Functional Characterization of Abdominal-A in the Pine Caterpillar Moth, Dendrolimus punctatus
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsAuthors should indicate the number of pine moth pupae per treatment used for the total RNA extraction.
Here are suggestions for minor revision
Line 198: Correct the figure reference from “B-D, E-H:” to “B-D, F-H:”.
o Current Text: “B-D, E-H:”
o Revised Text: “B-D, F-H:”
Line 247: Delete the extra space before the comma in “Abdominal-a (Abd-a) ,”.
o Current Text: “Abdominal-a (Abd-a) ,”
o Revised Text: “Abdominal-a (Abd-a),”
Line 365: Authors should describe how they euthanized and extracted the RNA from the study pine moth pupae.
Authors should specify how they initially deduced the amino acid sequences as stated in line 367.
Line 375: Authors should at least briefly describe the procedure for cloning the PCR products into the pCR-Blunt vector for their sequencing.
Line 388: Authors should provide primers for the study in this manuscript for easy reference by readers.
Line 408: The phrase, “nuclear water free”, seems inaccurate. Please change it to “nuclease free water”.
Lines 378, 417, 423: Supplementary Table and figure as stated in “Table S1, and Figure S3” were not provided to reviewers.
Introduction:
a. Include more recent references and provide a broader context for the significance of RNAi in pest management.
b. Clarify the specific challenges posed by Dendrolimus punctatus and how this study addresses them.
Methods:
a. Consider providing a more detailed description of the controls used in the CRISPR/Cas9 experiments to ensure reproducibility.
Results:
a. Enhance figure labeling for better clarity and understanding of the results presented.
Discussion:
a. Expand on the potential implications of the findings for future research and practical applications in pest management.
Author Response
Thank you for pointing out these issues. We agree with these comments.
Comments 1: Authors should indicate the number of pine moth pupae per treatment used for the total RNA extraction.
Response 1: Agree, revised “Total RNA was extracted from pine moth pupae using Trizol Reagent (Invitrogen, USA)” to “Total RNA was extracted from a single pine moth pupae using Trizol Reagent (Invitrogen, USA).”
Comments 2: Here are suggestions for minor revision
Line 198: Correct the figure reference from “B-D, E-H:” to “B-D, F-H:”.
o Current Text: “B-D, E-H:”
o Revised Text: “B-D, F-H:”
Response 2: Agree, revised “B-D, E-H:” to “B-D, F-H:”
Comments 3: Line 247: Delete the extra space before the comma in “Abdominal-a (Abd-a) ,”.
o Current Text: “Abdominal-a (Abd-a) ,”
o Revised Text: “Abdominal-a (Abd-a),”
Response 3: Agree, revised “Abdominal-a (Abd-a) ,” to “Abdominal-a (Abd-a),”.
Comments 4: Line 365: Authors should describe how they euthanized and extracted the RNA from the study pine moth pupae.
Response 4: Agree, we have made the following adjustments.
Changed “Total RNA was extracted from pine moth pupae using Trizol Reagent (Invitrogen, USA). And reverse transcription to cDNA using the Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo, USA).” to “Total RNA was extracted from pine moth pupae using Trizol Reagent (Invitrogen, USA). Subsequently, the RNA was then purified through a phenol/chloroform/isopropanol mixture at a ratio of 25:24:1, followed by an additional purification step using chloroform. After precipitation with isopropanol, the RNA was washed with 75% ethanol and ultimately dissolved in nuclear free water. Subsequently, reverse transcription was carried out to convert the RNA into cDNA using the Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo, USA).”
Comments 5: Authors should specify how they initially deduced the amino acid sequences as stated in line 367.
Response 5: Agree, we have made the following adjustments.
Changed “Deduced amino acid sequences that significantly matched transcriptome data from D. punctatus were identified from protein alignments of B. mori (GenBank accession #: NM_001173338.1, NM_001173337.1, NM_001114159.2).” to “Using the local BLAST (Basic Local Alignment Search Tool), the nucleotide sequences that significantly matched transcriptome data from D. punctatus were identified from protein alignments of B. mori (GenBank accession #: NM_001173338.1, NM_001173337.1, NM_001114159.2).”.
Comments 6: Line 375: Authors should at least briefly describe the procedure for cloning the PCR products into the pCR-Blunt vector for their sequencing.
Response 6: Agree, we have made the following adjustments.
“PCR products were analyzed on a 1% agarose gel and the extracted products were ligated into a blunt-end pCR-Blunt vector for sequencing.” to “PCR products were analyzed on a 1% agarose gel and the extracted products were ligated into a blunt-end pCR-Blunt vector (Thermo Fisher, USA) using the T4 DNA ligase (NEB, USA). Subsequently, the ligation products were transformed into DH5α cells, and the positive clones were selected for sequencing”.
Comments 7: Line 388: Authors should provide primers for the study in this manuscript for easy reference by readers.
Response 7: Agree, we have made the following adjustments.
Changed “The same primers as those reported in a previous study were used [33].” To “The primers were used as follows, Abd-a-F, “GGGAGGAGCAGGAGAGAATG”, Abd-a-R, “CTTTGAGTAGGTCGTTGGA”. Ubx-F, “ATTTTGAGCAGGGTGG CTTT”, Ubx-R, “GAGGCTGGGCATAGGTGAG”. Abd-b-F, “GTGGCGAAGAACGGCG GACA”, Abd-b-R, “GAAGAACCGCAGCCGACCCC”. Scr-F, “GTAGAGCAAACGGGGC ATC”, Scr-R, “TGCGGTGGCGAGTAACAA”. Antp-F, “CGTATGAAGTGGAAGAA GGAGAA”, Antp-R, “TATTGTGGCGAGGTTGGTG”. Dfd-F, “GCTGGAGTCACCACCA CGGC”, Dfd-R, “TGCCCACCGACGCAATGCAA”. Lab-F, “GATACCGCCCGCA GAGTT”, Lab-R, “TGTTGTTGAGATTTAGGAGTGG”. Pb-F, “AGTGGAACGCAAAAC ACAAA”, Pb-R, “GAAGTGGAAGTCTGAGGAGGAG”. Wnt-1-F, “TGTCCGTGGTTG TTTGTGTT”, Wnt-1-R, “TATTTGGTTCTCCCGCTTTG”. Dll-F, “GGTCCTTGGGAC ATGAAGGG”, Dll-R, “CGTGTCCGCGATGTCATTTC”. RP32-F, “ATGGCAATCAGACC TGTGTACAG”, RP32-R, “GACGGGTCTTCTTGTTTGATCCGT”.”
Comments 8: Line 408: The phrase, “nuclear water free”, seems inaccurate. Please change it to “nuclease free water”.
Response 8: Agree, we have made the following adjustments.
Changed “Controls were injected with either an exogenous gene, EGFP, with an equal amount of Cas9 mRNA, and with nuclear water free of any sgRNAs or Cas9 mRNA. “ to “Controls were injected with either an exogenous gene, EGFP, with an equal amount of Cas9 mRNA, and with nuclear free water of any sgRNAs or Cas9 mRNA.”.
Comments 9: Lines 378, 417, 423: Supplementary Table and figure as stated in “Table S1, and Figure S3” were not provided to reviewers.
Response 9: OK, I will review and upload the files.
Comments 10: Introduction:
a. Include more recent references and provide a broader context for the significance of RNAi in pest management.
Response 10: Agree.
- Therefore, we have changed “In recent years, RNA interference (RNAi) has gained significant attention as a promising strategy for pest control” to “In recent years, RNA interference (RNAi) has gained significant attention as a promising species-specific strategy for pest control. Unlike traditional chemical pesticides, RNAi is highly specific and precise, targeting only pest genes without harming other organisms. Additionally, its durability and non-residual nature ensure long-term pest control while minimizing environmental impact [3-7].”
- To enhance the comprehensiveness of the literature review, we have incorporated three additional papers, designated as 4, 5, and 6. Subsequently, for consistency and clarity, we have adjusted the numbering of the references accordingly: paper 4 has been relabeled as 3, paper 7 as 8, and all other references have been incremented by 2.
- Horak, K. E. RNAi: Applications in Vertebrate Pest Management. Trends Biotechnol. 2020, 38, 1200-1202.
- He, L. , Huang, Y.N., Tang X.M. RNAi-based pest control: Production, application and the fate of dsRNA. Front Bioeng Biotechnol. 2022, 29:10:1080576. doi: 10.3389/fbioe.2022.1080576.
- Chen, Y.M., De Schutter, K. Biosafety aspects of RNAi-based pests control.Pest Manag Sci.2024, doi: 10.1002/ps.8098.
- Dalakouras, A., Koidou, V., Papadopoulou, K. DsRNA-based pesticides: Considerations for efficiency and risk assessment. Chemosphere. 2024, 352:141530. doi: 10.1016/j.chemosphere.2024.141530.
- Zhu, K. Y.; Palli, S. R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu. Rev. Entomol. 2020, 65, 293-311.
- Jaiwal, A.; Natarajaswamy, K.; Rajam, M. V. RNA silencing of hormonal biosynthetic genes impairs larval growth and development in cotton bollworm, Helicoverpa armigera. Journal of Biosciences 2020, 45, (1).
- Kebede, M.; Fite, T. RNA interference (RNAi) applications to the management of fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae): Its current trends and future prospects. Front. Mol. Biosci. 2022, 9, 944774.
- Swevers, L.; Liu, J.; Smagghe, G. Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi. Viruses 2018, 10, 230.
- Wiltshire, R. M.; Duman-Scheel, M. Advances in oral RNAi for disease vector mosquito research and control. Curr. Opin. Insect Sci. 2020, 40, 18-23.
Comments 11: b. Clarify the specific challenges posed by Dendrolimus punctatus and how this study addresses them.
Response 11: Agree, we have made the following adjustments. Changed “The moth’s wide distribution in mountainous regions has rendered conventional methods challenging, while the use of chemical pesticides can be detrimental to beneficial insects and the environment.” to “The moth’s wide distribution in mountainous regions has rendered conventional methods challenging, while the use of chemical pesticides can be detrimental to beneficial insects and other organisms, ultimately leading to the erosion of biodiversity.”
Comments 12: Methods:
a. Consider providing a more detailed description of the controls used in the CRISPR/Cas9 experiments to ensure reproducibility.
Response 12: Agree, here are the modifications we have implemented. Changed “Controls were injected with either an exogenous gene, EGFP, with an equal amount of Cas9 mRNA, and with nuclear free water of any sgRNAs or Cas9 mRNA.” to “Controls were injected with either an exogenous gene, EGFP, with an equal amount of Cas9 mRNA.”
Comments 13: Results:
a. Enhance figure labeling for better clarity and understanding of the results presented.
Response 13: OK, I will review and labeled again.
Comments 14: Discussion:
a. Expand on the potential implications of the findings for future research and practical applications in pest management.
Response 14: Agree, here are the modifications we have implemented. Changed “These findings demonstrate that Abd-a is essential for embryonic and reproductive development in this pest and highlights its potential as a target for genetic control. Future studies could further explore the molecular mechanisms underlying Abd-a's regulation of developmental processes in D. punctatus and evaluate the efficacy of targeting this gene for pest management strategies. Additionally, investigating the functional roles of other Hox genes within the bithorax complex in this species would provide a more comprehensive understanding of the genetic basis of insect development and potentially reveal novel targets for pest control.” to “These findings underscore the pivotal role of Abd-a in the embryonic and reproductive development of this pest, thus highlighting its immense potential as a prime target for genetic control measures Additionally, it could be harnesses to enhance the efficacy of the SIT (sterile insect technique), effectively diminishing the pest’s reproductive potential. Future studies could further explore the molecular mechanisms underlying Abd-a's regulation of developmental processes in D. punctatus and evaluate the efficacy of targeting this gene for pest management strategies. Additionally, delving into the functional roles played by other Hox genes within the bithorax complex of this species would not only enhance our comprehensive understanding of the genetic basis of insect development, but also facilitate cross-species comparisions, potentially uncovering novel, universal targets for enhanced pest management.”
Reviewer 2 Report
Comments and Suggestions for AuthorsINTRODUCTION
It would be useful to add more information about the morphology and life cycle of D. puctatus. Potentially even pictures and drawings could be helpful
Line 45 Authority name, Order and Family are necessary when a species is mentioned for the first time.
MATERIALS AND METHODS
I did not see any information regarding the statistical analyses. Were stats performed to establish the statistical significance of the observed results? I see that the authors say that difference in mortality between treatment and control was significant, but I cannot see the analyses or the software used.
Can the authors specify this?
This is a great paper that can just benefit from some additional information considering that the audience of this journal is not exclusively made of entomologists. Great work.
Author Response
Thank you for pointing out these issues. We agree with these comments..
Comments 1: It would be useful to add more information about the morphology and life cycle of D. puctatus. Potentially even pictures and drawings could be helpful
Response 1: Agree, please add Figure 1: Life cycle of Dendrolimus punctatus.
Comments 2: Line 45 Authority name, Order and Family are necessary when a species is mentioned for the first time.
Response 2: Agree, here are the modifications we have implemented. Revised “RNAi has shown promising results in managing various pests, including flies, armyworms, and cotton bollworms.” to “RNAi has shown promising results in managing various pests, including flies (Drosophila melanogaster ), mosquitos (genera Anopheles, Aedes, and Culex), armyworms (Spodoptera frugiperda), and cotton bollworms (Helicoverpa armigera).”
Comments 3: MATERIALS AND METHODS
I did not see any information regarding the statistical analyses. Were stats performed to establish the statistical significance of the observed results? I see that the authors say that difference in mortality between treatment and control was significant, but I cannot see the analyses or the software used.
Can the authors specify this?
Response 3: Agree, here are the modifications we have implemented. Revised “The mRNA measurements were quantified in three independent biological replicates and normalized to DpRp32.” to “The relative mRNA level of the target genes was calculated using the 2-∆∆Ct method, where the expression of the target gene was normalized to an internal reference, RP32. Three independent replications were performed for each sample.”
