Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Viral Source
2.2. Electron Microscopy
2.3. Sap Transmission Experiments
2.4. High-Throughput RNA Sequencing, Sequence Processing, and Assembly
2.5. CMV Genome Sequence
2.6. Analyses of Evolutionary Relationships and Genetic Diversity
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Garibaldi, A.; Gilardi, G.; Franco Ortega, S.; Gullino, M.L. First Report of Botrytis Blight Caused by Botrytis cinerea on Purple Coneflower in Italy. Plant Dis. 2018, 102, 821. [Google Scholar] [CrossRef]
- Lee, I.M.; Bottner, K.D.; Dally, E.L.; Davis, R.E. First Report of Purple Coneflower Phyllody Associated with a 16SrI-B Phytoplasma in Maryland. Plant Dis. 2008, 92, 654. [Google Scholar] [CrossRef]
- China’s Ministry of Agriculture. Announcement No. 1787 of the Ministry of Agriculture. In China, the Purple Coneflower, Its Powder and Oral Solution Have Been Certificated by China’s Ministry of Agriculture as the Second Class New Veterinary Drug; China’s Ministry of Agriculture: Beijing, China, 19 June 2012. (In Chinese) [Google Scholar]
- China’s Ministry of Agriculture. Announcement No. 2171 of the Ministry of Agriculture. In China, the Purple Coneflower Root and Root Powder Have Been Certificated by China’s Ministry of Agriculture as the Second Class New Veterinary Drug; China’s Ministry of Agriculture: Beijing, China, 24 November 2014. (In Chinese) [Google Scholar]
- Hwang, S.F.; Chang, K.F.; Howard, R.J.; Khadhair, A.H.; Gaudiel, R.G.; Hiruki, C. First report of a yellows phytopiasma disease in purple coneflower (Echinace spp.) in canada. Z. Pflanzenkrankh. Pflanzenschutz 1997, 104, 182–192. [Google Scholar]
- Letchamo, W.; Polydeonny, L.V.; Gladisheva, N.O.; Arnason, T.J.; Livesey, J.; Awang, D. Factors affecting Echinacea quality. In Trends in New Crops and New Uses: Proceedings of the Fifth National Symposium New Crops and New Uses: Strength in Diversity, Atlanta, GA, USA, 10–13 November 2001; Janick, J., Whipkey, A., Eds.; ASHS Press: Alexandria, VA, USA, 2002; pp. 514–521. [Google Scholar]
- Pearce, T.; Scott, J.; Pethybridge, S. First Report of Witch’s Broom Phytoplasma (16SrII-D Group) in Purple Coneflower in Australia. Plant Dis. 2011, 95. [Google Scholar] [CrossRef] [PubMed]
- Franova, J.; Spak, J.; Simkova, M. First report of a 16SrIII-B subgroup phytoplasma associated with leaf reddening, virescence and phyllody of purple coneflower. Eur. J. Plant Pathol. 2012, 136, 7–12. [Google Scholar] [CrossRef]
- Dunich, A.; Mishchenko, L. Heavy metals content in virus infected purple coneflower plants. Bull. Taras Shevchenko Natl. Univ. Kyiv. Ser. Biol. 2013, 65, 22–26. [Google Scholar]
- Dunich, A.A.; Mishchenko, L.T. Purple coneflower viruses: Species diversity and harmfulness. Biopolym. Cell 2015, 31, 15–28. [Google Scholar] [CrossRef]
- Stanković, I.; Vučurović, A.; Zečević, K.; Petrović, B.; Nikolić, D.; Delibašić, G. Characterization of cucumber mosaic virus and its satellite RNAs associated with tomato lethal necrosis in Serbia. Eur. J. Plant Pathol. 2021, 160, 301–313. [Google Scholar] [CrossRef]
- Yamamoto, T.; Ishii, M.; Sasaya, T.; Iwasaki, M. Mosaic disease of Echinacea (Echinacea purpurea, Compositae). Proc. Assoc. Pl. Protec Shikoku 1993, 28, 49–53. [Google Scholar]
- Beckerman. Cucumber mosaic virus. Yard Gard. Line New 2001, 3, 21–23. [Google Scholar]
- Rangahau, M.K. Echinacea—The purple coneflowers. Crop Food Res. 2001, 33, 12–13. [Google Scholar]
- Bellardi, M.G.; Rubies–Autonell, C.; Hudaib, M. Effect of Cucumber mosaic virus infection on the quality of Echinacea purpurea root extracts. J. Plant Pathol. 2001, 83, 69. [Google Scholar]
- Horvath, J.; Baracsi, E.; Takacs, A.; Kazinczi, G.; Gaborjanyi, R.; Krajczinger, R. Virus infection of ornamental plants in Hungary. Cereal Res. Commun. 2006, 34, 485–488. [Google Scholar] [CrossRef]
- Voinylo, N.V. Some aspects of protection of floral and ornamental plants against viral diseases in botanical gardens. Plant Prot. Minsk. 2006, 30, 190–191. [Google Scholar]
- Li, G.; Zhu, S.; Zhou, Q.; Shi, Z.; Zhang, Y.; Li, M. Identification of Cucumber mosaic virus isolated from Echinacea purpurea. Plant Prot. 2007, 33, 54–56. [Google Scholar]
- Dikova, B. Establishment of some viruses—Polyphagues on economically important essential oil–bearing and medicinal plants in Bulgaria. Biotechnol. Biotechnol. Equip. 2009, 23, 80–84. [Google Scholar] [CrossRef]
- Kardani, S.G.; Rastegar, M. Identification and management of Cucumber mosaic virus in Purple coneflower (Echinacea purpurea) Farms. Iran. Med. Plants Technol. 2019, 2, 34–46. (In Persian) [Google Scholar]
- Muehle, E.; Schumann, K. On the presence of Cucumber mosaic virus (Marmor cucumeris H.) on Echinacea purpurea (L.) Moench. Pharmazie 1964, 19, 417–421. [Google Scholar]
- De Wispelaere, M.; Rao AL, N. Production of cucumber mosaic virus RNA5 and its role in recombination. Virology 2009, 384, 179–191. [Google Scholar] [CrossRef][Green Version]
- Lot, H.; Marchoux, G.; Marrou, J.; Kaper, J.M.; West, C.K.; Van Vloten-Doting, L.; Hull, R. Evidence for three functional RNA species in several strains of cucumber mosaic virus. J. Gen. Virol. 1974, 22, 81–93. [Google Scholar] [CrossRef]
- Anderson, B.J.; Boyce, P.M.; Blanchard, C.L. RNA 4 sequences from cucumber mosaic virus subgroups, I and II. Gene 1995, 161, 293–294. [Google Scholar] [CrossRef] [PubMed]
- Quemada, H.; Kearney, C.; Gonsalves, D.; Slightom, J.L. Nucleotide sequences of the coat protein genes and fanking regions of cucumber mosaic virus strains C and WL RNA 3. J. Gen. Virol. 1989, 70, 1065–1073. [Google Scholar] [CrossRef] [PubMed]
- Rossinck, M.J.; Zhang, L.; Hellwald, K.H. Rearrangements in the 5′ nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J. Virol. 1999, 73, 6752–6758. [Google Scholar] [CrossRef]
- Song, S.; Cui, J.; Lei, G.; Chen, Y.; Yang, M.; Li, Z.; Zhang, J. Occurrence, infectivity and molecular characterization of hosta virus X in North-east China. Can. J. Plant Pathol. 2020, 42, 595–603. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Belete, M.T.; Gudeta, W.F.; Kim, S.E.; Igori, D.; Moon, J.S. Complete genome sequence of Codonopsis torradovirus A, a novel torradovirus infecting Codonopsis Ianceolata in South Korea. Arch Virol. 2021, 166, 3473–3476. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Mei, S.; Yu, H.; Zhang, S.; Wu, J.; Cao, M. Mixed infection of an emaravirus, a Crinivirus, and a begomovirus in Pueraria lobata (Wild) Ohwi. Front. Microbiol. 2022, 13, 926724. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Rozanov, M.N.; Koonin, E.V.; Gorbalenya, A.E. Conservation of the putative methyltransferase domain: A hallmark of the ‘Sindbis-like’supergroup of positive-strand RNA viruses. J. Gen. Virol. 1992, 73, 2129–2134. [Google Scholar] [CrossRef]
- Habili, N.; Symons, R.H. Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Res. 1989, 17, 9543–9555. [Google Scholar] [CrossRef] [PubMed]
- Palukaitis, P.; García-Arenal, F. Cucumoviruses. Adv. Virus Res. 2003, 62, 241–323. [Google Scholar] [PubMed]
- Argos, P. A sequence motif in many polymerases. Nucleic Acids Res. 1988, 16, 9909–9916. [Google Scholar] [CrossRef]
- Brigneti, G.; Voinnet, O.; Li, W.X.; Ji, L.H.; Ding, S.W.; Baulcombe, D.C. Retracted: Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J. 1998, 17, 6739–6746. [Google Scholar] [CrossRef] [PubMed]
- González, I.; Martínez, L.; Rakitina, D.V.; Lewsey, M.G.; Atencio, F.A.; Llave, C.; Kalinina, N.O.; Carr, J.P.; Palukaitis, P.; Canto, T. Cucumber mosaic virus 2b protein subcellular targets and interactions: Their significance to RNA silencing suppressor activity. Mol. Plant-Microbe Interact. 2010, 23, 294–303. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.S.; Ding, S.W. A viral protein inhibits the long range signaling activity of the gene silencing signal. EMBO J. 2002, 21, 398–407. [Google Scholar] [CrossRef]
- Gera, A.; Loebenstein, G.; Raccah, B. Protein coats of two strains of cucumber mosaic virus affect transmission by Aphis gossypii. Phytopathology 1979, 69, 396–399. [Google Scholar] [CrossRef]
- Pirone, T.P.; Blanc, S. Helper-dependent vector transmission of plant viruses. Annu. Rev. Phytopathol. 1996, 34, 227–247. [Google Scholar] [CrossRef]
- Shintaku, M.H.; Zhang, L.; Palukaitis, P. A single amino acid substitution in the coat protein of cucumber mosaic virus induces chlorosis in tobacco. Plant Cell 1992, 4, 751–757. [Google Scholar]
- Roossinck, M.J. Evolutionary history of Cucumber mosaic virus deduced by phylogenetic analyses. J. Virol. 2002, 76, 3382–3387. [Google Scholar] [CrossRef]
- Davino, S.; Panno, S.; Rangel, E.A.; Davino, M.; Bellardi, M.G.; Rubio, L. Population genetics of cucumber mosaic virus infecting medicinal, aromatic and ornamental plants from northern Italy. Arch. Virol. 2012, 157, 739–745. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.-J.; Li, G.-F.; Zhu, S.-F.; Shi, Z.-W.; Li, M.-F. The analysis on the characteristics of the coat protein genes of Cucumber mosaic virus isolated from Echinacea purpurea Moench. Acta Agric. Univ. Jiangxiensis 2007, 1, 34–37. [Google Scholar]
- Liang, P.; Navarro, B.; Zhang, Z.; Wang, H.; Lu, M. Identification and characterization of a novel geminivirus with a monopartite genome infecting apple tree. J. Gen. Virol. 2015, 96, 2411–2420. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence (5′–3′) |
---|---|
RNA1-F | GAGCAATTACAGCATCAACGT |
RNA1-R | CGGACCGAAGTCCTTCCGAA |
RNA2-F | TACAAGAGCGTACGGTTCAACC |
RNA2-R | AGCAATACTGCCAACTCAGCTC |
RNA3-F | CGTCGTGTCGAGTCGTGTTGT |
RNA3-R | GCACGTTGTGCTAGAAGTACAC |
RNA | Protein | Protein Length (aa) | Starting Position (bp) | Ending Position (bp) |
---|---|---|---|---|
RNA1 | 1a | 993 | 70 | 3051 |
RNA2 | 2a | 858 | 78 | 2654 |
2b | 111 | 2413 | 2748 | |
RNA3 | MP | 279 | 120 | 959 |
CP | 218 | 1251 | 1907 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Chen, L.; Sun, P.; Li, Z.; Zhang, L. Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China. Agronomy 2024, 14, 1709. https://doi.org/10.3390/agronomy14081709
Zhang B, Chen L, Sun P, Li Z, Zhang L. Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China. Agronomy. 2024; 14(8):1709. https://doi.org/10.3390/agronomy14081709
Chicago/Turabian StyleZhang, Bin, Liping Chen, Pingping Sun, Zhengnan Li, and Lei Zhang. 2024. "Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China" Agronomy 14, no. 8: 1709. https://doi.org/10.3390/agronomy14081709
APA StyleZhang, B., Chen, L., Sun, P., Li, Z., & Zhang, L. (2024). Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China. Agronomy, 14(8), 1709. https://doi.org/10.3390/agronomy14081709