Innovative Multiplex PCR Assay for Detection of tlh, trh, and tdh Genes in Vibrio parahaemolyticus with Reference to the U.S. FDA’s Bacteriological Analytical Manual (BAM)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacteria, Genomic DNA, and Primers
2.2. Multiplex PCR Condition
2.3. Optimization, Sensitivity, and Specificity of Multiplex PCR Assay
3. Results and Discussion
3.1. Multiplex PCR Assay of BAM and Bej et al. [11]
3.2. Optimization of the Current Multiplex PCR
3.3. Sensitivity and Specificity of Our Multiplex PCR
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Su, Y.-C.; Liu, C. Vibrio parahaemolyticus: A concern of seafood safety. Food Microbiol. 2007, 24, 549–558. [Google Scholar] [CrossRef] [PubMed]
- DePaola, A.; Nordstrom, J.L.; Bowers, J.C.; Wells, J.G.; Cook, D.W. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Appl. Environ. Microbiol. 2003, 69, 1521–1526. [Google Scholar] [CrossRef]
- Froelich, B.A.; Noble, R.T. Vibrio bacteria in raw oysters: Managing risks to human health. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150209. [Google Scholar] [CrossRef] [PubMed]
- Broberg, C.A.; Calder, T.J.; Orth, K. Vibrio parahaemolyticus cell biology and pathogenicity determinants. Microbes Infect. 2011, 13, 992–1001. [Google Scholar] [CrossRef] [PubMed]
- Andrews, L. Strategies to control Vibrios in molluscan shellfish. Food Prot. Trends 2004, 24, 70–76. [Google Scholar]
- Nordstrom, J.; Kaysner, C.; Blackstone, G.; Vickery, M.; Bowers, J.; DePaola, A. Effect of intertidal exposure on Vibrio parahaemolyticus levels in Pacific Northwest oysters. J. Food Prot. 2004, 67, 2178–2182. [Google Scholar] [CrossRef]
- Martinez-Urtaza, J.; Baker-Austin, C.; Jones, J.L.; Newton, A.E.; Gonzalez-Aviles, G.D.; DePaola, A. Spread of Pacific northwest Vibrio parahaemolyticus strain. N. Engl. J. Med. 2013, 369, 1573–1574. [Google Scholar] [CrossRef]
- Newton, A.E.; Garrett, N.; Stroika, S.G.; Halpin, J.L.; Turnsek, M.; Mody, R.K. Notes from the field: Increase in Vibrio parahaemolyticus infections associated with consumption of atlantic coast shellfish-2013. MMWR Morb. Mortal. Wkly. Rep. 2014, 63, 335–336. [Google Scholar]
- DePaola, A. Managing Vibrio Risk in Oysters. Food Prot. Trends 2019, 39, 338–347. [Google Scholar]
- Kaysner, C.A.; DePaola, A.; Jones, J. Bacteriological Analytical Manual Chapter 9: Vibrio. Food and Drug Administration, Silver Spring, Maryland. 2019. Available online: https://www.fda.gov/food/laboratory-methods-food/bam-chapter-9-vibrio (accessed on 6 May 2024).
- Bej, A.K.; Patterson, D.P.; Brasher, C.W.; Vickery, M.C.; Jones, D.D.; Kaysner, C.A. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tlh, tdh and trh. J. Microbiol. Methods 1999, 36, 215–225. [Google Scholar] [CrossRef]
- Nordstrom, J.L.; Vickery, M.C.; Blackstone, G.M.; Murray, S.L.; DePaola, A. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 2007, 73, 5840–5847. [Google Scholar] [CrossRef]
- Park, S.B.; Zhang, Y. Development of Multienzyme Isothermal Rapid Amplification (MIRA) Combined with Lateral-Flow Dipstick (LFD) Assay to Detect Species-Specific tlh and Pathogenic trh and tdh Genes of Vibrio parahaemolyticus. Pathogens 2024, 13, 57. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, J.; Jiang, T.; Bao, Y.; Zhou, X. Insufficiency of the Kanagawa hemolytic test for detecting pathogenic Vibrio parahaemolyticus in Shanghai, China. Diagn. Microbiol. Infect. Dis. 2011, 69, 7–11. [Google Scholar]
- Shirai, H.; Ito, H.; Hirayama, T.; Nakamoto, Y.; Nakabayashi, N.; Kumagai, K.; Takeda, Y.; Nishibuchi, M. Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis. Infect. Immun. 1990, 58, 3568–3573. [Google Scholar] [CrossRef]
- Sun, J.; Li, X.; Hu, Z.; Xue, X.; Zhang, M.; Wu, Q.; Zhang, W.; Zhang, Y.; Lu, R. Characterization of Vibrio parahaemolyticus isolated from stool specimens of diarrhea patients in Nantong, Jiangsu, China during 2018–2020. PLoS ONE 2022, 17, e0273700. [Google Scholar] [CrossRef] [PubMed]
- Markoulatos, P.; Siafakas, N.; Moncany, M. Multiplex polymerase chain reaction: A practical approach. J. Clin. Lab. Anal. 2002, 16, 47–51. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.T.; Kim, Y.-O.; Kong, I.-S. Multiplex PCR for the detection and differentiation of Vibrio parahaemolyticus strains using the groEL, tdh and trh genes. Mol. Cell. Probes 2013, 27, 171–175. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Tang, J.; Liu, J.; Cai, Z.; Bai, X. Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J. Appl. Microbiol. 2012, 112, 823–830. [Google Scholar] [CrossRef]
- Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 1–19. [Google Scholar] [CrossRef]
- Bintsis, T. Foodborne pathogens. AIMS Microbiol. 2017, 3, 529. [Google Scholar] [CrossRef]
- Priyanka, B.; Patil, R.K.; Dwarakanath, S. A review on detection methods used for foodborne pathogens. Indian J. Med. Res. 2016, 144, 327–338. [Google Scholar] [CrossRef] [PubMed]
Names | Genes | Sequences (5′-3′) | Size (bp) | References |
---|---|---|---|---|
VP_TLH_L | tlh | AAAGCGGATTATGCAGAAGCACTG | 450 | [11] |
VP_TLH_R | GCTACTTTCTAGCATTTTCTCTGC | |||
VP_TRH_L | trh | TTGGCTTCGATATTTTCAGTATCT | 486 | |
VP_TRH_R | CATAACAAACATATGCCCATTTCCG | |||
VP_TDH_L | tdh | GTAAAGGTCTCTGACTTTTGGAC | 270 | |
VP_TDH_R | TGGAATAGAACCTTCATCTTCACC | |||
VP_TLH_F2 | tlh | CTCAGTTTAAGTACTCAACACAAGAAGAGAT | 369 | This study and [11] |
VP_TLH_R2 | CTAAGTTGTTGCTACTTTCTAGCATTTTCT | |||
VP_TLH_F2 | tlh | CTCAGTTTAAGTACTCAACACAAGAAGAGAT | 359 | |
VP_TLH_R | GCTACTTTCTAGCATTTTCTCTGC | |||
VP_TLH_L | tlh | AAAGCGGATTATGCAGAAGCACTG | 403 | |
VP_TLH_R2 | CTAAGTTGTTGCTACTTTCTAGCATTTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.B.; Zhang, Y. Innovative Multiplex PCR Assay for Detection of tlh, trh, and tdh Genes in Vibrio parahaemolyticus with Reference to the U.S. FDA’s Bacteriological Analytical Manual (BAM). Pathogens 2024, 13, 774. https://doi.org/10.3390/pathogens13090774
Park SB, Zhang Y. Innovative Multiplex PCR Assay for Detection of tlh, trh, and tdh Genes in Vibrio parahaemolyticus with Reference to the U.S. FDA’s Bacteriological Analytical Manual (BAM). Pathogens. 2024; 13(9):774. https://doi.org/10.3390/pathogens13090774
Chicago/Turabian StylePark, Seong Bin, and Yan Zhang. 2024. "Innovative Multiplex PCR Assay for Detection of tlh, trh, and tdh Genes in Vibrio parahaemolyticus with Reference to the U.S. FDA’s Bacteriological Analytical Manual (BAM)" Pathogens 13, no. 9: 774. https://doi.org/10.3390/pathogens13090774
APA StylePark, S. B., & Zhang, Y. (2024). Innovative Multiplex PCR Assay for Detection of tlh, trh, and tdh Genes in Vibrio parahaemolyticus with Reference to the U.S. FDA’s Bacteriological Analytical Manual (BAM). Pathogens, 13(9), 774. https://doi.org/10.3390/pathogens13090774