.80322719.805547
a Phenotype variation; b defective abdominal segments.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, H.; Chen, L.; Ma, Q.; Wang, X.; Zhang, S.; Zhou, X. Functional Characterization of Abdominal-A in the Pine Caterpillar Moth, Dendrolimus punctatus. Forests 2024, 15, 1157. https://doi.org/10.3390/f15071157

AMA Style

Liu H, Chen L, Ma Q, Wang X, Zhang S, Zhou X. Functional Characterization of Abdominal-A in the Pine Caterpillar Moth, Dendrolimus punctatus. Forests. 2024; 15(7):1157. https://doi.org/10.3390/f15071157

Chicago/Turabian Style

Liu, Huihui, Lin Chen, Qinghua Ma, Xinghong Wang, Sufang Zhang, and Xuguo Zhou. 2024. "Functional Characterization of Abdominal-A in the Pine Caterpillar Moth, Dendrolimus punctatus" Forests 15, no. 7: 1157. https://doi.org/10.3390/f15071157

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop