Interaction Analysis of Odorant-Binding Protein 12 from Sirex noctilio and Volatiles from Host Plants and Symbiotic Fungi Based on Molecule Dynamics Simulation
Abstract
:1. Introduction
- (1)
- The biological characteristics of SnocOBP12 were obtained through the systematic analysis of bioinformatics.
- (2)
- There is a three-dimensional model of SnocOBP12 predicted by homology modeling in this study. Thereafter, with computational simulation, its binding preference was analyzed and the critical amino acid residues for ligand binding was further identified. This is beneficial to better explain the molecular mechanism of SnocOBP12 action.
2. Materials and Methods
2.1. Verification of the SnocOBP12 Sequence
2.2. Sequence Analysis
2.3. Homology Modeling and Molecular Docking
2.4. Molecular Dynamics Simulation of the SnocOBP12−Ligand Complexes
2.5. Binding Free Energy Calculations and Per-Residue Free Energy Decomposition
2.6. Computational Alanine Scanning (CAS)
3. Results
3.1. Sequence Analysis and Homology Modeling
3.2. Molecular Docking and Binding Affinities for SnocOBP12 with Ligands
3.3. MD and Conformational Stability of SnocOBP12–Ligand Complexes
3.4. Energy Calculation and Binding Modes Analysis
3.5. Computational Alanine Scanning
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zwiebel, L.J.; Takken, W. Olfactory regulation of mosquito–host interactions. Insect Biochem. Mol. Biol. 2004, 34, 645–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hua, J.F.; Zhang, S.; Cui, J.J.; Wang, D.J.; Wang, C.Y.; Luo, J.Y.; Lv, L.M. Identification and binding characterization of three odorant binding proteins and one chemosensory protein from Apolygus lucorum (Meyer-Dur). J. Chem. Ecol. 2012, 38, 1163–1170. [Google Scholar] [CrossRef] [PubMed]
- Brito, N.F.; Moreira, M.F.; Melo, A.C.A. A look inside odorant-binding proteins in insect chemoreception. J. Insect Physiol. 2016, 95, 51–65. [Google Scholar] [CrossRef] [PubMed]
- Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature 1981, 293, 161–163. [Google Scholar] [CrossRef]
- Zhang, Y.L.; Fu, X.B.; Cui, H.C.; Zhao, L.; Yu, J.Z.; Li, H.L. Functional characteristics, electrophysiological and antennal immunolocalization of general odorant-binding protein 2 in tea geometrid, Ectropis obliqua. Int. J. Mol. Sci. 2018, 19, 875. [Google Scholar] [CrossRef] [Green Version]
- Sandler, B.H.; Nikonova, L.; Leal, W.S.; Clardy, J. Sexual attraction in the silkworm moth: Structure of the pheromone-binding-protein–bombykol complex. Chem. Biol. 2000, 7, 143–151. [Google Scholar] [CrossRef] [Green Version]
- Pelosi, P.; Iovinella, I.; Felicioli, A.; Dani, F.R. Soluble proteins of chemical communication: An overview across arthropods. Front. Physiol. 2014, 5, 320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Wang, X.; Zhang, L. Sex pheromones and olfactory proteins in Antheraea moths: A. pernyi and A. polyphemus (Lepidoptera: Saturniidae). Arch. Insect Biochem. Physiol. 2020, 105, e21729. [Google Scholar]
- Fan, J.; Francis, F.; Liu, Y.; Chen, J.L.; Cheng, D.F. An overview of odorant-binding protein functions in insect peripheral olfactory reception. Genet. Mol. Res. 2011, 10, 3056–3069. [Google Scholar] [CrossRef]
- Wu, Z.Z.; Qu, M.Q.; Pu, X.H.; Cui, Y.; Xiao, W.Y.; Zhao, H.X.; Bing, S.Y.; Lin, J.T. Transcriptome sequencing of Tessaratoma papillosa antennae to identify and analyze expression patterns of putative olfaction genes. Sci. Rep. 2017, 7, 3070. [Google Scholar] [CrossRef]
- Rihani, K.; Ferveur, J.F.; Briand, L. The 40-Year Mystery of Insect Odorant-Binding Proteins. Biomolecules 2021, 11, 509. [Google Scholar] [CrossRef] [PubMed]
- Laughlin, J.D.; Ha, T.S.; Jones, D.N.; Smith, D.P. Activation of pheromone-sensitive neurons is mediated by conformational activation of pheromone-binding protein. Cell 2008, 133, 1255–1265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rihani, K.; Fraichard, S.; Chauvel, I.; Poirier, N.; Delompré, T.; Neiers, F.; Tanimura, T.; Ferveur, J.-F.; Briand, L. A conserved odorant binding protein is required for essential amino acid detection in Drosophila. Commun. Biol. 2019, 2, 425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, Y.L.; Huang, L.Q.; Pelosi, P.; Wang, C.Z. Expression in antennae and reproductive organs suggests a dual role of an odorant-binding protein in two sibling Helicoverpa species. PLoS ONE 2012, 7, e30040. [Google Scholar] [CrossRef] [PubMed]
- Bautista, M.A.M.; Bhandary, B.; Wijeratne, A.J.; Michel, A.P.; Hoy, C.W.; Mittapalli, O. Evidence for trade-offs in detoxification and chemosensation gene signatures in Plutella xylostella. Pest Manag. Sci. 2015, 71, 423–432. [Google Scholar] [CrossRef] [PubMed]
- Diallo, S.; Shahbaaz, M.; Makwatta, J.M.; Muema, J.M.; Masiga, D.; Christofells, A.; Getahun, M.N. Antennal enriched odorant binding proteins are required for odor communication in Glossina f. fuscipes. Biomolecules 2021, 11, 541. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Merchant, A.; Zhao, Z.; Zhang, Y.; Zhang, J.; Zhang, Q.; Wang, Q.; Zhou, X.; Li, X. Characterization of MaltOBP1, a minus-C odorant-binding protein, from the Japanese pine sawyer beetle, Monochamus alternatus hope (Coleoptera: Cerambycidae). Front. Physiol. 2020, 11, 212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Donini, O.; Reyes, C.M.; Kollman, P.A. Biomolecular simulations: Recent developments in force fields, simulations of enzyme catalysis, protein-ligand, protein-protein, and protein-nucleic acid noncovalent interactions. Annu. Rev. Biophys. Biomol. Struct. 2001, 30, 211–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hassan, S.A.; Gracia, L.; Vasudevan, G.; Steinbach, P.J. Computer Simulation of Protein-Ligand Interactions. In Protein-Ligand Interactions; Humana Press: Totowa, NJ, USA, 2005; pp. 451–492. [Google Scholar]
- Bai, Q.; Shao, Y.; Pan, D.; Zhang, Y.; Liu, H.; Yao, X. Search for β2 adrenergic receptor ligands by virtual screening via grid computing and investigation of binding modes by docking and molecular dynamics simulations. PLoS ONE 2014, 9, e107837. [Google Scholar] [CrossRef] [Green Version]
- Yi, X.; Zhang, Y.; Wang, P.; Qi, J.; Hu, M.; Zhong, G. Ligands binding and molecular simulation: The potential investigation of a biosensor based on an insect odorant binding protein. Int. J. Biol. Sci. 2015, 11, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Li, R.; Zhou, T.; Cheng, S.; Li, C.; Ye, X.; Li, Y.; Tian, Z. Structural evidence for pheromone discrimination by the pheromone binding protein 3 from Plutella xylostella. Int. J. Biol. Macromol. 2021, 169, 396–406. [Google Scholar] [CrossRef]
- Li, Y.N.; Hao, E.H.; Li, H.; Yuan, X.H.; Lu, P.F.; Qiao, H.L. Computational Interaction Analysis of Sirex noctilio Odorant-Binding Protein (SnocOBP7) Combined with Female Sex Pheromones and Symbiotic Fungal Volatiles. Agronomy 2021, 11, 2461. [Google Scholar] [CrossRef]
- Ciesla, W.M. European woodwasp: A potential threat to North America’s conifer forests. J. For. 2003, 101, 18–23. [Google Scholar]
- Yemshanov, D.; Koch, F.H.; Ducey, M.; Koehler, K. Trade-associated pathways of alien forest insect entries in Canada. Biol. Invasions 2012, 14, 797–812. [Google Scholar] [CrossRef]
- Li, D.; Shi, J.; Lu, M.; Ren, L.; Zhen, C.; Luo, Y. Detection and identification of the invasive Sirex noctilio (Hymenoptera: Siricidae) fungal symbiont, Amylostereum areolatum (Russulales: Amylostereacea), in China and the stimulating effect of insect venom on laccase production by A. areolatum YQL03. J. Econ. Entomol. 2015, 108, 1136–1147. [Google Scholar] [CrossRef] [PubMed]
- Hurley, B.P.; Slippers, B.; Wingfield, M.J. A Comparison of Control Results for the Alien Invasive Woodwasp, Sirex noctilio, in the Southern Hemisphere. Agric. For. Entomol. 2007, 9, 159–171. [Google Scholar] [CrossRef] [Green Version]
- Thompson, B.M.; Bodart, J.; Mcewen, C.; Gruner, D.S. Adaptations for symbiont-mediated external digestion in Sirex noctilio (Hymenoptera: Siricidae). Ann. Entomol. Soc. Am. 2014, 107, 453–460. [Google Scholar] [CrossRef]
- Bao, M.; Qiao, H.; Shi, J.; Luo, Y.; Lu, P. Research progress in reproductive behavior and chemical ecological regulation of the European woodwasp (Sirex noctilio), a severe invasive pest. Sci. Silvae Sin. 2020, 56, 127–141. (In Chinese) [Google Scholar]
- Sun, X.; Tao, J.; Ren, L.; Shi, J.; Luo, Y. Identification of Sirex noctilio (Hymenoptera: Siricidae) using a species-specific cytochrome Coxidase subunit I PCR assay. J. Econ. Entomol. 2016, 109, 1424–1430. [Google Scholar] [CrossRef] [Green Version]
- Cooperband, M.F.; Böröczky, K.; Hartness, A.; Jones, T.H.; Zylstra, K.E.; Tumlinson, J.H.; Mastro, V.C. Male-produced pheromone in the European woodwasp, Sirex noctilio. J. Chem. Ecol. 2012, 38, 52–62. [Google Scholar] [PubMed]
- Gao, C.Y. Study on the Associated Semiochemicals and TRAPPING Techniquesin Forest of Sirex noctilio Fabricius and S nitobei. Master’s Thesis, Beijing Forestry University, Beijing, China, 2019. (In Chinese). [Google Scholar]
- Guignard, Q.; Bouwer, M.; Slippers, B.; Allison, J. Biology of a putative male aggregation-sex pheromone in Sirex noctilio (Hymenoptera: Siricidae). PLoS ONE 2020, 15, e0244943. [Google Scholar] [CrossRef] [PubMed]
- Hurley, B.P.; Garnas, J.; Cooperband, M.F. Assessing trap and lure effectiveness for the monitoring of Sirex noctilio. Agric. For. Entomol. 2015, 17, 64–70. [Google Scholar] [CrossRef] [Green Version]
- Liu, R. Identification of Pheromone Components of Sirex noctilio and Trapping Technology in Forest. Master’s Thesis, Beijing Forestry University, Beijing, China, 2019. (In Chinese). [Google Scholar]
- Bashford, R. The development of static trapping systems to monitor for wood-boring insects in forestry plantations. Aust. For. 2008, 71, 236–241. [Google Scholar] [CrossRef]
- Bashford, R.; Madden, J.L. The use of kairomone lures for the detection of Sirex noctilio in susceptible Pinus radiata plantations in Australia. In The Sirex Woodwasp and Its Fungal Symbiont; Springer: Dordrecht, The Netherlands, 2012; pp. 159–166. [Google Scholar]
- Guo, B.; Hao, E.; Qiao, H.; Wang, J.; Wu, W.; Zhou, J.; Lu, P. Antennal transcriptome analysis of olfactory genes and characterizations of odorant binding proteins in two woodwasps, Sirex noctilio and Sirex nitobei (Hymenoptera: Siricidae). BMC Genom. 2021, 22, 172. [Google Scholar] [CrossRef]
- Chou, K.C.; Shen, H.B. Cell-PLoc 2.0: An improved package of web-servers for predicting subcellular localization of proteins in various organisms. Nat. Sci. 2010, 2, 1090. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Xu, F.; Wang, X.; Kwon, W.S.; Yang, D.C. Molecular discrimination of Panax ginseng cultivar K-1 using pathogenesis-related protein 5 gene. J. Ginseng Res. 2019, 43, 482–487. [Google Scholar] [CrossRef] [PubMed]
- Webb, B.; Sali, A. Comparative protein structure modeling using MODELLER. Curr. Protoc. Bioinform. 2016, 54, 5–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [Green Version]
- Wang, G.; Yang, M.L.; Duan, Z.L.; Liu, F.L.; Jin, L.; Long, C.B.; Zhang, M.; Tang, X.P.; Xu, L.; Li, Y.C.; et al. Dalbavancin binds ACE2 to block its interaction with SARS-CoV-2 spike protein and is effective in inhibiting SARS-CoV-2 infection in animal models. Cell Res. 2021, 31, 17–24. [Google Scholar] [CrossRef]
- Decherchi, S.; Berteotti, A.; Bottegoni, G.; Rocchia, W.; Cavalli, A. The ligand binding mechanism to purine nucleoside phosphorylase elucidated via molecular dynamics and machine learning. Nat. Commun. 2015, 6, 6155. [Google Scholar] [CrossRef] [Green Version]
- Genheden, S.; Ryde, U. The MM/PBSA and MM/GBSA methods to estimate ligand-binding affinities. Expert Opin. Drug Discov. 2015, 10, 449–461. [Google Scholar] [CrossRef] [PubMed]
- Paudel, P.; Wagle, A.; Seong, S.H.; Park, H.J.; Jung, H.A.; Choi, J.S. A new tyrosinase inhibitor from the red alga Symphyocladia latiuscula (Harvey) Yamada (Rhodomelaceae). Mar. Drugs 2019, 17, 295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- da Costa, K.S.; Galúcio, J.M.; da Costa, C.H.S.; Santana, A.R.; Carvalho, V.d.S.; Nascimento, L.D.d.; Lima, A.H.L.e.; Cruz, J.N.; Alves, C.N.; Lameira, J. Exploring the potentiality of natural products from essential oils as inhibitors of odorant-binding proteins: A structure-and ligand-based virtual screening approach to find novel mosquito repellents. ACS Omega 2019, 4, 22475–22486. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.N.; Xu, J.W.; Zhang, X.C.; Zhang, X.Q.; Li, L.L.; Yuan, X.; Mang, D.Z.; Zhu, X.Y.; Zhang, F.; Dewer, Y.; et al. Organophosphorus insecticide interacts with the pheromone-binding proteins of Athetis lepigone: Implication for olfactory dysfunction. J. Hazard. Mater. 2020, 397, 122777. [Google Scholar] [CrossRef] [PubMed]
- do Bomfim, M.R.; Araújo, J.S.C.; Macêdo, W.J.C.; Santos, C.B.R.D.; Leite, F.H.A. Identification of potential modulator of Anopheles gambiae odorant binding protein 1 by hierarchical virtual screening and molecular dynamic. J. Biomol. Struct. Dyn. 2021, 39, 6031–6043. [Google Scholar] [CrossRef]
- Tzotzos, G.; Iley, J.N.; Moore, E.A. New insights on repellent recognition by Anopheles gambiae odorant-binding protein 1. PLoS ONE 2018, 13, e0194724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, F.; Feng, Y.; Han, B.; Hu, H.; Feng, M.; Meng, L.; Ma, C.; Yu, L.; Li, J. Mechanistic insight into binding interaction between chemosensory protein 4 and volatile larval pheromones in honeybees (Apis mellifera). Int. J. Biol. Macromol. 2019, 141, 553–563. [Google Scholar] [CrossRef]
- Sarvary, M.A.; Cooperband, M.F.; Hajek, A.E. The importance of olfactory and visual cues in developing better monitoring tools for Sirex noctilio (Hymenoptera: Siricidae). Agric. For. Entomol. 2015, 17, 29–35. [Google Scholar] [CrossRef]
- Bao, M.; Ren, L.L.; Liu, X.B.; Liu, R.; Ao, T.G.; Bai, S.N.; Lu, P.F. Mating behavior and attractiveness of male cuticle extracts based on electroantennogram and behavioral assay in Sirex noctilio Fabricius. J. Environ. Entomol. 2018, 40, 324–332. (In Chinese) [Google Scholar]
- Ahmed, N.; Darshanee, H.L.C.; Khan, I.A.; Zhang, Z.F.; Liu, T.X. Host selection behavior of the green peach aphid, Myzus persicae, in response to volatile organic compounds and nitrogen contents of cabbage cultivars. Front. Plant Sci. 2019, 10, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.X.; Ren, L.L.; Liu, X.B.; Shi, J.; Wang, J.Z.; Luo, Y.Q. Effects of endophytic fungi in Mongolian pine on the selection behavior of woodwasp (Sirex noctilio) and the growth of its fungal symbiont. Pest Manag. Sci. 2019, 75, 492–505. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Li, C.; Liu, D. Analyses of structural dynamics revealed flexible binding mechanism for the Agrilus mali odorant binding protein 8 towards plant volatiles. Pest Manag. Sci. 2021, 77, 1642–1653. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.N.; Zhang, X.C.; Zhu, R.; Yao, W.C.; Xu, J.W.; Wang, M.; Ren, J.Y.; Xu, C.Z.; Huang, Z.R.; Zhang, X.W.; et al. Computational and experimental approaches to decipher the binding mechanism of general odorant-binding protein 2 from Athetis lepigone to chlorpyrifos and phoxim. J. Agric. Food Chem. 2020, 69, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Yao, R.; Zhao, M.; Zhong, L.; Li, Y.; Li, D.; Deng, Z.; Ma, X. Characterization of the binding ability of the odorant binding protein BminOBP9 of Bactrocera minax to citrus volatiles. Pest Manag. Sci. 2021, 77, 1214–1225. [Google Scholar] [CrossRef] [PubMed]
- Choo, Y.M.; Xu, P.; Hwang, J.K.; Zeng, F.; Tan, K.; Bhagavathy, G.; Chauhan, K.R.; Leal, W.S. Reverse chemical ecology approach for the identification of an oviposition attractant for Culex quinquefasciatus. Proc. Natl. Acad. Sci. USA 2018, 115, 714–719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
SnocOBP12 | Primer Sequence |
---|---|
F (5′ to 3′) | GAATTCATGACTAGGGCCCAAATCGAA |
R (5′ to 3′) | AAGCTTCGCGAAGATGTACATCGTCT |
Ligand | Molecular Formula | PubChem CID | Complex Code | Ligand | Molecular Formula | PubChem CID | Complex Code |
---|---|---|---|---|---|---|---|
Male Pheromones | Host Plant Volatiles | ||||||
(Z)-Dec-3-en-1-ol | C10H20O | 5352846 | CP-1 | (1S)-(−)-α-Pinene | C10H16 | 440968 | CH-1 |
(Z)-Dec-4-en-1-ol | C10H20O | 5362798 | CP-2 | (1R)-(+)-α-Pinene | C10H16 | 82227 | CH-2 |
(2E,4E)-Deca-2,4-dienal | C10H16O | 5283349 | CP-3 | (1R)-(+)-β-Pinene | C10H16 | 10290825 | CH-3 |
(Z)-Oct-3-en-1-ol | C8H16O | 5364519 | CP-4 | (1S)-(−)-β-Pinene | C10H16 | 440967 | CH-4 |
(Z)-Dodec-3-en-1-ol | C12H24O | 5364626 | CP-5 | 3-Carene | C10H16 | 26049 | CH-5 |
Female Pheromones | (−)-Limonene | C10H16 | 439250 | CH-6 | |||
(Z)-7-Heptacosene | C27H54 | 56936088 | CP-6 | Camphene | C10H16 | 6616 | CH-7 |
(Z)-7-Nonacosene | C29H58 | 56936089 | CP-7 | Tricyclene | C10H16 | 79035 | CH-8 |
(Z)-9-Nonacosene | C29H58 | 14367299 | CP-8 | Sabinene | C10H16 | 18818 | CH-9 |
Symbiotic Fungi Volatiles | 3-Thujene | C10H16 | 17868 | CH-10 | |||
3-Ethylacetophenone | C10H12O | 31493 | CF-1 | (−)-α-Cedrene | C15H24 | 6431015 | CH-11 |
(−)-Globulol | C15H26O | 12304985 | CF-2 | (E)-β-Farnesene | C15H24 | 5281517 | CH-12 |
(E)-Hex-3-enyl acetate | C8H14O2 | 5352557 | CF-3 | ||||
Geraniol | C10H18O | 637566 | CF-4 |
Complex Code | Cluster (ns) | Van der Waals Energy | Electrostatic Energy | Polar Solvation Energy | Non-Polar Solvation Energy | Binding Energy | |||||
---|---|---|---|---|---|---|---|---|---|---|---|
CH-1 | 10–50 | −25.385 | ±0.076 | −0.117 | ±0.014 | 9.079 | ±0.043 | −2.561 | ±0.006 | −18.982 | ±0.082 |
CH-2 | 10–50 | −24.201 | ±0.074 | 0.001 | ±0.011 | 6.902 | ±0.036 | −2.612 | ±0.006 | −19.910 | ±0.081 |
CH-3 | 10–50 | −23.029 | ±0.085 | 0.027 | ±0.013 | 5.221 | ±0.039 | −2.640 | ±0.006 | −20.422 | ±0.085 |
CH-4 | 05–50 | −24.162 | ±0.076 | −0.043 | ±0.013 | 7.193 | ±0.042 | −2.556 | ±0.006 | −19.568 | ±0.095 |
CH-5 | 05–50 | −25.055 | ±0.075 | −0.055 | ±0.015 | 7.078 | ±0.038 | −2.652 | ±0.006 | −20.680 | ±0.087 |
CH-6 | 05–50 | −26.901 | ±0.082 | 0.357 | ±0.015 | 7.476 | ±0.036 | −2.654 | ±0.006 | −21.721 | ±0.084 |
CH-7 | 20–50 | −22.293 | ±0.095 | 0.005 | ±0.017 | 5.559 | ±0.052 | −2.624 | ±0.007 | −19.353 | ±0.101 |
CH-8 | 10–50 | −21.251 | ±0.078 | −0.085 | ±0.007 | 5.421 | ±0.049 | −2.608 | ±0.006 | −18.524 | ±0.079 |
CH-9 | 20–50 | −23.869 | ±0.103 | −0.065 | ±0.017 | 7.257 | ±0.040 | −2.698 | ±0.007 | −19.374 | ±0.103 |
CH-10 | 10–50 | −24.663 | ±0.080 | −0.100 | ±0.015 | 7.920 | ±0.048 | −2.695 | ±0.007 | −19.539 | ±0.099 |
CH-11 | 05–50 | −35.392 | ±0.099 | 0.047 | ±0.008 | 7.968 | ±0.038 | −3.198 | ±0.007 | −30.572 | ±0.101 |
CH-12 | 10–50 | −33.032 | ±0.111 | −0.520 | ±0.023 | 9.155 | ±0.055 | −3.951 | ±0.009 | −28.349 | ±0.119 |
CF-1 | 20–50 | −25.501 | ±0.108 | −1.794 | ±0.084 | 13.083 | ±0.120 | −2.804 | ±0.008 | −17.016 | ±0.114 |
CF-2 | 10–50 | −28.519 | ±0.135 | −3.812 | ±0.120 | 10.516 | ±0.128 | −3.425 | ±0.010 | −25.244 | ±0.152 |
CF-3 | 10–50 | −25.389 | ±0.102 | −1.451 | ±0.044 | 11.681 | ±0.070 | −2.889 | ±0.007 | −18.049 | ±0.115 |
CF-4 | 10–50 | −26.605 | ±0.128 | −2.421 | ±0.123 | 11.270 | ±0.097 | −3.096 | ±0.008 | −20.847 | ±0.113 |
Complex | Mutation | ΔEmut (kcal/mol) | Effect |
---|---|---|---|
CH-11 | LEU74 > Ala | 0.71 | Destabilizing |
TYR109 > Ala | 1.37 | Destabilizing | |
CH-12 | ILE6 > Ala | 1.04 | Destabilizing |
MET10 > Ala | 0.95 | Destabilizing | |
MET53 > Ala | 0.38 | Neutral | |
LEU74 > Ala | 0.99 | Destabilizing | |
MET53 > Ala | 0.15 | Neutral | |
CF-2 | ILE70 > Ala | −0.12 | Neutral |
ILE73 > Ala | −0.06 | Neutral |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rong, H.; Li, Y.; Hao, E.; Yuan, X.; Lu, P.; Qiao, H. Interaction Analysis of Odorant-Binding Protein 12 from Sirex noctilio and Volatiles from Host Plants and Symbiotic Fungi Based on Molecule Dynamics Simulation. Agronomy 2022, 12, 861. https://doi.org/10.3390/agronomy12040861
Rong H, Li Y, Hao E, Yuan X, Lu P, Qiao H. Interaction Analysis of Odorant-Binding Protein 12 from Sirex noctilio and Volatiles from Host Plants and Symbiotic Fungi Based on Molecule Dynamics Simulation. Agronomy. 2022; 12(4):861. https://doi.org/10.3390/agronomy12040861
Chicago/Turabian StyleRong, Hao, Yini Li, Enhua Hao, Xiaohui Yuan, Pengfei Lu, and Haili Qiao. 2022. "Interaction Analysis of Odorant-Binding Protein 12 from Sirex noctilio and Volatiles from Host Plants and Symbiotic Fungi Based on Molecule Dynamics Simulation" Agronomy 12, no. 4: 861. https://doi.org/10.3390/agronomy12040861