Role of Probiotics in Gut Microbiome and Metabolome in Non-Alcoholic Fatty Liver Disease Mouse Model: A Comparative Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Models
2.2. Analyses Biochemical
2.3. Histological Examination
2.4. RNA Extraction and RT–qPCR Analysis
2.5. Gut Microbial Sequencing and Data Processing
2.6. Hepatic Metabolomics Analysis
2.7. Statistical Analysis
3. Results
3.1. A. muciniphila Has a Stronger Effect on Reducing Liver Lipid Accumulation in NAFLD Mice Than Does VSL#3
3.2. VSL#3 Treatment Improved Intestinal Damage and Gut Barrier Function Better, as Compared to A. muciniphila
3.3. A. muciniphila and VSL#3 Treatments Both Changed the Makeup of the Intestinal Flora in NASH Mice
3.4. Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) to Predict Microbial Functional Pathways
3.5. Alterations in Metabolism among the Four Groups Induced by Diets and Probiotics Supplement
3.6. Analysis of the Cross-Correlation between Metabolites and Intestinal Flora
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cholongitas, E.; Pavlopoulou, I.; Papatheodoridi, M.; Markakis, G.E.; Bouras, E.; Haidich, A.-B.; Papatheodoridis, G. Epidemiology of nonalcoholic fatty liver disease in Europe: A systematic review and meta-analysis. Ann. Gastroenterol. 2021, 34, 404. [Google Scholar] [CrossRef]
- Rojano, A.; Sena, E.; Manzano-Nuñez, R.; Pericàs, J.M.; Ciudin, A. NAFLD as the metabolic hallmark of obesity. Intern. Emerg. Med. 2023, 18, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Tacke, F.; Arrese, M.; Chander Sharma, B.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Yilmaz, Y.; George, J.; Fan, J. Global perspectives on nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [PubMed]
- Raza, S.; Rajak, S.; Anjum, B.; Sinha, R.A. Molecular links between non-alcoholic fatty liver disease and hepatocellular carcinoma. Hepatoma Res. 2019, 5, 42. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Yu, C.-H.; Li, X.-J.; Yao, J.-M.; Fang, Z.-Y.; Yoon, S.-H.; Yu, W.-Y. Gut dysbiosis in nonalcoholic fatty liver disease: Pathogenesis, diagnosis, and therapeutic implications. Front. Cell. Infect. Microbiol. 2022, 12, 997018. [Google Scholar] [CrossRef] [PubMed]
- Ore, A.; Akinloye, O.A. Phytotherapy as multi-hit therapy to confront the multiple pathophysiology in non-alcoholic fatty liver disease: A systematic review of experimental interventions. Medicina 2021, 57, 822. [Google Scholar] [CrossRef] [PubMed]
- Hoozemans, J.; de Brauw, M.; Nieuwdorp, M.; Gerdes, V. Gut microbiome and metabolites in patients with NAFLD and after bariatric surgery: A comprehensive review. Metabolites 2021, 11, 353. [Google Scholar] [CrossRef] [PubMed]
- Nawrot, M.; Peschard, S.; Lestavel, S.; Staels, B. Intestine-liver crosstalk in Type 2 Diabetes and non-alcoholic fatty liver disease. Metabolism 2021, 123, 154844. [Google Scholar] [CrossRef] [PubMed]
- Jadhav, K.; Cohen, T.S. Can you trust your gut? Implicating a disrupted intestinal microbiome in the progression of NAFLD/NASH. Front. Endocrinol. 2020, 11, 592157. [Google Scholar] [CrossRef] [PubMed]
- Alisi, A.; Bedogni, G.; Baviera, G.; Giorgio, V.; Porro, E.; Paris, C.; Giammaria, P.; Reali, L.; Anania, F.; Nobili, V. Randomised clinical trial: The beneficial effects of VSL# 3 in obese children with non-alcoholic steatohepatitis. Aliment. Pharmacol. Ther. 2014, 39, 1276–1285. [Google Scholar] [PubMed]
- Han, Y.; Ling, Q.; Wu, L.; Wang, X.; Wang, Z.; Chen, J.; Zheng, Z.; Zhou, Z.; Jia, L.; Li, L. Akkermansia muciniphila inhibits nonalcoholic steatohepatitis by orchestrating TLR2-activated γδT17 cell and macrophage polarization. Gut Microbes 2023, 15, 2221485. [Google Scholar] [CrossRef] [PubMed]
- Naudin, C.R.; Maner-Smith, K.; Owens, J.A.; Wynn, G.M.; Robinson, B.S.; Matthews, J.D.; Reedy, A.R.; Luo, L.; Wolfarth, A.A.; Darby, T.M. Lactococcus lactis subspecies cremoris elicits protection against metabolic changes induced by a western-style diet. Gastroenterology 2020, 159, 639–651.e5. [Google Scholar] [CrossRef] [PubMed]
- Chong, C.Y.L.; Orr, D.; Plank, L.D.; Vatanen, T.; O’Sullivan, J.M.; Murphy, R. Randomised double-blind placebo-controlled trial of inulin with metronidazole in non-alcoholic fatty liver disease (NAFLD). Nutrients 2020, 12, 937. [Google Scholar] [CrossRef] [PubMed]
- Vrieze, A.; Van Nood, E.; Holleman, F.; Salojärvi, J.; Kootte, R.S.; Bartelsman, J.F.; Dallinga–Thie, G.M.; Ackermans, M.T.; Serlie, M.J.; Oozeer, R. Transfer of intestinal microbiota from lean donors increases insulin sensitivity in individuals with metabolic syndrome. Gastroenterology 2012, 143, 913–916.e7. [Google Scholar] [CrossRef] [PubMed]
- Sanders, M.E. Probiotics: Definition, sources, selection, and uses. Clin. Infect. Dis. 2008, 46, S58–S61. [Google Scholar] [CrossRef] [PubMed]
- Szajewska, H.; Hojsak, I. Health benefits of Lactobacillus rhamnosus GG and Bifidobacterium animalis subspecies lactis BB-12 in children. Postgrad. Med. 2020, 132, 441–451. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Liu, L.; Liu, Q.; Li, F.; Zhang, L.; Zhu, F.; Shao, T.; Barve, S.; Chen, Y.; Li, X. Fibroblast growth factor 21 is required for the therapeutic effects of Lactobacillus rhamnosus GG against fructose-induced fatty liver in mice. Mol. Metab. 2019, 29, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Mobini, R.; Tremaroli, V.; Ståhlman, M.; Karlsson, F.; Levin, M.; Ljungberg, M.; Sohlin, M.; Bertéus Forslund, H.; Perkins, R.; Bäckhed, F. Metabolic effects of L actobacillus reuteri DSM 17938 in people with type 2 diabetes: A randomized controlled trial. Diabetes Obes. Metab. 2017, 19, 579–589. [Google Scholar] [CrossRef]
- Hsu, Y.-J.; Wu, M.-F.; Lee, M.-C.; Huang, C.-C. Exercise training combined with Bifidobacterium longum OLP-01 treatment regulates insulin resistance and physical performance in db/db mice. Food Funct. 2021, 12, 7728–7740. [Google Scholar] [CrossRef] [PubMed]
- Oniszczuk, A.; Oniszczuk, T.; Gancarz, M.; Szymańska, J. Role of gut microbiota, probiotics and prebiotics in the cardiovascular diseases. Molecules 2021, 26, 1172. [Google Scholar] [CrossRef]
- Sanchez-Rodriguez, E.; Egea-Zorrilla, A.; Plaza-Díaz, J.; Aragón-Vela, J.; Muñoz-Quezada, S.; Tercedor-Sánchez, L.; Abadia-Molina, F. The gut microbiota and its implication in the development of atherosclerosis and related cardiovascular diseases. Nutrients 2020, 12, 605. [Google Scholar] [CrossRef] [PubMed]
- Derrien, M.; Vaughan, E.E.; Plugge, C.M.; de Vos, W.M. Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 2004, 54, 1469–1476. [Google Scholar] [CrossRef] [PubMed]
- Yoon, H.S.; Cho, C.H.; Yun, M.S.; Jang, S.J.; You, H.J.; Kim, J.-h.; Han, D.; Cha, K.H.; Moon, S.H.; Lee, K. Akkermansia muciniphila secretes a glucagon-like peptide-1-inducing protein that improves glucose homeostasis and ameliorates metabolic disease in mice. Nat. Microbiol. 2021, 6, 563–573. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.; Kuang, Z.; Li, C.; Guo, S.; Xu, Y.; Zhao, D.; Hu, Y.; Song, B.; Jiang, Z.; Ge, Z. Gut Akkermansia muciniphila ameliorates metabolic dysfunction-associated fatty liver disease by regulating the metabolism of L-aspartate via gut-liver axis. Gut Microbes 2021, 13, 1927633. [Google Scholar] [CrossRef] [PubMed]
- Plovier, H.; Everard, A.; Druart, C.; Depommier, C.; Van Hul, M.; Geurts, L.; Chilloux, J.; Ottman, N.; Duparc, T.; Lichtenstein, L. A purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nat. Med. 2017, 23, 107–113. [Google Scholar] [CrossRef] [PubMed]
- Ashrafian, F.; Shahriary, A.; Behrouzi, A.; Moradi, H.R.; Keshavarz Azizi Raftar, S.; Lari, A.; Hadifar, S.; Yaghoubfar, R.; Ahmadi Badi, S.; Khatami, S. Akkermansia muciniphila-derived extracellular vesicles as a mucosal delivery vector for amelioration of obesity in mice. Front. Microbiol. 2019, 10, 483128. [Google Scholar] [CrossRef]
- Kim, S.; Lee, Y.; Kim, Y.; Seo, Y.; Lee, H.; Ha, J.; Lee, J.; Choi, Y.; Oh, H.; Yoon, Y. Akkermansia muciniphila prevents fatty liver disease, decreases serum triglycerides, and maintains gut homeostasis. Appl. Environ. Microbiol. 2020, 86, e03004–e03019. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastro. Hepatol. 2022, 19, 625–637. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Kissoon-Singh, V.; Coria, A.L.; Moreau, F.; Chadee, K. Probiotic mixture VSL# 3 reduces colonic inflammation and improves intestinal barrier function in Muc2 mucin-deficient mice. Am. J. Physiol.-Gastrointest. Liver Physiol. 2017, 312, G34–G45. [Google Scholar] [PubMed]
- Jones, R.B.; Alderete, T.L.; Martin, A.A.; Geary, B.A.; Hwang, D.H.; Palmer, S.L.; Goran, M.I. Probiotic supplementation increases obesity with no detectable effects on liver fat or gut microbiota in obese Hispanic adolescents: A 16-week, randomized, placebo-controlled trial. Pediatr. Obes. 2018, 13, 705–714. [Google Scholar] [CrossRef] [PubMed]
- Velayudham, A.; Dolganiuc, A.; Ellis, M.; Petrasek, J.; Kodys, K.; Mandrekar, P.; Szabo, G. VSL# 3 probiotic treatment attenuates fibrosis without changes in steatohepatitis in a diet-induced nonalcoholic steatohepatitis model in mice. Hepatology 2009, 49, 989–997. [Google Scholar] [PubMed]
- Jena, P.K.; Sheng, L.; Li, Y.; Wan, Y.-J.Y. Probiotics VSL# 3 are effective in reversing non-alcoholic steatohepatitis in a mouse model. Hepatobiliary Surg. Nutr. 2020, 9, 170. [Google Scholar] [PubMed]
- Crovesy, L.; Masterson, D.; Rosado, E.L. Profile of the gut microbiota of adults with obesity: A systematic review. Eur. J. Clin. Nutr. 2020, 74, 1251–1262. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Yang, S.; Lin, H.; Huang, J.; Watkins, P.A.; Moser, A.B.; DeSimone, C.; Song, X.-Y.; Diehl, A.M. Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease. Hepatology 2003, 37, 343–350. [Google Scholar] [CrossRef] [PubMed]
- Heeren, J.; Scheja, L. Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol. Metab. 2021, 50, 101238. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.; Ding, B.; Feng, C.; Yin, S.; Zhang, T.; Qi, X.; Lv, H.; Guo, X.; Dong, K.; Zhu, Y. Prevotella and Klebsiella proportions in fecal microbial communities are potential characteristic parameters for patients with major depressive disorder. J. Affect. Disord. 2017, 207, 300–304. [Google Scholar] [CrossRef] [PubMed]
- Hoyles, L.; Fernández-Real, J.-M.; Federici, M.; Serino, M.; Abbott, J.; Charpentier, J.; Heymes, C.; Luque, J.L.; Anthony, E.; Barton, R.H. Molecular phenomics and metagenomics of hepatic steatosis in non-diabetic obese women. Nat. Med. 2018, 24, 1070–1080. [Google Scholar] [CrossRef] [PubMed]
- Caussy, C.; Hsu, C.; Lo, M.T.; Liu, A.; Bettencourt, R.; Ajmera, V.H.; Bassirian, S.; Hooker, J.; Sy, E.; Richards, L. Link between gut-microbiome derived metabolite and shared gene-effects with hepatic steatosis and fibrosis in NAFLD. Hepatology 2018, 68, 918–932. [Google Scholar] [CrossRef] [PubMed]
- Cox, L.M.; Sohn, J.; Tyrrell, K.L.; Citron, D.M.; Lawson, P.A.; Patel, N.B.; Iizumi, T.; Perez-Perez, G.I.; Goldstein, E.J.C.; Blaser, M.J. Description of two novel members of the family Erysipelotrichaceae: Ileibacterium valens gen. nov., sp. nov. and Dubosiella newyorkensis, gen. nov., sp. nov., from the murine intestine, and emendation to the description of Faecalibacterium rodentium. Int. J. Syst. Evol. Microbiol. 2017, 67, 1247–1254. [Google Scholar] [CrossRef] [PubMed]
- Yachida, S.; Mizutani, S.; Shiroma, H.; Shiba, S.; Nakajima, T.; Sakamoto, T.; Watanabe, H.; Masuda, K.; Nishimoto, Y.; Kubo, M. Metagenomic and metabolomic analyses reveal distinct stage-specific phenotypes of the gut microbiota in colorectal cancer. Nat. Med. 2019, 25, 968–976. [Google Scholar] [CrossRef] [PubMed]
- Fu, T.; Huan, T.; Rahman, G.; Zhi, H.; Xu, Z.; Oh, T.G.; Guo, J.; Coulter, S.; Tripathi, A.; Martino, C. Paired microbiome and metabolome analyses associate bile acid changes with colorectal cancer progression. Cell Rep. 2023, 42, 112997. [Google Scholar] [CrossRef] [PubMed]
- Nagarajan, A.; Lasher, A.T.; Morrow, C.D.; Sun, L.Y. Long term methionine restriction: Influence on gut microbiome and metabolic characteristics. Aging Cell 2024, 23, e14051. [Google Scholar] [CrossRef] [PubMed]
- Zackular, J.P.; Baxter, N.T.; Iverson, K.D.; Sadler, W.D.; Petrosino, J.F.; Chen, G.Y.; Schloss, P.D. The gut microbiome modulates colon tumorigenesis. mBio 2013, 4, e00692-13. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Wang, A.C.; Parikh, I.; Green, S.J.; Hoffman, J.D.; Chlipala, G.; Murphy, M.P.; Sokola, B.S.; Bauer, B.; Hartz, A. Ketogenic diet enhances neurovascular function with altered gut microbiome in young healthy mice. Sci. Rep. 2018, 8, 6670. [Google Scholar] [CrossRef] [PubMed]
- Bian, X.; Wu, W.; Yang, L.; Lv, L.; Wang, Q.; Li, Y.; Ye, J.; Fang, D.; Wu, J.; Jiang, X. Administration of Akkermansia muciniphila ameliorates dextran sulfate sodium-induced ulcerative colitis in mice. Front. Microbiol. 2019, 10, 2259. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, D.J.; Campos-Ponce, M.; Taddei, C.R.; Doak, C.M. Microbiome, growth retardation and metabolism: Are they related? Ann. Hum. Biol. 2017, 44, 201–207. [Google Scholar] [CrossRef] [PubMed]
- Chiu, D.-C.; Baskin, J.M. Imaging and editing the phospholipidome. Acc. Chem. Res. 2022, 55, 3088–3098. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Agellon, L.B.; Allen, T.M.; Umeda, M.; Jewell, L.; Mason, A.; Vance, D.E. The ratio of phosphatidylcholine to phosphatidylethanolamine influences membrane integrity and steatohepatitis. Cell Metab. 2006, 3, 321–331. [Google Scholar] [CrossRef] [PubMed]
- Qian, H.; Chao, X.; Williams, J.; Fulte, S.; Li, T.; Yang, L.; Ding, W.-X. Autophagy in liver diseases: A review. Mol. Asp. Med. 2021, 82, 100973. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, M.A.; Homans, S.W.; Dwek, R.A.; Rademacher, T.W. Glycosyl-phosphatidylinositol moiety that anchors Trypanosoma brucei variant surface glycoprotein to the membrane. Science 1988, 239, 753–759. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
Cldn-1 | GGGGACAACATCGTGACCG | AGGAGTCGAAGACTTTGCACT |
ZO-2 | ATGGGAGCAGTACACCGTGA | TGACCACCCTGTCATTTTCTTG |
IL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
TNF-α | CCTGTAGCCCACGTCGTAG | GGGAGTAGACAAGGTACAACCC |
IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
IL-8 | CAAGGCTGGTCCATGCTCC | TGCTATCACTTCCTTTCTGTTGC |
IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, T.; Zeng, Z.; Yu, Y. Role of Probiotics in Gut Microbiome and Metabolome in Non-Alcoholic Fatty Liver Disease Mouse Model: A Comparative Study. Microorganisms 2024, 12, 1020. https://doi.org/10.3390/microorganisms12051020
Wu T, Zeng Z, Yu Y. Role of Probiotics in Gut Microbiome and Metabolome in Non-Alcoholic Fatty Liver Disease Mouse Model: A Comparative Study. Microorganisms. 2024; 12(5):1020. https://doi.org/10.3390/microorganisms12051020
Chicago/Turabian StyleWu, Tian, Zheng Zeng, and Yanyan Yu. 2024. "Role of Probiotics in Gut Microbiome and Metabolome in Non-Alcoholic Fatty Liver Disease Mouse Model: A Comparative Study" Microorganisms 12, no. 5: 1020. https://doi.org/10.3390/microorganisms12051020