Disinfection of Secondary Urban Wastewater Using Hydrogen Peroxide Combined with UV/Visible Radiation: Effect of Operating Conditions and Assessment of Microorganism Competition

Abstract

The growing and unprecedented water crisis leads to the need to find alternative water resources, and the reuse of treated urban wastewater is an excellent approach. Accordingly, in this work, the disinfection of a secondary effluent (W) discharged from a wastewater treatment plant (WWTP) by hydrogen peroxide combined with radiation (H₂O₂+UV/visible) was studied with the aim of obtaining treated water that can be reused. Firstly, the effect of hydrogen peroxide alone, radiation per se and the combined H₂O₂+UV/Visible process in the inactivation of enterobacteria were assessed. It was found that the oxidant alone is not efficient; the maximum inactivation is achieved when the oxidant and radiation are used simultaneously. For the first time, the effect of some operational parameters, namely the hydrogen peroxide concentration (between 50 and 125 mg/L), initial pH (from 5.0 to 7.0), temperature (between 15 and 25 °C), and radiation intensity (100 to 500 W/m²), on the efficiency of the disinfection process was assessed. When the process was carried out under the best operating conditions found ([H₂O₂] = 75 mg/L, pH = 5.0, T = 25 °C, and UV/visible light with I = 500 W/m²), total enterobacteria and total heterotrophs were inactivated and the abundance of the 16S rRNA, bla_TEM, qnrS, and intl1 genes was reduced. The cultivable microorganisms grew again after 3 days of storing the treated wastewater (TW), making it impossible to reuse such effluent after storage. Therefore, the potential capacity of a diverse bacterial community present in river water to inhibit the regrowth of potentially harmful bacteria present in the urban secondary wastewater after the application of the treatment process was also evaluated. To the authors’ knowledge, this has never been studied before. For this purpose, the TW was diluted with river water (R) at a volumetric percentage of 50/50—sample R+TW. It was found that, after storage, only the total heterotrophs grew, while the abundance of the targeted genes remained practically constant. The R+TW sample after storage met the legal limits for reuse in urban and agricultural applications. The results of this study suggest that the combination of the H₂O₂+UV/visible radiation treatment with dilution of the final treated effluent with natural surface water can contribute to reducing the burden of water scarcity.

1. Introduction

Water is an essential asset for life, but it is becoming increasingly scarce. Thus, it is necessary to implement new approaches to combat the scarcity of this crucial resource. One such approach is the reuse of urban wastewater. However, before reusing such effluents, it is necessary to implement disinfection processes to inactivate the pathogenic microorganisms present in secondary wastewater, as they can cause serious problems for public health and the environment [1,2,3]. Additionally, there is a great concern about the presence of antibiotic-resistant bacteria (ARB) in this type of effluent. Indeed, in wastewater treatment plants (WWTPs), the activated sludge process is inefficient in eliminating ARB and their genetic determinants from wastewater [4,5,6].

The most commonly used technologies for wastewater disinfection are chlorination [7,8,9], ozonation [10,11,12], and UV irradiation [13,14,15]. However, these processes have drawbacks, as some microorganisms are highly resistant and regrow after exposure to chlorination or UV radiation. The high cost of ozonation [16,17] is also a major drawback. In addition, these processes produce toxic and carcinogenic disinfection by-products [17,18,19]. Therefore, it is necessary to implement safer and more efficient technologies that are less harmful to the environment and public health. Among such disinfection technologies are other advanced oxidation processes (AOPs), which have several advantages, compared to those previously mentioned, such as high efficiency without generating potentially harmful disinfection by-products [20]. One of those AOPs is the use of hydrogen peroxide combined with radiation (H₂O₂+UV/Visible). This process relies on the action of the oxidant by radiation (which is usually used in WWTPs), especially ultraviolet radiation (wavelengths in the range of 200 to 300 nm), which can promote the photolysis of H₂O₂ molecules. In this way, UV radiation breaks the O-O bond of the H₂O₂ molecule, generating highly oxidative hydroxyl radicals (HO^•)—see Equation (1) [21,22].

$${\mathrm{H}}_2{\mathrm{O}}_{2 }+\mathrm{h}\mathsf{\nu }\to {2\mathrm{HO}}^{•}$$

(1)

The hydroxyl radicals (apart from the UV light itself) are responsible for inactivating the microorganisms present in the wastewater by damaging the cell structure and promoting cell lysis [23].

The combination of radiation with hydrogen peroxide has already been implemented to inactivate several microorganisms present in simulated or real water/wastewater [4,13,17,19,24,25,26,27,28,29,30,31], which are described in

Table 1. Studies focused on hydrogen peroxide combined with radiation for inactivation of microorganisms.

Microorganism(s)	Water/Wastewater Type	Operating Conditions	Process’ Efficiency	References
Escherichia coli (E. coli) K-12 and Pseudomonas aeruginosa (P. aeruginosa)	Inoculated saline solution (ISS) or urban wastewater (UWW)	UV-C or solar radiation [H2O2]UV-C = 5 mg/L [H2O2]solar = 30 mg/L QISS UV-C = 0.003 kJ/L QISS solar = 0.04–0.06 kJ/L QUWW UV-C = 4–9 kJ/L QUWW solar = 15–20 kJ/L	CFU/mL reduced from 103 to 1	[4]
E. coli, Enterococcus faecalis (E. faecalis) and Salmonella enteritidis	Inoculated solution	[H2O2] = 150 mg/L UV radiation Radiation dose = 500 mW s/cm2	Reduction of ~1.2–1.7 log	[13]
		[H2O2] = 35–50 mg/L UV-C radiation p = 230 W t = 60 min	CFU/100 mL reduce from 105 to 1	[19]
		[H2O2] = 50 mg/L Solar radiation I = 30 W/m2 T = 25 °C t = 15–60 min	CFU/mL reduce from 103 to 2	[26]
Acanthamoeba P31 and C1-211	Bacteria isolated from swimming pool and freshwater	[H2O2] = 170 mg/L Solar radiation I = 500 W/m2 t = 5 min	Reduction of 3 log	[24]
E. coli and total coliforms	Secondary wastewater generated in a pilot plant	[H2O2] = 90 mg/L Recirculation rate = 500 mL/min UV-C radiation Photonic flux = 9.5 × 10−7 Einstein/s p = 5 W t = 50 min	Reduction of 5–6 log	[25]
E. coli, bacteriophage MS2 and Bacillus spores	Inoculated water and wastewater	[H2O2] = 34–68 mg/L UV radiation Fluence rate = 2.2 × 10−7 Einstein/Ls	Log of inactivation/UV dose = 0.25 to 0.3 cm2/mJ for E. coli, ~0.1 cm2/mJ for bacteriophage MS2 and 0.65–0.9 cm2/mJ for Bacillus spores	[27]
E. coli	Simulated urban wastewater	[H2O2] = 150 mg/L UV radiation I = 500 W/m2 t = ~10 min pH = 7.0	Reduction of 4 log	[17,28]
		[H2O2] = 100 mg/L UV-C radiation I = 2.02 W/m2 Photonic flux = 0.1 μEinstein/s t = 10 min pH = 7.0–7.5	Reduction of 6 log	[17,28]
E. coli K-12	Distilled water (DW) Natural well water (NW) Simulated wastewater (SWW)	[H2O2] = 340 mg/L Solar radiation tDW = 0.5 h tNW = 1 h tSWW = 1.5 h QDW = 60 kJ/m2 QNW = 130 kJ/m2 QSWW = 190 kJ/m2	Reduction of 6 log	[29]
E. coli s	Inoculated urban wastewater, previously sterilized	[H2O2] = 50 mg/L Solar radiation Recirculation flow rate = 16 L/min t = 120 min QUV = 6.75 kJ/L	CFU/mL reduce from 105 to 2	[30]
Antibiotic resistant E. coli and E. faecalis	Inoculated urban wastewater, previously sterilized	[H2O2] = 20 mg/L Solar radiation QUV = 6.29 kJ/L for E. coli t = 120 min for E. coli QUV = 14.86 kJ/L for E. faecalis t = 240 min for E. faecalis	CFU/mL reduce from 106 to 2	[31]

. To the best of the authors’ knowledge, the use of this AOP for secondary urban wastewater disinfection, aiming at the inactivation of microorganisms present in real urban effluents, has only been addressed in a few studies in the open scientific literature [2,4,29,32,33]. Most of these studies only evaluated the application of the process under fixed conditions and only a few also evaluated the effect of a single variable (such as H₂O₂ concentration or UV-C radiation vs. sunlight). Therefore, the objectives of this work were (i) to find, through a detailed parametric analysis, the best operational parameters that maximize the inactivation of pathogenic bacteria and antibiotic resistance genes (ARGs) present in real urban secondary wastewater by the combined use of hydrogen peroxide with UV/visible radiation, (ii) to prevent the regrowth of microorganisms and the reactivation of ARGs after storage of the treated effluent (through competition between the microorganisms present in the treated effluent with the bacterial communities present in the river water), and (iii) to produce treated effluent that can be reused, namely in agriculture or urban applications. Most of these goals were herein addressed for the first time, emphasizing the novelty of this study.

2. Materials and Methods

2.1. Secondary Urban Effluent

In this work, the secondary urban wastewater (W) used was collected (between March 2023 and June 2024) after the coagulation/flocculation process in a WWTP located in the north of Portugal. In this WWTP, which serves 519,000 equivalent inhabitants, the influent is subjected to a preliminary screening step to remove sand and grease, and then a primary treatment by sedimentation is applied to separate settleable solids. Afterwards, an aerobic biological degradation by activated sludge is performed to remove the biodegradable organic matter, following secondary decantation to separate the biological sludge. Finally, before the effluent discharge into the environment, a coagulation/flocculation in a sand filter (where iron chloride is added to remove colloidal particles) is carried out.

2.2. Experimental Procedure

A batch photoreactor with a capacity of 250 mL made of glass was used to perform the various wastewater disinfection runs with hydrogen peroxide and/or radiation. The reactor is equipped with a UV/visible Heraeus TQ150 lamp—Noblelight GmbH, Hanau, Germany—(with a power of 150 W, which corresponds to an intensity (I) of 500 W/m², emitting in the 200–600 nm wavelengths range), which is located inside a quartz tube axially immersed in the reactor. To control the wastewater temperature, the quartz tube is jacketed and connected to a thermostatic bath (Huber, CC1).

A volume of 150 mL of effluent was added to the reactor, and after reaching the desired temperature, the pH was adjusted, when necessary, with sodium hydroxide—VWR Chemicals, Avantor Inc., Radnor, PA, USA, >98.5%—or sulfuric acid—Fluka, Honeywell, Charlotte, NC, USA, 95–98% (both 1 mol/L). Then, the desired amount of hydrogen peroxide (30% m/v from Supelco, Merck, Darmstadt, Germany) was added, and, finally, the lamp was turned on. This corresponds to zero time in the runs. During the reactions, agitation at 300 rpm was promoted to keep the wastewater inside the photoreactor homogenized. For that purpose, a magnetic bar and a stirring plate (Flac Instruments, Treviglio, Italy) were used. After 5 and 120 min of the beginning of the reaction, samples were taken to enumerate the cultivable enterobacteria. The runs under the best operating conditions were carried out with 800 mL of urban wastewater (also collected after the coagulation/flocculation process on three independent occasions) in a 1 L photoreactor equipped with a Heraeus (Noblelight GmbH, Hanau, Germany) TQ150 UV/visible lamp; the larger reactor and the volume of treated effluent were required for the various analytical determinations and procedures carried out (see below). In these assays, the total heterotrophs counts and genes quantification were also carried out at the end of the reaction (120 min) and after 3 days of storage. Before the storage, the physicochemical parameters were determined as well.

2.3. Analytical Methods

The cultivable enterobacteria and total heterotrophs enumeration (performed in the wastewater before and after treatment) was carried out using the membrane filtration method in triplicate. Samples were serially diluted, and 1 mL of the diluted samples, or up to a 10 mL sample, was filtrated using sterile cellulose nitrate membranes (Sartorius Stedium Biotech GmbH, Goettingen, Germany) with a porosity of 0.2 μm. The membranes were put on Difco Membrane Fecal Coliform (mFC) Agar or Plate Counting Agar (PCA, VWR Chemicals, Avantor Inc., Radnor, PA, USA) culture media for enterobacteria and total heterotroph enumeration, respectively, and incubated at 37 °C during 24 or 48 h for enterobacteria and total heterotroph, respectively. The colony-forming units (CFU) were enumerated, and the results were expressed in log (CFU/100 mL).

The quantification of the 16S rRNA, intl1, and antibiotic resistance genes (sul1, bla_TEM, and qnrS) was also carried out in triplicate at three independent times. Volumes ranging from 150 to 350 mL of each sample were filtered through polycarbonate membranes (0.22 µm porosity; Whatman, UK). DNA extraction was performed using the commercial Power Soil^® DNA Isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA). DNA quantification was done using a Qubit 3.0 Fluorometer (ThermoFisher Scientific, Waltham, MA, USA), and the extracts were stored at −20 °C until analysis by quantitative polymerase chain reaction (qPCR, StepOneTM Real-Time PCR System, Life Technologies, Carlsbad, CA, USA). This technique was used to measure the abundance (per mL of the sample) of the ARGs sul1, bla_TEM, and qnrS, encoding resistance against sulfonamides, beta-lactams, and quinolones, which were selected based on their prevalence in wastewater [34]. The intl1 gene, found in pathogenic and commensal bacteria of humans and domestic animals, is a recognized proxy for anthropogenic pollution and commonly associated with ARGs [35]. The 16S rRNA gene was quantified to assess the total bacteria abundance [36]. Based on SYBR Green detection, the protocols used have been described before [37,38], and primers information and qPCR conditions are listed in

Table 2. Conditions used in qPCR assays.

Target Gene	qPCR Standard	Primers	Primers (Sequence)Reference	Conditions	Efficiency (%)	Limit of Quantification (no. of Copies)	Reference
16S rRNA	Escherichia coli ATCC 25922	1114F	CGGCAACGAGCGCAACCC	95 °C for 10 min (1 cycle); 95 °C for 15 s, 55 °C for 20 s and 72 °C for 10 s (35 cycles)	94.0	144	[36]
		1275R	CCATTGTAGCACGTGTGTAGCC
intl1	clone intI1 (pNORM)	intI1-LC	GCCTTGATGTTACCCGAGAG	95 °C 10 min (1 cycle), 95 °C 15 s and 60 °C 1 min (40 cycles)	90.1	44	[39]
		intI1-LC5	GATCGGTCGAATGCGTGT
sul1	clone sul1(pNORM)	sul1-FW	CGCACCGGAAACATCGCTGCAC	95 °C for 5 min (1 cycle); 95 °C for 15 s and 60 °C for 1 min (35 cycles)	95.0	11	[40]
		sul1-RV	TGAAGTTCCGCCGCAAGGCTCG
qnrS	clone qnrS(pNORM)	qnrSrtF11	GACGTGCTAACTTGCGTGAT	95 °C for 5 min (1 cycle); 95 °C for 15 s and 60 °C for 1 min (40 cycles)	97.7	36	[41]
		qnrSrtR11	TGGCATTGTTGGAAACTTG
blaTEM	clone blaTEM(pNORM)	blaTEM-F	TTCCTGTTTTTGCTCACCCAG	95 °C for 10 min (1 cycle); 95 °C for 15 s, 60 °C for 1 min (40 cycles)	95.2	44	[42]
		blaTEM-R	CTCAAGGATCTTACCGCTGTTG

.

The pH measurement was carried out with a combined pH/T electrode (WTW SenTix 81) and a meter (WTW, inoLab level 2) according to the method 4500-H⁺ B [43]. Turbidity was determined according to the nephelometric method (2130 B [43]) using a Hanna Instruments, Bedfordshire, UK, turbidimeter (model HI88703-02).

Total suspended solids were quantified by gravimetry according to method 2540 D [43].

The biological oxygen demand (BOD) of the effluents corresponds to the fraction of biodegradable organic matter, which is determined by the oxygen consumed by microorganisms to degrade such organic compounds during 5 days at 20 °C. This parameter was determined by method 5210 D [43] using an OxiTop equipment (from WTW, Xylem, California, USA, S12 model) and an incubator (from WTW, Xylem, California, USA, OxiTop Box).

Ammonia (NH₃) was determined by the ion-selective electrode (method 4500—NH₃ D [43]) using a ThermoFisher Scientific, Waltham, MA, USA, electrode, model Orion 9512HPBNWP. Total nitrogen (N_total) was quantified by molecular absorption spectrophotometry after the samples digestion with persulfate (Method 4500 N. C [43]); the digestion permits converting organic nitrogen, ammonia, and nitrite into nitrate. The nitrate reacts with brucine and develops a yellow color, which is determined by absorbance at 410 nm (Method D992-71 [44]). For this purpose, a ThermoFisher Scientific, Waltham, MA, USA, model Helios γ spectrophotometer was used.

Samples were previously digested with ammonium persulfate to determine total phosphorus. Then, the reaction of phosphorus with ascorbic acid was promoted and a blue complex formed, whose color intensity was quantified by absorbance at 800 nm (colorimetric method—method 4500P—E [43]). For that, a ThermoFisher Scientific, Waltham, MA, USA, Helios γ spectrophotometer was utilized.

All analytical determinations were performed in duplicate, and the variation coefficient was less than 5%.

Microbiological and physical-chemical parameters were compared using one-way ANOVA followed by Tukey’s post hoc test (PAST v4. 0) [45].

3. Results and Discussion

3.1. Processes Screening

Three experiments were performed to understand the impact of the use of hydrogen peroxide and radiation alone, and the combination of both in the disinfection of the used wastewater. The first run only used hydrogen peroxide, the second one only UV/visible radiation, and in the last experiment, the oxidant and radiation were applied together.

Figure 1 shows the results obtained, where it is possible to observe that hydrogen peroxide alone was not very efficient in enterobacteria inactivation, since only a slight log (CFU/100 mL) reduction (from 6.3 for raw wastewater to 5.1 after treatment) was achieved, independently of the contact time (5 or 120 min). The low disinfection efficiency achieved is associated with the low oxidation potential of hydrogen peroxide (+1.78 eV [46]). An improvement in enterobacteria inactivation was reached when applying UV/visible radiation in secondary urban wastewater disinfection, which allowed the reduction of the log (CFU/100 mL) from ca. 6.6 to 4.5 and 3.2 after 5 and 120 min, respectively. Indeed, UV radiation is a well-described mutagen [25]. However, direct photolysis per se was not efficient enough to produce treated effluent that met the legal microbiological parameters for Class A (urban and agricultural uses) imposed by Portuguese and European legislation for wastewater reuse (see blue dashed line in Figure 1) [47,48].

Hydrogen peroxide combined with UV/visible radiation allowed the highest bacterial inactivation to be achieved, with the final log (CFU/100 mL), i.e., after 120 min of reaction, below the threshold of the legal parameter (log (CFU/100 mL) < 1). The improved disinfection efficiency achieved with this process is due to the generation of hydroxyl radicals from the photolysis of hydrogen peroxide (Equation (1)); these radicals have a very high oxidation potential (+2.80 eV [46]) and are responsible for promoting damage to membranes, DNA, and enzymes, leading to cell damage [49] and, consequently, cell lysis. These results demonstrate the importance of the combination of hydrogen peroxide and radiation for the elimination of enterobacteria from wastewater. Identical results are reported by other authors when studying the inactivation of different microorganisms [13,24,27,28,32].

3.2. Parametric Study

The parametric study aimed to evaluate the effect of several process variables, namely, hydrogen peroxide concentration, pH, temperature, and radiation intensity, on the reduction of enterobacteria abundance. Firstly, the concentration of hydrogen peroxide was varied in the range 50 to 125 mg/L. A significant reduction in the abundance of enterobacteria occurred after 5 min, and the maximum process efficiency was achieved with 75 mg/L of H₂O₂ (Figure 2). For a reaction time of 120 min, enterobacteria were inactivated to values below the detection limit (10 CFU/100 mL) for all peroxide concentrations ≤ 100 mg/L. The appearance of an optimum concentration of hydrogen peroxide is due to the undesirable reaction that occurs between the excess oxidant and the radicals (Equation (2)), which drastically reduces the amount of HO^• available to inactivate the bacteria:

$${\mathrm{H}}_2{\mathrm{O}}_2+{\mathrm{HO}}^{•}\to {\mathrm{HO}}_2^{•}+{\mathrm{H}}_2$$

(2)

Although ${ \mathrm{HO}}_2^{•}$ species are formed, their oxidation potential (1.70 eV) is lower than that of ${\mathrm{HO}}^{•}$ (2.80 eV) [46]. Studies reported in the literature show similar trends to those observed in this work, reaching an optimum hydrogen peroxide concentration that allows maximizing microbial inactivation [32]. Other authors report the appearance of a plateau for the oxidant concentration, beyond which the inactivation of microorganisms does not improve [31]. On the basis of the results obtained, a hydrogen peroxide concentration of 75 mg/L was chosen for the following disinfection experiments because it allows the reduction of enterobacteria to values below those established for Class A water reuse [47,48], even after only 5 min of reaction (Figure 2).

The influence of pH was also assessed as it has both a direct effect on microorganisms and an influence on the efficiency of the treatment process used. Therefore, the initial pH was varied from 5.0 to 7.0 to allow the treatment process to operate close to neutral, which is the pH zone where the enterobacteria are not sensitive [50,51]. In addition, and more importantly, treated wastewater must be neutral for reuse in urban applications and/or irrigation [47,48]. Therefore, the pH of the effluent was adjusted at the beginning of the reaction, for the tests at pH = 5.0 and pH = 7.0. The inactivation efficiency of enterobacteria decreased with the initial pH increase during the first 5 min of the reaction, and after 120 min of reaction, these bacteria were only countable at pH 7.0 (Figure 3). The elimination of enterobacteria at pH 5.0 (or 6.3, the pH of the used secondary effluent, here called “natural”) was due to the presence of hydroxyl radicals generated by the reaction and was not directly related to the pH adjustment, since in the control run at pH 5.0 (without any addition of oxidant or irradiation), the decrease in log (CFU/100 mL) was insignificant (Figure 3). The reduction in the disinfection process’ efficiency observed is most probably related to the fact that higher pH values improve the decomposition of the oxidant into water and oxygen (Equation (3)) [52], leading to a reduction in the concentration of available oxidant and consequently lower amounts of hydroxyl radicals being formed:

$${2\mathrm{H}}_2{\mathrm{O}}_2\to {\mathrm{O}}_2+{2\mathrm{H}}_2\mathrm{O}$$

(3)

For the subsequent experiments, the natural pH of the wastewater (6.3) was selected. On the one hand, it allows the production of treated effluent that meets the microbial count required by the legislation for Class A wastewater for reuse [47,48]. On the other hand, it is economically more advantageous as it is not necessary to adjust the pH before and after disinfection, thus reducing the costs associated with the consumption of acid and base.

This study also evaluated the influence of temperature on the efficiency of the treatment process by varying this process variable between 15 and 25 °C. The minimum and maximum values correspond to the average water temperatures in this WWTP in winter and summer, respectively.

The inactivation of enterobacteria increased with temperature: at 15 °C, the log (CFU/100 mL) values were reduced from 6.5 for the urban effluent to 3.9 after 120 min of reaction, whereas, at 25 °C, values decreased from 6.5 to <1 after 120 min of oxidation (Figure 4). Although all the temperatures tested allowed a reduction in the abundance of enterobacteria, only the temperature of 25 °C produced a treated effluent that met the microbiological parameters set by the legislation for Class A effluent for reuse [47,48] (cf. dashed blue line in Figure 4). The increase in the efficiency of the process with temperature is most probably related to the improvement in the kinetic constants of all the reactions, particularly for the formation of hydroxyl radicals and bacterial inactivation, according to the Arrhenius law. From the results obtained, it can be concluded that the disinfection process is more efficient in summer than in winter.

The last parameter evaluated was the radiation intensity, which is also quite relevant because it plays an important role in the efficiency of the H₂O₂+UV/visible oxidation process. For this purpose, experiments were performed with varying intensities from 100 up to 500 W/m². The two lowest intensities tested (100 and 150 W/m²) correspond to the minimum and maximum solar radiation incidence in the north of Portugal [53]. However, higher intensities, including the maximum emitted by the TQ150 lamp (500 W/m²), were tested to be able to extrapolate the results reached with this disinfection process for other regions/countries where the incidence of solar radiation is much higher. As expected, the process efficiency was more pronounced as the light intensity increased (Figure 5). This increase in enterobacterial inactivation is related to the improvement in hydroxyl radical formation, according to Equation (1). Only at an irradiation intensity of 500 W/m² was it possible to produce an effluent that complied with the Escherichia coli level required for water reuse (irrespective of the 5-min or 120-min runs), since only under these conditions was the number of CFUs per 100 mL below the legal limit (<10 CFU/mL) [47,48]). It is possible that lower intensities of irradiation would also allow this standard to be achieved but would require longer reaction times, which were not tested. The results herein obtained are in agreement with other works available in the literature, namely those combining solar light with H₂O₂ for the inactivation of E. coli from simulated urban wastewater [17] or using H₂O₂ with UV radiation for the inactivation of MS2 coliphage and Enterococcus faecalis [27].

The parametric study made it possible to select the best operating conditions ([H₂O₂] = 75 mg/L, natural pH, T = 25 °C, use of UV/visible radiation and I = 500 W/m²) to perform the disinfection process, which made it possible to achieve a reduction in the abundance of enterobacteria to log values below the detection limit (10 CFU/100 mL), i.e., a log reduction of ~6.5. The value obtained is higher than those reported in other studies available in the literature (log reduction of 1.2–6.0) when this disinfection technology (H₂O₂ + radiation) was used to inactivate different bacteria [4,13,17,19,24,25,26,28,29,30,31] or when other AOPs were used—e.g., persulfate activated by graphene oxide, photo-Fenton, or Fenton [54,55,56,57]. However, it is within the range of other studies that have used persulfate-based oxidation [54,58], coagulation/flocculation plus Fenton [59], or ozonation [38] to treat urban wastewater, but such processes are, in principle, more complex.

3.3. Effect of the Dilution of Treated Water with River Water on the Activation of Genes and the Regrowth of Microorganisms

In a wastewater reuse scenario, it is important to assess the quality of the treated wastewater after storage, as microbial regrowth may occur during this period [4,25,32,34,38,54,60]. For that, three runs were performed using the best operating conditions previously identified, with secondary effluent being collected for three consecutive weeks, after which the treated effluent was stored in the dark at room temperature for 3 days. This storage period was selected taking into account that the WWTP may not supply treated effluent at weekends.

As expected, the oxidation treatment reduced (p < 0.05) total heterotrophs and enterobacteria to levels below the detection limit (10 CFU/100 mL) in the treated water, hereafter referred to as TW (compare W with TW samples, Figure 6a). Accordingly, there was a decrease in the abundance of total bacteria, as well as in the abundance of the intl1, qnrS, and bla_TEM genes (compare W with TW samples, Figure 6b,c), reaching values lower than the detection limit (log copy number/100 mL < 3.46) for the qnrS and bla_TEM genes. Similar results were reported by Michael et al. [4], who observed a reduction on the abundance of total bacteria and the ARG genes sul1, sul2, tetM bla_OXA-A, bla_TEM, bla_SHV, and qnrS when applying hydrogen peroxide combined with UV-C radiation.

However, upon storage of TW, a regrowth (p < 0.05) of enterobacteria and total heterotrophs was observed (TW3d, Figure 6a), reaching values close to those recorded for the initial wastewater sample (W, Figure 6a). Other authors have reported the microbial regrowth using the same or similar oxidation processes [4,25,32]. Bacterial regrowth is probably related to the ability of injured microorganisms to recover and/or their ability to enter latency during disinfection [25].

To prevent the regrowth of enterobacteria, which includes potentially pathogenic microorganisms, river water (R), with a diverse microbial community, was used to dilute the treated wastewater (TW). The rationale behind this process is the competition between environmental microorganisms inhabiting the surface water and the potentially pathogenic microorganisms that survive the oxidation treatment [38,60]. In fact, no regrowth of enterobacteria was observed (p < 0.05) after 3 days of storage of TW diluted with RW 50%(v/v) (R+TW3d, Figure 6a). Inhibition of enterobacteria regrowth using the same proportion of river water and treated wastewater has been reported previously by our group in other studies using different oxidation technologies (ozonation and persulfate activation by UV/visible radiation) [38,60]. For this sample (R+TW3d), the abundance of enterobacteria was lower than 1 CFU/100 mL, which is lower than the value established in the European legislation for water reuse—10 CFU/100 mL [47,48].

However, a significant increase in the abundance of total heterotrophs (p < 0.05) was observed during storage of TW diluted with RW 50% (v/v) (sample R+TW3d, Figure 6a). Accordingly, the abundance of total bacteria and intl1 also increased (p < 0.05) during storage of TW diluted with RW 50% (v/v), reaching values similar to those found in river water (Figure 6b). Interestingly, storage of TW diluted with RW 50%(v/v) had different effects on the abundance of each analyzed ARG. The abundance of the qnrS and the sul1genes did not increase, showing values similar to those determined in TW (Figure 6c). In contrast, a 2-log increase was observed for the bla_TEM gene_. Altogether, these results suggest that storage of TW diluted with RW 50% (v/v) promoted the decrease of some bacterial groups, such as enterobacteria, but promoted the increase in the proliferation of others.

3.4. Effect of the Dilution of Treated Water with River Water on Physicochemical Parameters of the Effluent

The physicochemical composition of W and W3d, R and R3d, or TW and TW3d was almost identical. Therefore, for the sake of brevity, only the data of the samples analyzed after 3 days of storage alone or mixed with river water are presented in

Table 3. Physicochemical characteristics of river water (R3d), secondary wastewater (W3d), treated secondary wastewater (TW3d), and treated secondary wastewater diluted with river water by 50% (R+TW 3d) after 3 days of storage. Significantly different values are indicated by the letters a–d for distinct samples (one-way ANOVA followed by Tukey’s post hoc test, p < 0.05). Limits imposed by European and Portuguese legislation for water reuse in irrigation and urban utilities are also included.

Parameter	R3d	W3d	TW3d	R+TW3d	Limits Imposed [47,48]
					Irrigation (1)	Urban Utilities
TOC (mgC/L)	3.1 ± 0.03 a	12.2 ± 0.1 b	9.5 ± 0.1 c	4.6 ± 0.1 d	-
COD (mgO2/L)	4.1 ± 0.3 a	30.5 ± 0.4 b	22.1 ± 1.0 c	10.5 ± 0.5 d	-	-
BOD5 (mgO2/L)	1.0 ± 0.1 a	8.7 ± 0.6 b	5.3 ± 0.6 c	2.2 ± 1.1 a	<10	<25
Turbidity (NTU)	1.3 ± 0.1 a	12.0 ± 0.9 b	5.9 ± 0.1 c	4.2 ± 0.1 d	<5	<5
TSS (mg/L)	5.0 ± 0.5 a	24.0 ± 1.0 b	12.0 ± 0.9 c	8.3 ± 1.2 d	<10	-
NTotal (mgN/L)	1.7 ± 0.1 a	33.2 ± 0.1 b	32.5 ± 0.4 c	19.1 ± 0.7 d	<15 (2)	-
NH3 (mgNH4+/L)	<0.1 ± 0.1 a	15.6 ± 1.3 b	10.7 ± 1.2 c	6.7 ± 0.7 d	<10 (2)	<5 (3)
PTotal (mgP/L)	<0.05 ± 0.1 a	4.8 ± 0.4 b	3.3 ± 0.2 c	2.1 ± 0.1 d	<5	<2
pH	7.0 ± 0.1 a	6.7 ± 0.2 b	6.8 ± 0.1 c	6.8 ± 0.1 c	-	6.0–9.0

Notes: (1) Limits for water, class A. (2) Optional parameter. Might apply to some irrigation projects to minimize the risks of biofilm formation and obstruction of irrigation systems. (3) Only applicable for recreational uses of landscape setting and cooling waters.

. In the secondary effluent (W3d), a low organic load (evaluated by COD, TOC, and BOD₅) was present, and a significant decrease (p < 0.05) was observed after the disinfection process (sample TW3d) (Table 3). Therefore, it can be stated that the organic matter was degraded simultaneously with the inactivation of the microorganism. It is worth noting that the BOD₅ values of treated wastewater with or without river water dilution were lower than the legal values for water reuse. In turn, the R+TW3d sample had lower COD and TOC values than TW (p < 0.05) due to the dilution effect with river water, which had the lowest concentrations (p < 0.05). A significant reduction in turbidity (p < 0.05) and TSS was observed after the oxidation process; this reduction is associated with the deposition of solids during the storage period. R+TW3d had lower turbidity and TSS values than TW3d due to the effect of dilution with R3d. The R+TW3d sample meets the legal values for the reuse of treated water in agriculture and urban applications [47,48] for turbidity and TSS.

The treatment reduced the total phosphorus concentration (p < 0.05), and all samples (R3d, W3d, TW3d, and R+TW3d) complied with the legal values for water reuse (see Table 3). In contrast, the total nitrogen and ammonia were above the reuse limits (Table 3). However, these last parameters are optional to minimize biofilm formation or when the water is used for cooling and landscaping for recreational purposes.

In view of the promising results obtained, it should be noted that further studies should be carried out before implementing this disinfection technology in wastewater treatment plants. First, a pilot installation should be designed to carry out larger-scale disinfection runs to estimate the volume of wastewater to be treated and to carry out the corresponding technical-economic assessment. When implementing such treatment technology at higher TRL, E. coli, pH, total and ammonia nitrogen, total phosphorus, turbidity, total suspended solids, and BOD should be evaluated daily in order to assess the efficiency of the process and whether the treated wastewater is suitable for reuse due to the heterogeneity of urban wastewater.

4. Conclusions

Disinfection of wastewater for reuse in agriculture and municipal services is a very important approach to protect the environment and public health and to combat water scarcity. It is, therefore, essential to implement an effective and cost-effective technology to inactivate harmful pathogenic microorganisms and, thus, the ARGs they carry. This study evaluated the application of the hydrogen peroxide-based oxidation combined with radiation as a disinfection process for implementation as a tertiary treatment in urban WWTPs. The research work allowed us to conclude that the use of hydrogen peroxide or UV radiation alone was inefficient for inactivating enterobacteria present in secondary urban wastewater. On the other hand, the total inactivation of enterobacteria and heterotrophs inactivation, together with the reduction of genes (except sul1), were achieved after 120 min of reaction when the H₂O₂+UV/visible radiation process was performed under the best operating conditions ([H₂O₂] = 75 mg/L, natural pH of the wastewater, T = 25 °C, UV/visible radiation, and I = 500 W/m²). However, after storage of the treated wastewater, the cultivable microorganisms regrow and there is a slight increase in the 16S rRNA and sul1 genes, making it impossible to reuse the wastewater. The competition between the microorganisms present in the river water and the treated wastewater (sample R+TW) prevented the regrowth of enterobacteria and the increase in the abundance of the qnrS gene during storage. Therefore, the R+TW sample can be reused for urban or agricultural purposes, as it meets the values required by Portuguese and European legislation.