Comparative Analysis of the Liver and Spleen Transcriptomes between Holstein and Yunnan Humped Cattle
Abstract
:Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Sample Collection
2.2. RNA Extraction, Transcriptome Library Construction, and Sequencing
2.3. Quality Control and Reads Mapping
2.4. Differentially Expressed Gene Analysis
2.5. Enrichment Analysis of Differentially Expressed Genes (DEGs)
2.6. Quantitative Reverse-Transcription Polymerase Chain Reaction (RT-qPCR) Validation
3. Results
3.1. RNA-Seq and Mapping
3.2. Identification of Differentially Expressed Genes
3.3. Function Enrichment Analysis for DEGs
3.4. Validation Analysis Using RT-qPCR
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Loftus, R.T.; MacHugh, D.E.; Bradley, D.G.; Sharp, P.M.; Cunningham, P. Evidence for two independent domestications of cattle. Proc. Natl. Acad. Sci. USA 1994, 91, 2757–2761. [Google Scholar] [CrossRef] [PubMed]
- Troy, C.S.; MacHugh, D.E.; Bailey, J.F.; Magee, D.A.; Loftus, R.T.; Cunningham, P.; Chamberlain, A.T.; Sykes, B.C.; Bradley, D.G. Genetic evidence for Near-Eastern origins of European cattle. Nature 2001, 410, 1088–1091. [Google Scholar] [CrossRef] [PubMed]
- Bruford, M.W.; Bradley, D.G.; Luikart, G. DNA markers reveal the complexity of livestock domestication. Nat. Rev. Genet. 2003, 4, 900–910. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Pardal, L.; Sánchez-Gracia, A.; Álvarez, I.; Traoré, A.; Ferraz, J.B.S.; Fernández, I.; Costa, V.; Chen, S.Y.; Tapio, M.; Cantet, R.J.C.; et al. Legacies of domestication, trade and herder mobility shape extant male zebu cattle diversity in South Asia and Africa. Sci. Rep. 2018, 8, 18027. [Google Scholar] [CrossRef] [PubMed]
- Glass, E.J.; Preston, P.M.; Springbett, A.; Craigmile, S.; Kirvar, E.; Wilkie, G.; Brown, C.G. Bos taurus and Bos indicus (Sahiwal) calves respond differently to infection with Theileria annulata and produce markedly different levels of acute phase proteins. Int. J. Parasitol. 2005, 35, 337–347. [Google Scholar] [CrossRef] [PubMed]
- Vordermeier, M.; Ameni, G.; Berg, S.; Bishop, R.; Robertson, B.D.; Aseffa, A.; Hewinson, R.G.; Young, D.B. The influence of cattle breed on susceptibility to bovine tuberculosis in Ethiopia. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 227–232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattioli, R.C.; Pandey, V.S.; Murray, M.; Fitzpatrick, J.L. Immunogenetic influences on tick resistance in African cattle with particular reference to trypanotolerant N’Dama (Bos taurus) and trypanosusceptible Gobra zebu (Bos indicus) cattle. Acta Trop. 2000, 75, 263–277. [Google Scholar] [CrossRef]
- Authié, E.; Duvallet, G.; Robertson, C.; Williams, D.J. Antibody responses to a 33 kDa cysteine protease of Trypanosoma congolense: Relationship to ‘trypanotolerance’ in cattle. Parasite Immunol. 2010, 15, 465–474. [Google Scholar] [CrossRef]
- Zeng, B.J.; Li, R.; Xiao, H.; Chen, S.Y. Advances in molecular genetic basis of disease resistance differences among domestic cattle breeds. Chin. J. Anim. Vet. Sci. 2017, 48, 193–200. [Google Scholar]
- Cargill, E.J.; Womack, J.E. Detection of polymorphisms in bovine Toll-like receptors 3, 7, 8, and 9. Genomics 2007, 89, 745–755. [Google Scholar] [CrossRef]
- Seabury, C.M.; Seabury, P.M.; Decker, J.E.; Schnabel, R.D.; Taylor, J.F.; Womack, J.E. Diversity and evolution of 11 innate immune genes in Bos taurus taurus and Bos taurus indicus cattle. Proc. Natl. Acad. Sci. USA 2010, 107, 151–156. [Google Scholar] [CrossRef] [PubMed]
- Bilgen, N.; Kul, B.C.; Offord, V.; Werling, D.; Ertugrul, O. Determination of genetic variations of Toll-like receptor (TLR) 2, 4, and 6 with next-generation sequencing in native cattle breeds of Anatolia and Holstein Friesian. Diversity 2016, 8, 23. [Google Scholar] [CrossRef]
- Fisher, C.A.; Bhattarai, E.K.; Osterstock, J.B.; Dowd, S.E.; Seabury, P.M.; Vikram, M.; Whitlock, R.H.; Schukken, Y.H.; Schnabel, R.D.; Taylor, J.F. Correction: Evolution of the Bovine TLR Gene Family and Member Associations with Mycobacterium avium Subspecies paratuberculosis Infection. PLoS ONE 2011, 6, e27744. [Google Scholar] [CrossRef] [PubMed]
- Freeman, A.R.; Lynn, D.J.; Murray, C.; Bradley, D.G. Detecting the effects of selection at the population level in six bovine immune genes. BMC Genet. 2008, 9, 62. [Google Scholar] [CrossRef] [PubMed]
- Peng, R.; Liu, Y.L.; Cai, Z.G.; Shen, F.J.; Chen, J.S.; Hou, R.; Zou, F.D. Characterization and analysis of whole transcriptome of giant panda spleens: Implying critical roles of long non-coding rnas in immunity. Cell. Physiol. Biochem. 2018, 46, 1065–1077. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.B.; Li, C.C.; Fang, M.D.; Zhu, M.J.; Li, X.Y.; Zhou, R.; Li, K.; Zhao, S.H. Understanding Haemophilus parasuis infection in porcine spleen through a transcriptomics approach. BMC Genom. 2009, 10, 64. [Google Scholar] [CrossRef]
- Tanaka, M.; Iwakiri, Y. Lymphatics in the liver. Curr. Opin. Immunol. 2018, 53, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential Expression of RNA-Seq Data at the Gene Level—The DESeq Package; EMBL: Heidelberg, Germany, 2013. [Google Scholar]
- Dennis, G.J.; Sherman, B.T.; Hosack, D.A.; Yang, J.; Gao, W.; Lane, H.C.; Lempicki, R.A. DAVID: Database for annotation, visualization, and integrated discovery. Genome Biol. 2003, 4, 3. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Tautz, D.; Ellegren, H.; Weigel, D. Next generation molecular ecology. Mol. Ecol. 2010, 19, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Yu, G.L.; Lin, Y.; Tang, Y.; Diao, Y.X. Comparative transcriptomic analysis of immune-related gene expression in duck embryo fibroblasts following duck tembusu virus infection. Int. J. Mol. Sci. 2018, 19, 2328. [Google Scholar] [CrossRef]
- Yang, X.; Zhang, H.; Shang, J.; Liu, G.; Xia, T.; Zhao, C.; Sun, G.; Dou, H. Comparative analysis of the blood transcriptomes between wolves and dogs. Anim. Genet. 2018, 49, 291–302. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.B.; Zhao, Z.H.; Yu, H.B.; Li, G.P.; Ping, J.; Yang, Y.W.; Yang, R.J.; Yu, X.Z. Comparative genome-wide methylation analysis of longissimus dorsi muscles between Japanese black (Wagyu) and Chinese Red Steppes cattle. PLoS ONE 2017, 12, e0182492. [Google Scholar] [CrossRef]
- Marioni, J.C.; Mason, C.E.; Mane, S.M.; Stephens, M.; Gilad, Y. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 2008, 18, 1509–1517. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Zhang, Y.Q.; Zhang, X.H.; Wang, D.C.; Jin, G.; Li, B.; Xu, F.; Cheng, J.; Zhang, F.; Wu, S.J. The comprehensive liver transcriptome of two cattle breeds with different intramuscular fat content. Biochem. Biophys. Res. Commun. 2017, 490, 1018–1025. [Google Scholar] [CrossRef]
- MacParland, S.A.; Liu, J.C.; Ma, X.Z.; Innes, B.T.; Bartczak, A.M.; Gage, B.K.; Manuel, J.; Khuu, N.; Echeverri, J.; Linares, I.; et al. Single cell RNA sequencing of human liver reveals distinct intrahepatic macrophage populations. Nat. Commun. 2018, 9, 4383. [Google Scholar] [CrossRef]
- Mosaad, Y.M.; Hammad, A.; Fawzy, Z.; El-Refaaey, A.; Tawhid, Z.; Hammad, E.M.; Youssef, L.F.; ElAttar, E.A.; Radwan, D.F.; Fawzy, I.M. C1q rs292001 polymorphism and C1q antibodies in juvenile lupus and their relation to lupus nephritis. Clin. Exp. Immunol. 2015, 182, 23–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, D.Y.; Qiu, T.Y.; Zhang, Q.C.; Kang, H.; Yuan, S.H.; Zhu, L.X.; Zhu, R.X. Systematic toxicity mechanism analysis of proton pump inhibitors: An in silico study. Chem. Res. Toxicol. 2015, 28, 419–430. [Google Scholar] [CrossRef] [PubMed]
- Pan, D.K.; Liu, T.; Lei, T.T.; Zhu, H.B.; Wang, Y.; Deng, S.P. Progress in multiple genetically modified minipigs for xenotransplantation in China. Xenotransplantation 2019, 26, e12492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qiao, P.; Dang, E.L.; Cao, T.Y.; Fang, H.; Zhang, J.Y.; Qiao, H.J.; Wang, G. Dysregulation of mCD46 and sCD46 contribute to the pathogenesis of bullous pemphigoid. Sci. Rep. 2017, 7, 145. [Google Scholar] [CrossRef] [PubMed]
- Madjd, Z.; Durrant, L.G.; Bradley, R.; Spendlove, I.; Ellis, I.O.; Pinder, S.E. Loss of CD55 is associated with aggressive breast tumors. Clin. Cancer. Res. 2004, 10, 2797–2803. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, M.; Mizuno, M.; Kawada, M.; Uesu, T.; Nasu, J.; Takeuchi, K.; Okada, H.; Endo, Y.; Fujita, T.; Tsuji, T. Polymorphic expression of decay-accelerating factor in human colorectal cancer. J. Gastroenterol. Hepatol. 2001, 16, 184–189. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, L.; Peng, S.; Chen, Z.; Gimm, O.; Finke, R.; Hoang-Vu, C. The expression of CD97EGF and its ligand CD55 on marginal epithelium is related to higher stage and depth of tumor invasion of gastric carcinomas. Oncol. Rep. 2005, 14, 1413–1420. [Google Scholar] [CrossRef]
- Chen, H.H.; Tsai, L.J.; Lee, K.R.; Chen, Y.M.; Hung, W.T.; Chen, D.Y. Genetic association of complement component 2 polymorphism with systemic lupus erythematosus. Tissue Antigens 2015, 86, 122–133. [Google Scholar] [CrossRef]
- Kasanmoentalib, E.S.; Valls Seron, M.; Ferwerda, B.; Tanck, M.W.; Zwinderman, A.H.; Baas, F.; Van Der Ende, A.; Brouwer, M.C.; Van De Beek, D. Mannose-binding lectin-associated serine protease 2 (MASP-2) contributes to poor disease outcome in humans and mice with pneumococcal meningitis. J. Neuroinflammation 2017, 14, 2. [Google Scholar] [CrossRef]
- Nicolicht, P.; Faria, D.O.S.; Martins-Silva, L.; Maia, L.S.M.; Moreno, A.S.; Arruda, L.K.; Motta, A.A.; Grumach, A.S.; Pesquero, J.B. Gene mapping strategy for Alu elements rearrangements: Detection of new large deletions in the SERPING1 gene causing hereditary angioedema in Brazilian families. Gene 2019, 685, 179–185. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, W.W.; Tang, L.; Chen, W.W.; Guan, X.X. Epithelial-mesenchymal transition induced PAI-1 is associated with prognosis of triple-negative breast cancer patients. Gene 2018, 670, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.K.; Carrillo, J.A.; Ding, Y.; He, Y.H.; Zhao, C.P.; Liu, J.N.; Liu, G.E.; Zan, L.S.; Song, J.Z. Transcriptomic profiling of spleen in Grass-Fed and Grain-Fed Angus cattle. PLoS ONE 2015, 10, e0135670. [Google Scholar] [CrossRef] [PubMed]
- Seth, R.B.; Sun, L.; Ea, C.K.; Chen, Z.J. Identification and Characterization of MAVS, a Mitochondrial Antiviral Signaling Protein that Activates NF-κB and IRF3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, S.; Li, F.; Qin, L. NLRX1 attenuates apoptosis and inflammatory responses in myocardial ischemia by inhibiting MAVS-dependent NLRP3 inflammasome activation. Mol. Immunol. 2016, 76, 90–97. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.T.; Tong, X.M.; Li, G.; Li, J.; Deng, M.; Ye, X. Ankrd17 positively regulates RIG-I-like receptor (RLR)-mediated immune signaling. Eur. J. Immunol. 2012, 42, 1304–1315. [Google Scholar] [CrossRef] [PubMed]
- Menning, M.; Kufer, T.A. A role for the Ankyrin repeat containing protein Ankrd17 in Nod1- and Nod2-mediated inflammatory responses. FEBS Lett. 2013, 587, 2137–2142. [Google Scholar] [CrossRef] [PubMed]
- Mahla, R.S.; Reddy, M.C.; Prasad, D.V.; Kumar, H. Sweeten PAMPs: Role of sugar complexed PAMPs in innate immunity and vaccine biology. Front. Immunol. 2013, 4, 248. [Google Scholar] [CrossRef]
- Cates, E.A.; Connor, E.E.; Mosser, D.M.; Bannerman, D.D. Functional characterization of bovine TIRAP and MyD88 in mediating bacterial lipopolysaccharide-induced endothelial NF-kappaB activation and apoptosis. Comp. Immunol. Microbiol. Infect. Dis. 2009, 32, 477–490. [Google Scholar] [CrossRef]
- Beutler, B.A. TLRs and innate immunity. Blood 2008, 113, 1399–1407. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Product Length (bp) |
---|---|---|---|
PON3 | TGCCACCAGAGACCACTA | AGAAGAGCACCTGAGTCC | 86 |
TIMELESS | AGAGGATGATGATGAGAGCGA | CGGATTCAAATTCACCACCTA | 81 |
RDH5 | GGTACGGGTCTCTATCGTG | CCAAAGTTTCCAGGTTTGTC | 65 |
ST6GAL1 | TTCAAGAAATCTCCTCGGAGC | TTGGATGGGAGGAACTCGTA | 118 |
MASP2 | GCTCCAGCCTGGATGTCA | TGCAGAGTAGAAGGCCTCA | 80 |
C4BPB | TATTGTGGGCCACTGTCC | ATTCACATTCACAGGCTCC | 73 |
DEFB4A | CATGCTGCAGGAGGTAGTAA | CAGTTTCTGACTCCGCATT | 65 |
HBA | GACCAAAGCGGTGGAACA | AGGTCACTCAGTTCAGACAG | 60 |
ORM1 | ATGTCATCAAGTGCATAGGC | ATCCTTCTTCTCGTCAGTGT | 62 |
PENK | ATGAGAAGAGTGGGTCGT | GCTTGAGGAAGCCACCGTA | 67 |
PRSS2 | TCCAGGGCATTGTGTCTT | TCCTGAATCCAGTCCACG | 94 |
GAPDH | CACCCTCAAGATTGTCAGCA | GGTCATAAGTCCCTCCACGA | 103 |
Sample | Raw Reads | Total Reads | Total Mapped | Multiple Mapped | Uniquely Mapped |
---|---|---|---|---|---|
LNBIL15 | 151,610,288 | 146,798,108 | 141,959,097 (96.70%) | 11,387,576 (7.76%) | 130,571,521 (88.95%) |
LNBIL23 | 158,426,510 | 149,138,882 | 143,215,256 (96.03%) | 11,038,440 (7.40%) | 132,176,816 (88.63%) |
LNBIL33 | 158,008,850 | 148,991,036 | 143,216,931 (96.12%) | 10,108,526 (6.78%) | 133,108,405 (89.34%) |
LNBIL48 | 158,698,260 | 149,549,442 | 143,742,832 (96.12%) | 10,320,099 (6.90%) | 133,422,733 (89.22%) |
LNBIL52 | 168,246,008 | 158,878,130 | 152,686,465 (96.10%) | 11,676,419 (7.35%) | 141,010,046 (88.75%) |
LNBIS15 | 151,867,606 | 146,831,026 | 138,375,611 (94.24%) | 9,902,596 (6.74%) | 128,473,015 (87.50%) |
LNBIS23 | 154,069,138 | 149,005,788 | 141,309,652 (94.84%) | 9,514,847 (6.39%) | 131,794,805 (88.45%) |
LNBIS33 | 157,622,632 | 148,145,826 | 139,711,950 (94.31%) | 8,507,598 (5.74%) | 131,204,352 (88.56%) |
LNBIS48 | 157,185,058 | 148,828,996 | 140,530,424 (94.42%) | 9,373,622 (6.30%) | 131,156,802 (88.13%) |
LNBIS52 | 175,323,500 | 165,047,030 | 152,074,621 (92.14%) | 10,333,303 (6.26%) | 141,741,318 (85.88%) |
PNBTL13 | 158,211,656 | 149,867,928 | 145,298,732 (96.95%) | 9,247,889 (6.17%) | 136,050,843 (90.78%) |
PNBTL24 | 158,210,184 | 150,330,960 | 145,905,391 (97.06%) | 10,646,629 (7.08%) | 135,258,762 (89.97%) |
PNBTL37 | 160,387,868 | 155,323,182 | 151,501,438 (97.54%) | 10,344,558 (6.66%) | 141,156,880 (90.88%) |
PNBTL47 | 153,100,356 | 148,219,400 | 144,578,196 (97.54%) | 11,445,184 (7.72%) | 133,133,012 (89.82%) |
PNBTL57 | 151,520,072 | 146,777,702 | 142,946,257 (97.39%) | 9,632,568 (6.56%) | 133,313,689 (90.83%) |
PNBTS13 | 179,001,604 | 170,245,090 | 161,695,701 (94.98%) | 13,838,064 (8.13%) | 147,857,637 (86.85%) |
PNBTS24 | 158,417,034 | 150,073,450 | 143,034,331 (95.31%) | 11,076,554 (7.38%) | 131,957,777 (87.93%) |
PNBTS37 | 158,604,840 | 150,948,876 | 144,191,794 (95.52%) | 6,735,375 (4.46%) | 137,456,419 (91.06%) |
PNBTS47 | 152,406,952 | 148,084,368 | 141,738,020 (95.71%) | 11,052,917 (7.46%) | 130,685,103 (88.25%) |
PNBTS57 | 160,635,684 | 156,375,142 | 150,989,616 (96.56%) | 12,356,517 (7.90%) | 138,633,099 (88.65%) |
Pathway ID | Pathway Description | Number of DEGs | p-Value |
---|---|---|---|
bta01100 | Metabolic pathways | 126 | 0.0001 |
bta02010 | ATP-binding cassette (ABC) transporters | 9 | 0.0080 |
bta05204 | Chemical carcinogenesis | 12 | 0.0092 |
bta04610 | Complement and coagulation cascades | 12 | 0.0138 |
bta00051 | Fructose and mannose metabolism | 7 | 0.0192 |
bta00590 | Arachidonic acid metabolism | 11 | 0.0310 |
bta05166 | HTLV-I infection | 28 | 0.0383 |
bta04152 | AMPK signalling pathway | 15 | 0.0419 |
bta00830 | Retinol metabolism | 9 | 0.0448 |
bta04976 | Bile secretion | 10 | 0.0478 |
bta00982 | Drug metabolism—cytochrome P450 | 9 | 0.0490 |
Pathway ID | Pathway Description | Number of DEGs | p-Value |
---|---|---|---|
bta04145 | Phagosome | 22 | 0.00600 |
bta01100 | Metabolic pathways | 113 | 0.00690 |
bta04144 | Endocytosis | 31 | 0.00750 |
bta04530 | Tight junction | 19 | 0.0098 |
bta04071 | Sphingolipid signalling pathway | 17 | 0.0126 |
bta04380 | Osteoclast differentiation | 18 | 0.0165 |
bta04015 | Rap1 signalling pathway | 25 | 0.0211 |
bta04514 | Cell adhesion molecules (CAMs) | 19 | 0.0295 |
bta04340 | Hedgehog signalling pathway | 6 | 0.0312 |
bta05152 | Tuberculosis | 21 | 0.0382 |
bta04974 | Protein digestion and absorption | 12 | 0.0394 |
bta04610 | Complement and coagulation cascades | 11 | 0.0400 |
bta05323 | Rheumatoid arthritis | 13 | 0.0411 |
bta04666 | Fc gamma R-mediated phagocytosis | 12 | 0.0424 |
bta05162 | Measles | 14 | 0.0460 |
Tissue | Gene | Description | Expression Up_Down | p-Value |
---|---|---|---|---|
Liver | TLR3 | Toll Like Receptor 3 | Up | 0.0107 |
TLR7 | Toll Like Receptor 7 | Up | 0.0326 | |
C1QB | Complement C1q B Chain | Up | 0.0031 | |
CD46 | CD46 Molecule | Up | 0.0001 | |
CD55 | CD55 Molecule | Up | 0.0003 | |
C2 | Complement C2 | Down | 0.0025 | |
MASP2 | Mannan Binding Lectin Serine Peptidase 2 | Up | 0.0000 | |
F2 | Coagulation Factor II, Thrombin | Up | 0.0000 | |
SERPING1 | Serpin Family G Member 1 | Down | 0.0003 | |
SERPINE1 | Serpin Family E Member 1 | Down | 0.0005 | |
C4BPA | Complement Component 4 Binding Protein Alpha | Up | 0.0025 | |
C4BPB | Complement Component 4 Binding Protein Beta | Up | 0.0000 | |
Spleen | MAVS | Mitochondrial Antiviral Signaling Protein | Up | 0.0128 |
NLRX1 | Nucleotide binding domain and leucine-rich repeat-containing (NLR) Family Member X1 | Down | 0.0003 | |
ANKRD17 | Ankyrin Repeat Domain 17 | Up | 0.0371 | |
NOD2 | Nucleotide Binding Oligomerization Domain Containing 2 | Up | 0.0256 | |
TLR2 | Toll Like Receptor 2 | Down | 0.0000 | |
TLR6 | Toll Like Receptor 6 | Down | 0.0003 | |
CD46 | CD46 Molecule | Up | 0.0031 | |
TIRAP | TIR Domain Containing Adaptor Protein | Down | 0.0242 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Zeng, B.; Shi, P.; Xiao, H.; Chen, S. Comparative Analysis of the Liver and Spleen Transcriptomes between Holstein and Yunnan Humped Cattle. Animals 2019, 9, 527. https://doi.org/10.3390/ani9080527
Chen Y, Zeng B, Shi P, Xiao H, Chen S. Comparative Analysis of the Liver and Spleen Transcriptomes between Holstein and Yunnan Humped Cattle. Animals. 2019; 9(8):527. https://doi.org/10.3390/ani9080527
Chicago/Turabian StyleChen, Yanyan, Benjuan Zeng, Peng Shi, Heng Xiao, and Shanyuan Chen. 2019. "Comparative Analysis of the Liver and Spleen Transcriptomes between Holstein and Yunnan Humped Cattle" Animals 9, no. 8: 527. https://doi.org/10.3390/ani9080527