Haemotrophic Mycoplasmas Infecting Pigs: A Review of the Current Knowledge
Abstract
:1. Introduction
2. Porcine Haemoplasma Species
3. Clinical and Pathological Descriptions
3.1. Mycoplasma suis
3.2. Mycoplasma parvum
3.3. ‘Candidatus Mycoplasma haemosuis’
4. Pathobiology and Host–Pathogen Interactions
5. Epidemiology
5.1. Worldwide Occurrence
5.2. Prevalence
5.3. Transmission Routes
6. Diagnostics
6.1. Cultivation
6.2. Microscopy
6.3. Molecular Methods
6.4. Serological Methods
7. Prevention and Treatment
8. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Messick, J.B. Hemotrophic mycoplasmas (hemoplasmas): A review and new insights into pathogenic potential. Vet. Clin. Pathol. 2004, 33, 2–13. [Google Scholar] [CrossRef] [PubMed]
- Hoelzle, L.E.; Zeder, M.; Felder, K.M.; Hoelzle, K. Pathobiology of Mycoplasma suis. Vet. J. 2014, 202, 20–25. [Google Scholar] [CrossRef] [PubMed]
- Stadler, J.; Ade, J.; Hermanns, W.; Ritzmann, M.; Wentzel, S.; Hoelzle, K.; Hoelzle, L.E. Clinical, haematological and pathomorphological findings in Mycoplasma suis infected pigs. BMC Vet. Res. 2021, 17, 214. [Google Scholar] [CrossRef] [PubMed]
- Guimaraes, A.M.; Santos, A.P.; SanMiguel, P.; Walter, T.; Timenetsky, J.; Messick, J.B. Complete genome sequence of Mycoplasma suis and insights into its biology and adaption to an erythrocyte niche. PLoS ONE 2011, 6, e19574. [Google Scholar] [CrossRef] [PubMed]
- Schilling, V. Eperythrozoon coccoides, eine neue durch Splenektomie aktivierbare Dauerinfektion der weissen Maus. Klin. Wochenschr. 1928, 7, 1853–1855. [Google Scholar] [CrossRef]
- Schreiner, S.A.; Hoelzle, K.; Hofmann-Lehmann, R.; Hamburger, A.; Wittenbrink, M.M.; Kramer, M.M.; Sokoli, A.; Felder, K.M.; Groebel, K.; Hoelzle, L.E. Nanotransformation of the haemotrophic Mycoplasma suis during in vitro cultivation attempts using modified cell free Mycoplasma media. Vet. Microbiol. 2012, 160, 227–232. [Google Scholar] [CrossRef] [PubMed]
- Millán, J.; Di Cataldo, S.; Volokhov, D.V.; Becker, D.J. Worldwide occurrence of haemoplasmas in wildlife: Insights into the patterns of infection, transmission, pathology and zoonotic potential. Transbound. Emerg. Dis. 2021, 68, 3236–3256. [Google Scholar] [CrossRef] [PubMed]
- Rikihisa, Y.; Kawahara, M.; Wen, B.; Kociba, G.; Fuerst, P.; Kawamori, F.; Suto, C.; Shibata, S.; Futohashi, M. Western immunoblot analysis of Haemobartonella muris and comparison of 16S rRNA gene sequences of H. muris, H. felis, and Eperythrozoon suis. J. Clin. Microbiol. 1997, 35, 823–829. [Google Scholar] [CrossRef] [PubMed]
- Neimark, H.; Johansson, K.E.; Rikihisa, Y.; Tully, J.G. Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of ‘Candidatus Mycoplasma haemofelis’, ‘Candidatus Mycoplasma haemomuris’, ‘Candidatus Mycoplasma haemosuis’ and ‘Candidatus Mycoplasma wenyonii’. Int. J. Syst. Evol. Microbiol. 2001, 51, 891–899. [Google Scholar] [CrossRef]
- Neimark, H.; Johansson, K.E.; Rikihisa, Y.; Tully, J.G. Revision of haemotrophic Mycoplasma species names. Int. J. Syst. Evol. Microbiol. 2002, 52, 683. [Google Scholar] [CrossRef]
- Messick, J.B.; Walker, P.G.; Raphael, W.; Berent, L.; Shi, X. ‘Candidatus mycoplasma haemodidelphidis’ sp. nov., ‘Candidatus mycoplasma haemolamae’ sp. nov. and Mycoplasma haemocanis comb. nov., haemotrophic parasites from a naturally infected opossum (Didelphis virginiana), alpaca (Lama pacos) and dog (Canis familiaris): Phylogenetic and secondary structural relatedness of their 16S rRNA genes to other mycoplasmas. Int. J. Syst. Evol. Microbiol. 2002, 52, 693–698. [Google Scholar] [CrossRef] [PubMed]
- Tasker, S.; Helps, C.R.; Day, M.J.; Harbour, D.A.; Shaw, S.E.; Harrus, S.; Baneth, G.; Lobetti, R.G.; Malik, R.; Beaufils, J.P.; et al. Phylogenetic analysis of hemoplasma species: An international study. J. Clin. Microbiol. 2003, 41, 3877–3880. [Google Scholar] [CrossRef]
- Peters, I.R.; Helps, C.R.; McAuliffe, L.; Neimark, H.; Lappin, M.R.; Gruffydd-Jones, T.J.; Day, M.J.; Hoelzle, L.E.; Willi, B.; Meli, M.; et al. RNase P RNA gene (rnpB) phylogeny of Hemoplasmas and other Mycoplasma species. J. Clin. Microbiol. 2008, 46, 1873–1877. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, Y.; Fujihara, M.; Obara, H.; Nagai, K.; Harasawa, R. Two genetic clusters in swine hemoplasmas revealed by analyses of the 16S rRNA and RNase P RNA genes. J. Vet. Med. Sci. 2011, 73, 1657–1661. [Google Scholar] [CrossRef]
- Thongmeesee, K.; Kamkong, P.; Thanee, S.; Wattanapansak, S.; Kaewthamasorn, M.; Tiawsirisup, S. Molecular detection and genetic analysis of porcine haemoplasmas in commercial pig farms from Thailand reveal a putative novel species. Transbound. Emerg. Dis. 2022, 69, e2028–e2040. [Google Scholar] [CrossRef]
- Zhou, R.Q.; Nie, K.; Huang, H.C.; Hu, S.J.; Zhou, Z.Y.; Luo, H.L. Phylogenetic analysis of Mycoplasma suis isolates based on 16S rRNA gene sequence in China. Vet. Res. Commun. 2009, 33, 855–863. [Google Scholar] [CrossRef]
- Gupta, R.S.; Sawnani, S.; Adeolu, M.; Alnajar, S.; Oren, A. Phylogenetic framework for the phylum Tenericutes based on genome sequence data: Proposal for the creation of a new order Mycoplasmoidales ord. nov., containing two new families Mycoplasmoidaceae fam. nov. and Metamycoplasmataceae fam. nov. harbouring Eperythrozoon, Ureaplasma and five novel genera. Antonie Van Leeuwenhoek 2018, 111, 1583–1630. [Google Scholar] [CrossRef]
- Guimaraes, A.M.; Santos, A.P.; do Nascimento, N.C.; Timenetsky, J.; Messick, J.B. Comparative genomics and phylogenomics of hemotrophic mycoplasmas. PLoS ONE 2014, 9, e91445. [Google Scholar] [CrossRef] [PubMed]
- Hoelzle, L.E. Significance of haemotrophic mycoplasmas in veterinary medicine with particular regard to the Mycoplasma suis infection in swine. Berl. Munch. Tierarztl. Wochenschr. 2007, 120, 34–41. [Google Scholar]
- Stadler, J.; Willi, S.; Ritzmann, M.; Eddicks, M.; Ade, J.; Hoelzle, K.; Hoelzle, L.E. Detection of Mycoplasma suis in pre-suckling piglets indicates a vertical transmission. BMC Vet. Res. 2019, 15, 252. [Google Scholar] [CrossRef]
- Brissonnier, M.; Normand, V.; Lebret, A.; Moalic, P.Y.; Guyomard, A.S.; Bachy, V.; Berton, P.; Auvigne, V.; Bouchet, F.; Boulbria, G. Frequency of infection with Mycoplasma suis in gestating sows using qPCR on ten commercial French herds, and impact of the infection on clinical, haematological and biochemical parameters. Porc. Health Manag. 2020, 6, 13. [Google Scholar] [CrossRef] [PubMed]
- Petri, F.A.M.; Sonalio, K.; de Souza Almeida, H.M.; Ferraz, M.E.S.; Storino, G.Y.; de Souza, M.R.; André, M.R.; de Oliveira, L.G. Porcine hemothropic mycoplasmas infection associated with productive impact in intensive pig production. Porc. Health Manag. 2020, 6, 33. [Google Scholar] [CrossRef] [PubMed]
- Henry, S.C. Clinical observations on eperythrozoonosis. J. Am. Vet. Med. Assoc. 1979, 174, 601–603. [Google Scholar] [PubMed]
- Zinn, G.M.; Jesse, G.W.; Dobson, A.W. Effect of eperythrozoonosis on sow productivity. J. Am. Vet. Med. Assoc. 1983, 182, 369–371. [Google Scholar] [PubMed]
- Doyle, L.P. A Rickettsia-like or anaplasmosis-like disease in swine. J. Am. Vet. Med. Assoc. 1932, 81, 668–671. [Google Scholar]
- Kinsley, A. Protozoan-like body in the blood of swine. Vet. Med. 1932, 27, 196. [Google Scholar]
- Splitter, E.J. Eperythrozoon suis n. sp. and Eperythrozoon parvum n. sp., 2 new blood parasites of swine. Science 1950, 111, 513–514. [Google Scholar] [CrossRef]
- Splitter, E.J. Eperythrozoon suis, the etiologic agent of ictero-anemia or an anaplasmosis-like disease in swine. Am. J. Vet. Res. 1950, 11, 324–330. [Google Scholar]
- do Nascimento, N.C.; Dos Santos, A.P.; Chu, Y.; Guimaraes, A.M.; Pagliaro, A.; Messick, J.B. Genome Sequence of Mycoplasma parvum (Formerly Eperythrozoon parvum), a Diminutive Hemoplasma of the Pig. Genome Announc. 2013, 1, e00986-13. [Google Scholar] [CrossRef]
- Fu, Y.; Shi, T.; Xu, L.; Wei, W.; Lu, F.; Zhang, X.; Yuan, X.; Li, J.; Lv, J.; Fang, W. Identification of a novel Hemoplasma species from pigs in Zhejiang province, China. J. Vet. Med. Sci. 2017, 79, 864–870. [Google Scholar] [CrossRef]
- Messick, J.B.; Santos, A.P.; Guimaraes, A.M. Complete genome sequences of two hemotropic mycoplasmas, Mycoplasma haemofelis strain Ohio2 and Mycoplasma suis Strain Illinois. J. Bacteriol. 2011, 193, 2068–2069. [Google Scholar] [CrossRef] [PubMed]
- Oehlerking, J.; Kube, M.; Felder, K.M.; Matter, D.; Wittenbrink, M.M.; Schwarzenbach, S.; Kramer, M.M.; Hoelzle, K.; Hoelzle, L.E. Complete genome sequence of the hemotrophic Mycoplasma suis strain KI3806. J. Bacteriol. 2011, 193, 2369–2370. [Google Scholar] [CrossRef] [PubMed]
- do Nascimento, N.C.; dos Santos, A.P.; Chu, Y.; Guimaraes, A.M.; Baird, A.N.; Weil, A.B.; Messick, J.B. Microscopy and genomic analysis of Mycoplasma parvum strain Indiana. Vet. Res. 2014, 45, 86. [Google Scholar] [CrossRef] [PubMed]
- Sonalio, K.; Perles, L.; Gatto, I.R.H.; do Amaral, R.B.; Almeida, H.M.; Galdeano, J.V.B.; Vieira, R.F.; Andre, M.R.; de Oliveira, L.G. Genetic diversity of emerging hemotropic mycoplasmas in domestic pigs from Brazil. Transbound. Emerg. Dis. 2021, 68, 1162–1174. [Google Scholar] [CrossRef] [PubMed]
- Stadler, J.; Ade, J.; Ritzmann, M.; Hoelzle, K.; Hoelzle, L.E. Detection of a novel haemoplasma species in fattening pigs with skin alterations, fever and anaemia. Vet. Rec. 2020, 187, 66. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, Y.; Fujihara, M.; Suzuki, J.; Sasaoka, F.; Nagai, K.; Harasawa, R. Prevalence of swine hemoplasmas revealed by real-time PCR using 16S rRNA gene primers. J. Vet. Med. Sci. 2012, 74, 1315–1318. [Google Scholar] [CrossRef] [PubMed]
- Ade, J.; Hoelzle, K.; Stadler, J.; Ritzmann, M.; Hoelzle, L.E. Occurrence of Mycoplasma parvum in German Pigs of Different Age Groups Using a Novel Quantitative Real-Time PCR Assay. Pathogens 2022, 11, 1374. [Google Scholar] [CrossRef] [PubMed]
- Ade, J.; Stadler, J.; Ritzmann, M.; Zübert, C.; Hoelzle, K.; Hoelzle, L.E. Occurrence of ‘Candidatus Mycoplasma haemosuis’ in fattening pigs, sows and piglets in Germany using a novel gap-based quantitative real-time PCR assay. BMC Vet. Res. 2022, 18, 40. [Google Scholar] [CrossRef] [PubMed]
- Dipeolu, O.O.; Majaro, O.M.; Akinboade, O.A.; Nwufor, K.J. Studies on the blood parasites of pigs in Ibadan, Nigeria. Vet. Parasitol. 1982, 10, 87–90. [Google Scholar] [CrossRef]
- Stadler, J.; Jannasch, C.; Mack, S.L.; Dietz, S.; Zöls, S.; Ritzmann, M.; Hoelzle, K.; Hoelzle, L.E. Clinical and haematological characterisation of Mycoplasma suis infections in splenectomised and non-splenectomised pigs. Vet. Microbiol. 2014, 172, 294–300. [Google Scholar] [CrossRef]
- Splitter, E.J. Icteroanemia in swine. Vet. Med. 1951, 46, 14–15. [Google Scholar] [PubMed]
- Preston, K.; Greve, J. Eperythrozoonosis in 4-week-old pigs. Iowa State Univ. Vet. 1965, 27, 119 passim. [Google Scholar] [PubMed]
- Henderson, J.; O’hagan, J.; Hawe, S.; Pratt, M. Anaemia and low viability in piglets infected with Eperythrozoon suis. Vet. Rec. 1997, 140, 144–146. [Google Scholar] [CrossRef] [PubMed]
- Groebel, K.; Hoelzle, K.; Wittenbrink, M.; Ziegler, U.; Hoelzle, L. Mycoplasma suis invades porcine erythrocytes. Infect. Immun. 2009, 77, 576–584. [Google Scholar] [CrossRef] [PubMed]
- Heinritzi, K. Haematologie und Metabolismus des eperythrozoonotischen Anfalls. Prakt. Tierarzt 1984, 65, 40–44. [Google Scholar]
- Strait, E.L.; Hawkins, P.A.; Wilson, W.D. Dysgalactia associated with Mycoplasma suis infection in a sow herd. J. Am. Vet. Med. Assoc. 2012, 241, 1666–1667. [Google Scholar] [CrossRef] [PubMed]
- Heinritzi, K.; Wentz, I.; Bollwahn, W. Hematological findings in acute eperythrozoonosis of swine. Berl. Und Muenchener Tieraerztliche Wochenschr. 1984, 97, 404–407. [Google Scholar]
- Heinritzi, K.; Plank, G.; Peteranderl, W.; Sandner, N. Untersuchungen zum Säure-Basen-Haushalt und Kohlenhydratstoffwechsel bei der Infektion mit Eperythrozoon suis. J. Vet. Med. Ser. B 1990, 37, 412–417. [Google Scholar] [CrossRef]
- Bollwahn, W. Die eperythrozoonose (İkteroanämie) der Schweine. Prakt. Tierarzt 1982, 63, 1043–1046. [Google Scholar]
- Hoelzle, L.E. Haemotrophic mycoplasmas: Recent advances in Mycoplasma suis. Vet. Microbiol. 2008, 130, 215–226. [Google Scholar] [CrossRef]
- Ritzmann, M.; Grimm, J.; Heinritzi, K.; Hoelzle, K.; Hoelzle, L.E. Prevalence of Mycoplasma suis in slaughter pigs, with correlation of PCR results to hematological findings. Vet. Microbiol. 2009, 133, 84–91. [Google Scholar] [CrossRef] [PubMed]
- Oberst, R.D.; Gwaltney, S.M.; Hays, M.P.; Morgan, S.; Stair, E.L. Experimental infections and natural outbreaks of eperythrozoonosis in pigs identified by PCR-DNA hybridizations. J. Vet. Diagn. Investig. 1993, 5, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Gwaltney, S.M.; Oberst, R.D. Comparison of an improved polymerase chain reaction protocol and the indirect hemagglutination assay in the detection of Eperythrozoon suis infection. J. Vet. Diagn. Investig. 1994, 6, 321–325. [Google Scholar] [CrossRef] [PubMed]
- Pereyra, N.; Sarradell, J.; Cane, F.; Francois, S.; Pidone, C.; Comba, E.; Rodríguez, F.; Guglielmone, A. Detección de Mycoplasma suis en casos clínicos de síndrome del desmedro multisistémico posdestete en porcinos. Rev. Argent. De Microbiol. 2006, 38, 130–133. [Google Scholar]
- Dent, B.T.; Stevens, K.A.; Korvick, D.L.; Clymer, J.W. Mycoplasma suis infection in pigs after splenectomy. Lab Anim. 2013, 42, 125–128. [Google Scholar] [CrossRef] [PubMed]
- Tseng, C.; Wang, J. Pathological features of experimental infection with Eperythrozoon suis in pigs. Taiwan J. Vet. Med. Anim. Husb. 1991, 58, 27–32. [Google Scholar]
- Sokoli, A.; Groebel, K.; Hoelzle, K.; Amselgruber, W.M.; Mateos, J.M.; Schneider, M.K.; Ziegler, U.; Felder, K.M.; Hoelzle, L.E. Mycoplasma suis infection results endothelial cell damage and activation: New insight into the cell tropism and pathogenicity of hemotrophic mycoplasma. Vet. Res. 2013, 44, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Quin, A. A discussion of some diseases of swine. Can. Vet. J. 1960, 1, 246. [Google Scholar] [PubMed]
- Pospischil, A.; Hoffmann, R. Eperythrozoon suis in naturally infected pigs: A light and electron microscopic study. Vet. Pathol. 1982, 19, 651–657. [Google Scholar] [CrossRef]
- Jansen, B. The occurrence of Eperythrozoon parvum Splitter, 1950 in South African swine. Onderstepoort J. Vet. Res. 1952, 25, 6. [Google Scholar]
- Jennings, A.; Seamer, J. A new blood parasite in British pigs. Nature 1956, 178, 153–154. [Google Scholar] [CrossRef]
- Seamer, J. Studies with Eperythrozoon parvum Splitter, 1950. Parasitology 1960, 50, 67–80. [Google Scholar] [CrossRef] [PubMed]
- Zachary, J.; Basgall, E. Erythrocyte membrane alterations associated with the attachment and replication of Eperythrozoon suis: A light and electron microscopic study. Vet. Pathol. 1985, 22, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Liebich, H.; Heinritzi, K. Licht-und elektronenmikroskopische Untersuchungen an Eperythrozoon suis Tierärztl. Prax 1992, 20, 270–274. [Google Scholar]
- Hoelzle, L.E.; Hoelzle, K.; Helbling, M.; Aupperle, H.; Schoon, H.A.; Ritzmann, M.; Heinritzi, K.; Felder, K.M.; Wittenbrink, M.M. MSG1, a surface-localised protein of Mycoplasma suis is involved in the adhesion to erythrocytes. Microbes Infect. 2007, 9, 466–474. [Google Scholar] [CrossRef]
- Felder, K.M.; Hoelzle, K.; Ritzmann, M.; Kilchling, T.; Schiele, D.; Heinritzi, K.; Groebel, K.; Hoelzle, L.E. Hemotrophic mycoplasmas induce programmed cell death in red blood cells. Cell. Physiol. Biochem. 2011, 27, 557–564. [Google Scholar] [CrossRef]
- Heinritzi, K.; Peteranderl, W.; Plank, G. Eperythrozoon-infektion beim schwein: Einfluss auf säure-basen-haushalt sowie glucose-, lactat-und pyruvatgehalt des venösen blutes. Dtsch. Tierärztliche Wochenschr. 1990, 97, 31–34. [Google Scholar]
- Smith, J.; Cipriano, J.; Hall, S. In Vitro and in vivo glucose consumption in swine eperythrozoonosis. J. Vet. Med. Ser. B 1990, 37, 587–592. [Google Scholar] [CrossRef] [PubMed]
- Nonaka, N.; Thacker, B.; van Veen, T.S.; Bull, R. In Vitro maintenance of Eperythrozoon suis. Vet. Parasitol. 1996, 61, 181–199. [Google Scholar] [CrossRef]
- Juengling, A.; Erhard, M.; Heinritzi, K. Bedeutung und Verlauf eines Kalteagglutinins beider Eperythrozoon suis-Infektion des Schweines. Berl. Muench. Tieraerztl. Wochenschr. 1994, 107, 271–275. [Google Scholar]
- Felder, K.M.; Hoelzle, K.; Heinritzi, K.; Ritzmann, M.; Hoelzle, L.E. Antibodies to actin in autoimmune haemolytic anaemia. BMC Vet. Res. 2010, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Zachary, J.; Smith, A. Experimental porcine eperythrozoonosis: T-lymphocyte suppression and misdirected immune responses. Am. J. Vet. Res. 1985, 46, 821–830. [Google Scholar] [PubMed]
- Hoffmann, R.; Schmid, D.; Hoffmann-Fezer, G. Erythrocyte antibodies in porcine eperythrozoonosis. Vet. Immunol. Immunopathol. 1981, 2, 111–119. [Google Scholar] [CrossRef] [PubMed]
- Schreiner, S.A.; Sokoli, A.; Felder, K.M.; Wittenbrink, M.M.; Schwarzenbach, S.; Guhl, B.; Hoelzle, K.; Hoelzle, L.E. The surface-localised α-enolase of Mycoplasma suis is an adhesion protein. Vet. Microbiol. 2012, 156, 88–95. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Song, W.; Zhang, W.; He, L.; Fang, R.; Zhou, Y.; Shen, B.; Hu, M.; Zhao, J. Identification of erythrocyte membrane proteins interacting with Mycoplasma suis GAPDH and OSGEP. Res. Vet. Sci. 2018, 119, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Dietz, S.; Lassek, C.; Mack, S.L.; Ritzmann, M.; Stadler, J.; Becher, D.; Hoelzle, K.; Riedel, K.; Hoelzle, L.E. Updating the proteome of the uncultivable hemotrophic Mycoplasma suis in experimentally infected pigs. Proteomics 2016, 16, 609–613. [Google Scholar] [CrossRef]
- Hoelzle, L.E.; Hoelzle, K.; Harder, A.; Ritzmann, M.; Aupperle, H.; Schoon, H.A.; Heinritzi, K.; Wittenbrink, M.M. First identification and functional characterization of an immunogenic protein in unculturable haemotrophic Mycoplasmas (Mycoplasma suis HspA1). FEMS Immunol. Med. Microbiol. 2007, 49, 215–223. [Google Scholar] [CrossRef]
- Plank, G.; Heinritzi, K. Disseminated intravascular coagulation in eperythrozoonosis of swine. Berl. und Muench. Tieraerztl. Wochenschr. 1990, 103, 13–18. [Google Scholar]
- do Nascimento, N.C.; Guimaraes, A.M.S.; Dos Santos, A.P.; Chu, Y.; Marques, L.M.; Messick, J.B. RNA-Seq based transcriptome of whole blood from immunocompetent pigs (Sus scrofa) experimentally infected with Mycoplasma suis strain Illinois. Vet. Res. 2018, 49, 49. [Google Scholar] [CrossRef]
- Uilenberg, G.; Zeeuwen, A.; de Ruijter, T. Eperythrozoon parvum (Rickettsiales) in swine in the Netherland. Tijdschr. Voor Diergeneeskd. 1981, 106, 456. [Google Scholar]
- Gatto, I.R.H.; Sonálio, K.; Amaral, R.B.D.; Morés, N.; Dalla Costa, O.A.; André, M.R.; de Oliveira, L.G. High frequency and molecular characterization of porcine hemotrophic mycoplasmas in Brazil. Vet. Microbiol. 2019, 231, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.G.; Kwon, O.D.; Kwak, D. Prevalence and phylogenetic analysis of hemoplasma species in domestic pigs in Korea. Parasit. Vectors 2019, 12, 378. [Google Scholar] [CrossRef] [PubMed]
- Barnett, S. Eperythrozoon parvum in pigs in Kenya. Bull. Epizoot. Dis. Afr. 1963, 11, 185–195. [Google Scholar] [PubMed]
- Wu, J.; Yu, J.; Song, C.; Sun, S.; Wang, Z. Porcine eperythrozoonosis in China. Ann. N. Y. Acad. Sci. 2006, 1081, 280–285. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.L.; Liang, A.B.; Yao, C.B.; Yang, Z.B.; Zhu, J.G.; Cui, L.; Yu, F.; Zhu, N.Y.; Yang, X.W.; Hua, X.G. Prevalence of Mycoplasma suis (Eperythrozoon suis) infection in swine and swine-farm workers in Shanghai, China. Am. J. Vet. Res. 2009, 70, 890–894. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Wang, L.; Fang, R.; Khan, M.K.; Zhou, Y.; Zhao, J. Detection of Mycoplasma wenyonii in cattle and transmission vectors by the loop-mediated isothermal amplification (LAMP) assay. Trop. Anim. Health Prod. 2013, 45, 247–250. [Google Scholar] [CrossRef] [PubMed]
- Zhongyang, L.; Jiansong, Z.; Yijuan, S.; Yuting, X.; Yufeng, L.; Jiarong, X. Seroprevalence of Mycoplasma suis infection in pigs in eastern China as estimated by a blocking enzyme-linked immunosorbent assay. Can. J. Vet. Res. 2017, 81, 313–317. [Google Scholar] [PubMed]
- Jeon, Y. Morphological study and experimental production of porcine eperythrozoonosis. Res. Rep. Off. Rural. Dev. Korea Vet. Ser. 1971, 14, 35–40. [Google Scholar]
- Assoku, R.K.G. A study of the incidence of blood-borne parasites of livestock in southern Ghana. Bull. Anim. Health Prod. Afr. 1979, 271, 29–39. [Google Scholar]
- Okon, E.D. Blood parasites of local pigs in Ibadan. Trop. Anim. Health Prod. 1976, 8, 87–90. [Google Scholar] [CrossRef]
- Dipeolu, O.O.; Otesile, E.B.; Fagbemi, B.O.; Adetunji, A. Pathogenicity of Eperythrozoon suis alone and when mixed with Babesia trautmanni in experimentally-infected pigs. Vet. Parasitol. 1983, 13, 127–134. [Google Scholar] [CrossRef] [PubMed]
- Portiansky, E.L.; Quiroga, M.A.; Machuca, M.A.; Perfumo, C.J. Mycoplasma suis in naturally infected pigs: An ultrastructural and morphometric study. Pesqui. Veterinária Bras. 2004, 24, 1–5. [Google Scholar] [CrossRef]
- Acosta, D.B.; Ruiz, M.; Sanchez, J.P. First molecular detection of Mycoplasma suis in the pig louse Haematopinus suis (Phthiraptera: Anoplura) from Argentina. Acta Trop. 2019, 194, 165–168. [Google Scholar] [CrossRef] [PubMed]
- Toledo, M.A.; Leite, A.I.; Gonçalves, L.R.; Sousa, K.C.; Amaral, R.B.; Silva, G.C.; Machado, R.Z.; André, M.R. High occurrence of Mycoplasma suis infection in swine herds from non-technified farms in Mossoró, state of Rio Grande do Norte, Northeastern Brazil. Rev. Bras. Parasitol. Vet. 2016, 25, 414–417. [Google Scholar] [CrossRef] [PubMed]
- Martins, M.; Silva, L.D.; Miranda, L.M.; Lima, C.A.A.; Amaral, R.B.D.; Machado, R.Z.; André, M.R.; Braga, M.; Rosário, C.; Melo, F.A.; et al. Molecular detection of Mycoplasma suis in extensive pig production systems in the State of Maranhão, northeast Brazil. Rev. Bras. Parasitol. Vet. 2019, 28, 306–309. [Google Scholar] [CrossRef] [PubMed]
- Bordin, L.C.; Gava, D.; Sonalio, K.; Mechler-Dreibi, M.L.; Zanella, J.R.C.; Morés, N.; de Oliveira, L.G.; Vaz, E.K. Investigation of hemotropic Mycoplasmas in fetuses and sows with reproductive failure. Vet. Anim. Sci. 2021, 12, 100175. [Google Scholar] [CrossRef] [PubMed]
- Guimaraes, A.M.; Biondo, A.W.; Lara, A.C.; Messick, J.B. Exploratory study of Mycoplasma suis (Eperythrozoon suis) on four commercial pig farms in southern Brazil. Vet. Rec. 2007, 160, 50–53. [Google Scholar] [CrossRef] [PubMed]
- Ayroud, M.; Leavitt, S.; Higgs, G. Eperythrozoonosis in swine. Can. Vet. J. 1994, 35, 54–55. [Google Scholar] [PubMed]
- Biberstein, E.; Barr, L.; Larrow, L.; Roberts, S. Eperythrozoonosis of swine in New York State. Cornell Vet. 1956, 46, 288–297. [Google Scholar]
- Guimaraes, A.M.; Vieira, R.F.; Poletto, R.; Vemulapalli, R.; Santos, A.P.; de Moraes, W.; Cubas, Z.S.; Santos, L.C.; Marchant-Forde, J.N.; Timenetsky, J.; et al. A quantitative TaqMan PCR assay for the detection of Mycoplasma suis. J. Appl. Microbiol. 2011, 111, 417–425. [Google Scholar] [CrossRef]
- Schweighardt, H.; Fellner, A.; Pechan, P.; Leuermann, E. Eperythrozoonose beim Schwein-ein Fallbericht. Wien. Tierarztl. Mschr. 1986, 73, 250–253. [Google Scholar]
- Schwarz, L.; Strauss, A.; Loncaric, I.; Spergser, J.; Auer, A.; Rümenapf, T.; Ladinig, A. The Stable Fly (Stomoxys calcitrans) as a Possible Vector Transmitting Pathogens in Austrian Pig Farms. Microorganisms 2020, 8, 1476. [Google Scholar] [CrossRef] [PubMed]
- Gattinger, B.; Spergser, J.; Wille-Piazzai, W.; Kolodziejek, J.; Tichy, A.; Joachim, A. Detection of Mycoplasma (Eperythrozoon) suis by real-time PCR. Wien. Tierarztl. Monatsschrift 2008, 95, 22. [Google Scholar]
- De Busser, E.V.; Mateusen, B.; Vicca, J.; Hoelzle, L.; Haesebrouck, F.; Maes, D. Mycoplasma suis infection in suckling pigs on a Belgian farm. Vlaams Diergeneeskd. Tijdschr. 2008, 77, 182–186. [Google Scholar] [CrossRef]
- Normand, V.; Boulbria, G.; Brissonnier, M.; Bachy, V.; Moalic, P.; Berton, P.; Bouchet, F.; Lebret, A. Comparison of qPCR and blood smear microscopy for the diagnosis of Mycoplasma suis in a French veterinary practice. Porc. Health Manag. 2020, 6, 4–7. [Google Scholar] [CrossRef] [PubMed]
- Hoelzle, L.E.; Helbling, M.; Hoelzle, K.; Ritzmann, M.; Heinritzi, K.; Wittenbrink, M.M. First LightCycler real-time PCR assay for the quantitative detection of Mycoplasma suis in clinical samples. J. Microbiol. Methods 2007, 70, 346–354. [Google Scholar] [CrossRef] [PubMed]
- Korn, G.; Mussgay, M. Ein Fall von Eperythrozoon suis mit differentialdiagnostischer Bedeutung bei einem Schweinepestverdacht Zbl. Vet. Med. B 1968, 15, 617–630. [Google Scholar]
- Hoffmann, R.; Saalfeld, K. Ausbruch einer Eperythrozoonose in einem Schweinemastbestand. DTW Dtsch. Tierarztl. Wochenschr. 1977, 84, 7–9. [Google Scholar] [PubMed]
- Müller, E.; Neddenriep, G. Eperythrozoonose in einem Ferkelerzeugerbetrieb in Norddeutschland. Prakt. Tierarzt 1979, 662–665. [Google Scholar]
- Kántás, K.; Andó, P. Eperythrozoonosis in swine in Hungary. Magy. Allatorvosok Lapja 1987, 42, 673–676. [Google Scholar]
- Vezzoli, F.; Gualdi, V.; Luini, M.; Arioli, E.; Botti, S.; Recordati, C. Anaemia and mortality in piglets infected with Mycoplasma suis [Eperythrozoon suis]. In Proceedings of the Atti della Societa Italianà di Patologia ed Allevamento dei Suini 2003 XXIX Meeting Annuale, Salsomaggiore Terme, Italy, 16–19 August 2003. [Google Scholar]
- Perestrelo-Vieira, R.; Heinritzi, K.; Perestrelo-Vieira, H.; Sobestiansky, J.; Abreu-Lopes, J. First diagnosis of Eperythrozoon suis in Portugal. Rev. Port. De Ciências Veterinárias 1997, 92, 14–19. [Google Scholar]
- Potkonjak, A.; Lako, B.; Milićević, V.; Savić, B.; Ivetić, V.; Jakić-Dimić, D.; Stevančević, O.; Toholj, B. Molecular diagnostics of swine infection caused by Mycoplasma suis. Vet. Glas. 2009, 63, 353–358. [Google Scholar] [CrossRef]
- Lako, B.; Potkonjak, A.; Gagrcin, M.; Belic, B.; Stevancevic, O.; Davidov, I.; Toholj, B. Determining the presence and spread of porcine infection with haemotrophic mycoplasmas on our farms. Contemp. Agric. 2009, 58, 1–8. [Google Scholar]
- Gresham, A.; Rogers, J.; Tribe, H.; Phipps, L. Eperythrozoon suis in weaned pigs. Vet. Rec. 1994, 134, 71–72. [Google Scholar] [CrossRef] [PubMed]
- Hoelzle, K.; Engels, M.; Kramer, M.M.; Wittenbrink, M.M.; Dieckmann, S.M.; Hoelzle, L.E. Occurrence of Mycoplasma suis in wild boars (Sus scrofa L.). Vet. Microbiol. 2010, 143, 405–409. [Google Scholar] [CrossRef] [PubMed]
- Santana, M.d.S.; Hoppe, E.G.L.; Carraro, P.E.; Calchi, A.C.; de Oliveira, L.B.; do Amaral, R.B.; Mongruel, A.C.B.; Machado, D.M.R.; Burger, K.P.; Barros-Batestti, D.M. Molecular detection of vector-borne agents in wild boars (Sus scrofa) and associated ticks from Brazil, with evidence of putative new genotypes of Ehrlichia, Anaplasma, and haemoplasmas. Transbound. Emerg. Dis. 2022, 69, e2808–e2831. [Google Scholar] [CrossRef] [PubMed]
- Dias, G.B.; do Amaral, R.B.; Gatto, I.R.H.; Lapera, I.M.; de Oliveira, L.G.; Lux Hoppe, E.G.; Machado, R.Z.; André, M.R. Molecular detection of Mycoplasma suis in captive white-lipped peccaries (Tayassu pecari) and wild boars (Sus scrofa) in Brazil. Comp. Immunol. Microbiol. Infect. Dis. 2019, 63, 94–96. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, A.J.; Elshafie, N.O.; Kmetiuk, L.B.; Ullmann, L.S.; Brandão, A.P.D.; Haisi, A.; van Wilpe Bach, R.; de Barros-Filho, I.R.; Araújo Junior, J.P.; Barbosa, D.S.; et al. Hemotropic mycoplasmas (hemoplasmas) in wild boars, hunting dogs, and hunters from two Brazilian regions. Transbound. Emerg. Dis. 2022, 69, 908–912. [Google Scholar] [CrossRef]
- Heinritzi, K. Untersuchungen zur Übertragbarkeit von Eperythrozoon suis. Tieraerztl. Umsch. 1992, 47, 588–599. [Google Scholar]
- Prullage, J.; Williams, R.; Gaafar, S. On the transmissibility of Eperythrozoon suis by Stomoxys calcitrans and Aedes aegypti. Vet. Parasitol. 1993, 50, 125–135. [Google Scholar] [CrossRef]
- Ade, J.; Ritzmann, M.; Wöstmann, C.; Eddicks, M.; Reese, S.; Hoelzle, K.; Hoelzle, L.E.; Stadler, J. Update on shedding and transmission routes of porcine haemotrophic mycoplasmas in naturally and experimentally infected pigs. Porc. Health Manag. 2021, 7, 49. [Google Scholar] [CrossRef] [PubMed]
- Maes, D.; Nauwynck, H.; Rijsselaere, T.; Mateusen, B.; Vyt, P.; de Kruif, A.; Van Soom, A. Diseases in swine transmitted by artificial insemination: An overview. Theriogenology 2008, 70, 1337–1345. [Google Scholar] [CrossRef] [PubMed]
- Berrier Jr, H.; RE, G. Eperythrozoonosis transmitted in utero from carrier sows to their pigs. J. Am. Vet. Med. Assoc. 1954, 124, 98–100. [Google Scholar] [PubMed]
- Dietz, S.; Mack, S.L.; Hoelzle, K.; Becker, K.; Jannasch, C.; Stadler, J.; Ritzmann, M.; Hoelzle, L.E. Quantitative PCR analysis of Mycoplasma suis shedding patterns during experimental infection. Vet. Microbiol. 2014, 172, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Thiel, W. Zur Pathologie und Diagnostik der Eperythrozooninfektion der Schweine. Prakt. Tierarzt 1983, 64, 692–697. [Google Scholar]
- Thongmeesee, K.; Sri-In, C.; Kaewthamasorn, M.; Thanee, S.; Wattanaphansak, S.; Tiawsirisup, S. Establishment of molecular diagnostics targeting the 23S ribosomal RNA gene for the detection of Mycoplasma suis infection in Thai domestic pigs. Acta Trop. 2023, 238, 106759. [Google Scholar] [CrossRef] [PubMed]
- Ha, S.-K.; Jung, K.; Choi, C.; Ha, Y.; Song, H.-C.; Lim, J.-H.; Kim, S.-H.; Chae, C. Development of in-situ hybridization for the detection of Mycoplasma haemosuis (Eperythrozoon suis) in formalin-fixed, paraffin wax-embedded tissues from experimentally infected splenectomized pigs. J. Comp. Pathol. 2005, 133, 294–297. [Google Scholar] [CrossRef]
- Hoelzle, L.E.; Hoelzle, K.; Ritzmann, M.; Heinritzi, K.; Wittenbrink, M.M. Mycoplasma suis antigens recognized during humoral immune response in experimentally infected pigs. Clin. Vaccine Immunol. 2006, 13, 116–122. [Google Scholar] [CrossRef]
- Hsu, F.S.; Liu, M.C.; Chou, S.M.; Zachary, J.F.; Smith, A.R. Evaluation of an enzyme-linked immunosorbent assay for detection of Eperythrozoon suis antibodies in swine. Am. J. Vet. Res. 1992, 53, 352–354. [Google Scholar] [CrossRef]
- Schuller, W.; Heinritzi, K.; al-Nuktha, S.; Kölbl, S.; Schuh, M. Serologic progression studies using CF and ELISA for the detection of antibodies against Eperythrozoon suis infection of swine. Berl. Munch. Tierarztl. Wochenschr. 1990, 103, 9–12. [Google Scholar]
- Hoelzle, K.; Grimm, J.; Ritzmann, M.; Heinritzi, K.; Torgerson, P.; Hamburger, A.; Wittenbrink, M.M.; Hoelzle, L.E. Use of recombinant antigens to detect antibodies against Mycoplasma suis, with correlation of serological results to hematological findings. Clin. Vaccine Immunol. 2007, 14, 1616–1622. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Zhang, W.; Song, W.; Liu, Z.; Khan, M.K.; He, L.; Fang, R.; Li, P.; Zhou, Y.; Hu, M. Seroprevalence and risk factors of Mycoplasma suis infection in pig farms in central China. Prev. Vet. Med. 2014, 117, 215–221. [Google Scholar] [CrossRef] [PubMed]
- Xue, S.; Seo, K.; Yang, M.; Cui, C.; Yang, M.; Xiang, S.; Yan, Z.; Wu, S.; Han, J.; Yu, X.; et al. Mycoplasma suis Alpha-Enolase Subunit Vaccine Induces an Immune Response in Experimental Animals. Vaccines 2021, 9, 1506. [Google Scholar] [CrossRef] [PubMed]
- Hoelzle, K.; Doser, S.; Ritzmann, M.; Heinritzi, K.; Palzer, A.; Elicker, S.; Kramer, M.; Felder, K.M.; Hoelzle, L.E. Vaccination with the Mycoplasma suis recombinant adhesion protein MSG1 elicits a strong immune response but fails to induce protection in pigs. Vaccine 2009, 27, 5376–5382. [Google Scholar] [CrossRef] [PubMed]
Haemoplasma Species | Year of First Description | Reference |
---|---|---|
Mycoplasma suis, formerly Eperythrozoon suis | 1950 | [27] |
Mycoplasma parvum, formerly Eperythrozoon parvum | 1950 | [27] |
‘Candidatus Mycoplasma haemosuis’ | 2017 | [30] |
Organ System | Macroscopic Observations | Microscopic Observations |
---|---|---|
Skin and mucous membranes | ||
| ||
Body cavities |
| |
Muscles |
| |
Lymphatic system |
|
|
| ||
| ||
| ||
Vascular system |
|
|
| ||
| ||
| ||
| ||
Bone marrow |
| |
Spleen |
|
|
Lungs |
|
|
| ||
Liver |
|
|
| ||
| ||
|
| |
| ||
| ||
| ||
Kidneys |
|
|
|
| |
|
| |
CNS |
| |
| ||
| ||
|
M. suis Protein | Function in Adhesion to Erythrocytes | Function in Glucose Metabolism (Glycolysis) | Ref. |
---|---|---|---|
MSG1 | confirmed | yes GAPDH (glyceraldehyde-3-phosphate dehydrogenase) | [65] |
α-Enolase | confirmed | yes enolase function | [74] |
OSGEP | confirmed | no | [75] |
HspA1 (DnaK) | expected | no | [77] |
M. suis hypothetical proteins (n = 7) | expected | unknown | [76] |
Continent | Country | Reference |
---|---|---|
Asia | China | [16,30,84,85,86,87] |
Japan | [14,36] | |
South Korea | [82,88] | |
Thailand | [15] | |
Africa | Ghana | [89] |
Kenya | [83] | |
Nigeria | [39,90,91] | |
South Africa | [60] | |
South America | Argentina | [54,92,93] |
Brazil | [22,34,81,94,95,96,97] | |
North America | Canada | [98] |
United States | [25,26,31,46,99,100] | |
Europe | Austria | [101,102,103] |
Belgium | [104] | |
France | [21,105] | |
Germany | [20,35,37,38,51,106,107,108,109] | |
Hungary | [110] | |
Italy | [111] | |
Portugal | [112] | |
Serbia | [113,114] | |
Switzerland | [106] | |
The Netherlands | [80] | |
United Kingdom | [43,61,115] |
Country | Ref. | Category | Prevalence (Animal Level) | Prevalence (Herd Level) | |||
---|---|---|---|---|---|---|---|
M. suis | Brazil | [97] | sows | 18.2% | (22/121) | 100% | (4/4) |
piglets | 1.64% | (1/61) | 25% | (1/4) | |||
boars | 25.0% | (1/4) | 25% | (1/4) | |||
[94] | slaughter pigs | 76.2% | (112/147) | not available | |||
[95] | sows + boars | 54.7% | (35/64) | not available | |||
[96] | sows | 18.75% | (15/80) | 40.6% | (11/27) | ||
France | [21] | sows | 53.0% | (105/198) | 100% | (10/10) | |
Germany | [106] | piglets | 10.6% | (17/160) | not available | ||
[51] | feeder pigs | 13.9% | (164/1176) | 40.3% | (79/196) | ||
[37,38] | slaughter pigs | 19.0% | (38/200) | 50.0% | (10/20) | ||
[20] | sows | 31.25% | (65/208) | 76.2% | (16/21) | ||
[37] | sows | 6.7% | (4/60) | not available | |||
[20] | piglets | 14.35% | (68/474) | not available | |||
[37] | boars | 0% | (0/0) | not available | |||
Japan | [36] | feeder pigs + sows | 5.0% | (6/120) | 9.1% | (1/11) | |
Korea | [82] | not specified | 0.2% | (3/1867) | not available | ||
Switzerland | [106] | sows | 19.0% | (19/100) | not available | ||
M. parvum | Germany | [37] | sows | 25.0% | (15/60) | not available | |
[37] | slaughter pigs | 36.0% | (72/200) | not available | |||
[37] | boars | 4.4% | (8/183) | not available | |||
Japan | [36] | feeder pigs + sows | 15.0% | (18/120) | 54.5% | (6/11) | |
Korea | [82] | not specified | 2.7% | (51/1867) | not available | ||
‘Ca. M. haemosuis’ | Germany | [38] | piglets | 4.5% | (28/622) | not available | |
[38] | sows | 6.25% | (13/208) | 14.28% | (3/21) | ||
[37,38] | slaughter pigs | 17.5% | (35/200) | 45.0% | (9/20) | ||
[37] | sows | 21.7% | (13/60) | not available | |||
[37] | boars | 0% | (0/0) | not available | |||
China | [30] | sows | 36.0% | (31/86) | not available | ||
fattening pigs | 23.1% | (55/238) | not available | ||||
Korea | [82] | not specified | 0.1% | (1/1876) | not available |
Haemoplasma Species | Target Gene | Primer/Probe Name | Primer/Probe Sequence (5′ to 3′) | Reference |
---|---|---|---|---|
M. suis | msg1 | Msg1-Fw (Forward) | ACAACTAATGCACTAGCTCCTATC | [106] |
Msg1-Rv (Reverse) | GCTCC TGTAGTTGTAGGAATAATTGA | |||
Probe msg1-1 (Probe 1) | TTCACGCTTTCACTTCTGACCAAAGAC-fluorescein | |||
Probe msg1-2 (Probe 2) | LCRed-640-CAAGACTCTCCTCACTCTGACCTAAGAAGAGC-phosphate | |||
16S rRNA | M.s.713_for (Forward) | AACACCAGAGGCTAAGGCGA | [103] | |
M.s.713_rev (Reverse) | TTACGGCGTGGACTACTGGG | |||
MGB (Probe) | FAMTAATTGACGCTGAGGCTT | |||
16S rRNA | RTsuisF (Forward) | CCCTGATTGTACTAATTGAATAAG | [100] | |
RTsuisR (Reverse) | GCGAACACTTGTTAAGCAAG | |||
MGBsuis2 (Probe) | FAM-TGRATACACAYTTCAG-MGBNFQ | |||
16S rRNA | Suis 16S F (Forward) | AACGCATACTTAACTTT | [36] | |
Suis 16S R (Reverse) | CAT ACT CCT ATT TAC CCG CT | |||
23 S rRNA | MS_23SF1 (Forward) | GAAGTTTGAGCGAGAGCACAG | [127] | |
MS_23SR3 (Reverse) | AGGGCTTAAGTTAGAAGCTTCAGC | |||
23 S rRNA | MS_23SF1q (Forward) | TTGAAGTTTGAGCGAGAGCACAG | [127] | |
MS_23SR1q (Reverse) | ACCCGTTGTCCATCAGTTACGT | |||
MS_probe (Probe) | FAM-GTGAGAATCTTTCTAGCCGATTGATC-MGB-NFQ | |||
M. parvum | gap | MPaF (Forward) | ATGCTGGCGCTCCTAAAGTT | [37] |
MPaR (Reverse) | CTGCTGCAGCTCTAGCTCTT | |||
16 S rRNA | Parvum 16S F (Forward) | AACACATATTTAACTTGCTC | [36] | |
Parvum 16S R (Reverse) | CATATTCCTATTCATCCGCG | |||
‘Ca. M. haemosuis’ | 16 S rRNA | cmsf2 (Forward) | AAACTCTGATGGTACCTCCTGAATAAGTGA | [30] |
cmsr2 (Reverse) | CCTTCGCTGGGGATGTCAAACCT | |||
gap | CMhsuisF (Forward) | TGCTTTGGCTCCTGTGGTTA | [38] | |
CMhsuisR (Reverse) | GCAGCAGCACCTGTAGAAGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ade, J.; Eddicks, M.; Ritzmann, M.; Hoelzle, K.; Hoelzle, L.E.; Stadler, J. Haemotrophic Mycoplasmas Infecting Pigs: A Review of the Current Knowledge. Microorganisms 2024, 12, 1267. https://doi.org/10.3390/microorganisms12071267
Ade J, Eddicks M, Ritzmann M, Hoelzle K, Hoelzle LE, Stadler J. Haemotrophic Mycoplasmas Infecting Pigs: A Review of the Current Knowledge. Microorganisms. 2024; 12(7):1267. https://doi.org/10.3390/microorganisms12071267
Chicago/Turabian StyleAde, Julia, Matthias Eddicks, Mathias Ritzmann, Katharina Hoelzle, Ludwig E. Hoelzle, and Julia Stadler. 2024. "Haemotrophic Mycoplasmas Infecting Pigs: A Review of the Current Knowledge" Microorganisms 12, no. 7: 1267. https://doi.org/10.3390/microorganisms12071267