Detection of Multidrug-Resistant RND Efflux Pumps and Regulatory Proteins in Antibiotic-Resistant P. aeruginosa Recovered from Hospital Wastewater Effluent in the Eastern Cape Province of South Africa
Patho-Biocatalysis Group (PBG), Department of Biochemistry and Microbiology, University of Fort Hare, Private Bag X1314, Alice 5700, South Africa
*
Author to whom correspondence should be addressed.
Appl. Sci. 2023, 13(20), 11241; https://doi.org/10.3390/app132011241
Submission received: 6 September 2023
/
Revised: 11 October 2023
/
Accepted: 12 October 2023
/
Published: 13 October 2023
(This article belongs to the Section Applied Microbiology)
Abstract
:P. aeruginosa (P. aeruginosa) is a problematic hospital agent that is a global challenge due to the ineffectiveness of some conventional antimicrobial therapies. Multidrug-resistant (MDR) P. aeruginosa has distinct action modes, including beta-lactamase production, porin gene repression, and efflux pump overexpression. This current research work focuses on efflux pumps (MexAB-OprM, MexCD-OprJ, MexXY-OprN) and their regulatory proteins (NfxB, MexR, MexZ, NalC, NalD) in MDR P. aeruginosa isolated from hospital wastewater effluent. The sequence analysis of the main transporter MexB was also performed. Following antibiotic resistance profiling and polymerase chain reaction (PCR) amplification of the efflux pump genes, the association of the efflux pump proteins with antibiotic resistance was investigated and analysed statistically. Fifty-seven (57) multidrug-resistant isolates were obtained from 81 PCR-confirmed P. aeruginosa isolates. Of the MDR P. aeruginosa isolates, the following rates were recorded: MexA (96.5%), MexB (100%), OprM (96.5%), MexC (100%), MexD (74.1%), OprJ (63.7%), MexX (89.6%), and OprN (51.7%). Additionally, the regulatory proteins had the following rates: NfxB (31.6%), NalC (15.8%), NalD (12.2%), MexZ (3.5%), and MexR (3.5%). The efflux pumps and regulatory proteins are strongly associated with antibiotic resistance, implying that P. aeruginosa antibiotic resistance is heavily influenced by these efflux pumps and regulatory genes. The MexB DNA sequences had numerous substitutions and poor alignment with divergent regions, and hence they have a possible role in increased antibiotic resistance. The absence of regulatory genes in most MDR P. aeruginosa isolates in the current research may have permitted transcription of the efflux pump operons, thus also increasing the antibiotic resistance burden.
1. Introduction
P. aeruginosa is a significant cause of hospital-acquired infection [1]. Treatment of diseases brought about by P. aeruginosa is complex due to its antibiotic resistance to multiple antimicrobial agents [2]. Infections caused by drug-resistant P. aeruginosa lead to increased morbidity, death, extended duration in the hospital and cost of treatment [3]. Resistance can manifest from possessing resistance genes or changes that alter gene expression. In addition to the numerous known mechanisms of antibiotic resistance, overexpression of the efflux pump leads to decreased drug concentration, an essential means of antibiotic resistance.
The efflux pump transporters are classified into the following superfamilies: the ATP-binding cassette (ABC) superfamily, the multidrug and toxic compound extrusion (MATE) superfamily, the major facilitator superfamily (MFS), the resistance nodulation and cell division (RND) superfamily, and the small multidrug resistance (SMR) superfamily. The extrusion of antibiotics through the multidrug efflux system of the RND superfamily is the most predominant mechanism in P. aeruginosa. The RND multidrug efflux systems have three components: a cytoplasmic membrane, a periplasmic membrane fusion protein (MFP), and an outer membrane protein that helps to transport antibiotics from the cytoplasm via the periplasmic space to the outside of the cell [4]. The genetic makeup of P. aeruginosa comprises many RND superfamilies’ operons, such as MexAB-OprM, MexCD-OprJ, MexEF-OprN, MexXY-OprM, MexJK-OprM, MexGHI-OpmD and MexVW-OprM, which are responsible for intrinsic and acquired multidrug resistance.
MexAB-OprM was the first discovered out of all RND pumps to target multiple classes of antibiotics and common wild-type strains, hence its multidrug resistance. The substrates of MexAB-OprM are chloramphenicol, β-lactams, carbapenems, fluoroquinolones, tetracyclines, trimethoprim and sulphonamides. Likewise, dyes, detergents, triclosan, and organic solvents are also substrates of MexAB-OprM [1]. MexCD-OprJ’s substrates include quinolones, tetracycline, chloramphenicol, acriflavine, ethidium bromide, triclosan and organic solvents [5]. The extrusion of aminoglycosides is specific to MexXY-OprM [6].
Transcriptional repressors regulate efflux pump expression. These repressors block the transcription of operons. Intriguingly, the regulators are triggered by the substrates to be pumped out of the bacteria cell [7]. Repressor genes, such as MexR, NalD, and NalC, downregulate MexAB-OprM system expression [8]. The MexR gene, which encodes a repressor of the MarR family, is found upstream of the MexAB-OprM operon, forming a stable homodimer. Consequently, it downregulates transcription from the MexAB-OprM operon when bound to an intergenic region [9]. NalC and NalD belong to the TetR family; while the nalC is encoded by the NalC protein, NalD, a transcriptional regulator, acts as a repressor of the MexAB-OprM by attaching to a sequence between MexAB-OprM and the MexR binding site near the MexA promoter. As a result, NalD deficiency in nalD-type mutants results in MexAB-OprM overexpression [10]. The repressor genes of MexCD-OprJ and MexXY-OprM operons are nfxB and mexZ, respectively, which obstructs the transcription of the operons. In addition, MexXY gene deletion results in P. aeruginosa’s susceptibility to aminoglycosides, tetracycline, and erythromycin [11]. The blockage of transcription of efflux pump operons by repressors confers multidrug resistance in P. aeruginosa isolates.
The efflux pump system’s inner membrane component is the site for substrate attachment. However, a mutation in the DNA sequence of the inner membrane reduces its stability and, as a result, enables the RND multidrug efflux pumps [12]. Changes in the transmembrane domain of the inner membrane can impair the efflux pump [13,14]. There are few reports on the burden of efflux pump genes of MDR P. aeruginosa in association with their regulatory proteins recovered from hospital effluents in South Africa. Therefore, this study investigated the presence of RND efflux pump components and regulatory proteins in multidrug-resistant P. aeruginosa recovered from hospital wastewater discharge and MexB sequence variation analysis.
2. Materials and Methods
2.1. Bacterial Strains
The samples were obtained on a weekly basis (April to December 2023) from hospital discharge points at Victoria Hospital in the Eastern Cape Province of South Africa. A ten-fold serial dilution of the wastewater sample was performed. A 100 mL aliquot was filtered through a membrane filter with a pore size of 0.45 μm (Sartorius, Goettingen, Germany) according to the membrane filtration technique. The filtrate was aseptically placed on the Cetrimide agar surface (Sigma-Aldrich, St. Louis, MO, USA) plate and incubated at 37 °C for 24 h. Each sample was analysed in triplicate. However, distinct colonies with the characteristic pyocyanin and pyoverdine pigments showing blue-green and yellow-green colour were presumptive for P. aeruginosa. The presumptive P. aeruginosa was purified on nutrient agar and stored for DNA extraction. After careful extraction of the DNA [15], the P. aeruginosa strains were confirmed using a polymerase chain reaction (PCR) assay. The amplification was performed in a 50 μL reaction mixture, which consisted of 25 μL of Taq 2X master mix, 1 μL of 10 μM forward and reverse primers and 5 μL of template genomic DNA. PCR-grade water was added to make up the 50 μL total volume. Amplification was executed using the thermal cycler MyCyclerTM. The amplification product was separated on 1% agarose in 1X TBE pH 8·0 at 80 volts for 1 h and stained with ethidium bromide before being visualized under Alliance 4.7 transilluminator (UVITEC Limited, Cambridge, UK). The primers used in the identification of P. aeruginosa are listed in Table S1 in the Supplementary Files.
2.2. Evaluation of Resistance Profile
Kirby–Bauer disk diffusion was employed to ascertain the resistance rates of the confirmed P. aeruginosa isolates and further interpreted following CLSI guidelines. The P. aeruginosa isolates were tested against the following antibiotic disks: imipenem (IMI), amikacin-(AK), aztreonam (ATM), ceftazidime (CAZ), ciprofloxacin (CIP), tobramycin (TOB), gentamicin (GEN), meropenem (MEM), levofloxacin (LEV) and norfloxacin (NOR). P. aeruginosa isolates, resistant to more than three antibiotic classes, were classified as multidrug-resistant (MDR).
2.3. PCR Amplification of Efflux Pump Genes and Regulatory Proteins
The bacterial DNA of MDR P. aeruginosa was extracted as previously reported but with slight modifications [16]. The extracted DNA was used as a template for amplifying the efflux pump gene and regulatory proteins. The following efflux pump genes (MexA, MexB, OprM, MexC, MexD, OprJ, MexX, MexY, OprN) and specific regulatory proteins (MexR, MexZ, NalC, NalD, NfxB) were assayed in multidrug-resistant P. aeruginosa isolates using gene-specific primers. PCR reactions were made up of a total volume of 25 µL of PCR mixture with 5 µL of DNA, 1 µL of each forward and reverse primer, 12.5 µL of PCR master mix and 5.5 µL of nuclease-free water. The PCR products were visualised using 1.5% agarose gel electrophoresis (AGE) under a UV transilluminator (Alliance 4.7, UVITEC, Cambridge, UK). The primer sequences are listed in Table 1.
2.4. DNA Sequencing
The PCR products were further purified to remove unincorporated nucleotides and excess primers via the ExoSAP method using Exonuclease 1 (Exol) and Shrimp Alkaline Phosphatase (SAP). A reaction mixture containing 5 μL of PCR products, 0.5 μL of Exonuclease 1 and 1 μL of SAP was placed in a PCR tube. The mixture was further incubated in a thermal cycle at 37 °C and 85 °C for 15 min each. The reaction was used for Sanger sequencing. DNA sequencing was performed with 1 μL of Big Dye Terminator DNA v3.1 Ready Reaction mix (Applied Biosystems, Warrington, UK), 5 μL of genomic DNA (0.6–4 ng/μL), 1 μL of primer, 1.5 μL of 5X BigDye Sequencing buffer and 1.5 μL of molecular-grade water. Cycle conditions included denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s, and extension at 60 °C for 4 min over the course of 25 cycles. The sequencing products were purified by adding 2.5 μL of 125 mM EDTA and 30 μL of 99.9% ethanol, which were vortexed briefly. The reaction mixture was incubated at room temperature for 1 h, protected from light, and then washed using 70% ice-cold ethanol. The ABI 3500XL Genetic Analyser Data Collection System by Applied Biosystems, UK generated the chromatogram. The chromatograms were converted into text format using chromas software version 2.0, and sequences were opened using Bioedit Alignment Editor and analysed using the Basic Local Alignment Search Tool (BLASTn) Bioinformatics tool [24], accessible from NCBI (http://www.ncbi.nlm.nih.gov/ (accessed on 13 June 2023)). The sequences of MexB in the most common and essential clinical Gram-negative pathogens were retrieved from the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/ (accessed on 13 June 2023)). The sequences were from strains of S. rhizophila, A. chroococcum, A. vinelandii, Pseudomonas aeruginosa, Cupriavidus sp., Cupriavidus oxalaticus, Ralstonia pickettii and K. necator. The percentage similarity to other identified organisms was also recorded. The fasta sequence was aligned using clustal Omega version 1.2.1 on https://www.ebi.ac.uk/Tools/msa/clustalo/ (accessed on 13 June 2023) to investigate mutations in the nucleotide sequences [25,26]. To confirm the variations in complementary amino acids, the nucleotide sequences were converted into amino acids using the Expasy translate programme (https://web.expasy.org/translate/ (accessed on 13 June 2023)).
2.5. Phylogenetic Analysis
To evaluate the phylogenetic relationship of the MexB protein belonging to different genotypes, we used a sequence of a strain to represent each bacterium. All aligned sequences were then subjected to the MEGA11 molecular evolutionary genetic analysis to draw a phylogenetic tree. The evolutionary relationships were investigated by analysing the phylogenetics.
3. Results
3.1. Resistance Profile
In this study, PCR confirmed 81 (56.2%) P. aeruginosa isolates, with 70% being MDR. Most of the MDR P. aeruginosa isolates were resistant to six antibiotic classes, and a similar percentage were resistant to three, five and seven antibiotic classes, as shown in Figure 1. The antibiotic resistance rates ranged from 3.6% to 69.1%, with amikacin having the highest resistance rate of 76%, as shown in Figure 2. All (100%) MDR P. aeruginosa in this study were resistant to the aminoglycosides class of antibiotics. Meanwhile, 88% of P. aeruginosa isolates resisted fluoroquinolones and beta-lactam classes of antibiotics. Carabepenem resistance was also recorded in 75% of the MDR P. aeruginosa isolates, as shown in Table 2.
3.2. Prevalence of Efflux Pump and Regulatory Genes
MexAB-OprM is the most common efflux pump system in this study with the following rates: MexA (96.5%), MexB (100%), and OprM (96.5%). Furthermore, MexCD-OprJ was the second most prevalent, with the following prevalence rates: MexC (100%), MexD (74.1%), and OprJ (63.7%). MexX and OprN had the lowest occurrence, with 89.6% and 51.7% rates, respectively. MexY was not harboured in all P. aeruginosa isolates, as shown in Figure 3. All RND efflux pump genes investigated in this study were detected in 40% of MDR P. aeruginosa isolates. NfxB, a repressor encoded upstream of the MexCD-OprJ operon, was harboured in 31.6% MDR P. aeruginosa isolates. Meanwhile, NalC, NalD, MexZ and MexR were expressed in 15.8%, 12.2%, 3.5% and 3.5% of P. aeruginosa isolates, respectively, as shown in Figure 4.
The distribution of efflux pump genes across the antibiotic classes (beta-lactams, fluoroquinolones, carbapenems, and aminoglycosides) shows a similar prevalence rate, with all MDR isolates harbouring MexB and MexC. Meanwhile, other efflux pump genes were found to have the following ranges across the four antibiotics classes: MexA (96–98%), OprM (95–96.5%), MexD (74–76%), OprJ (62–65%), MexX (86–89.6%), and OprN (51–52%). All MDR P. aeruginosa isolates showed unique resistance patterns alongside the efflux pump genes and regulatory proteins. The distribution of efflux pump genes, regulatory proteins and resistance patterns of all MDR P. aeruginosa isolates are represented in Table 3. At the same time, the occurrence of antibiotic resistance to all tested antibiotics and efflux pump genes is shown in Table 4. The arrangement of the efflux pump systems as operons is shown in Table 5. A typical gel picture of all efflux pump genes and regulatory proteins is shown in Supplementary Figures S1–S3.
3.3. Sequence Analysis
Each block has a symbolic conservation score beneath the bottom row. When a sequence is highlighted in green with an asterisk (*), it is a conserved sequence, since all its nucleotide or amino acid positions are the same. A blank gap ( ) in red means that the nucleotide or amino acid is drastically different; hence, it is called non-conservative substitution. The aligned MexB main transporter sequence has mutations shown by the black gap, as represented in Supplementary Figure S4. There were variations in the translated amino acid sequences, as seen in Supplementary Figure S5. Phylogenetic analysis revealed differentiation of closely related strains, as shown in Figure 5.
4. Discussion
The efflux pump system is the most important means of resistance encoded on the P. aeruginosa chromosome [27]. Efflux pump systems, found in bacterial membrane transporters, are among the diverse mechanisms for multidrug resistance. Expression levels of the efflux system lead to antibiotic resistance when elevated [28]. This study investigated the resistance level and genotypic amplification of RND efflux pumps in all multidrug-resistant P. aeruginosa. The antibiotics investigated in this study are preferred substrates for RND efflux pumps. P. aeruginosa isolated in this study were resistant to aminoglycosides, fluoroquinolones, carbapenems, and the beta-lactam class of antibiotics with a phenotypic resistance rate of 76% for amikacin, ceftazidime (66%), gentamicin (60%) and levofloxacin (57%), meropenem (53%), ciprofloxacin (49%), aztreonam (30%), norfloxacin (15%), tobramycin (15%) and imipenem (7%). All (100%) MDR P. aeruginosa isolates resisted the aminoglycosides antibiotics class, while 88% were simultaneously resistant to the beta-lactam and fluoroquinolones class. However, the lowest occurrence of MDR P. aeruginosa isolates was detected in the carbapenem (75%) class of antibiotics. MDR was found in 70% of P. aeruginosa isolates, with resistance to six antibiotic classes being the most common.
The MexAB-OprM is the earliest and most common MDR efflux pump with elevated expression levels in the RND family [29]. Generally, PCR amplification of the efflux pump genes revealed that all MDR P. aeruginosa isolates harboured MexB and MexC, while MexA and OprM had the same rate of 96.5%. Meanwhile, MexX, MexD, OprJ and OprN occurred in 89.6%, 74.1%, 63.7% and 51.7% of the P. aeruginosa isolates, respectively. Similarly, a study detected MexA and MexB with prevalence rates of 88.2% and 70.5% in P. aeruginosa isolated from patients suffering from healthcare-associated infections [30]. In contrast, a study on the roles and associations of efflux pumps of P. aeruginosa in Iran found a lower occurrence of MexA, MexB, and OprM [18,31]. MexAB-OprM significantly extrudes quinolones, chloramphenicol, aminoglycosides, tetracycline, novobiocin, and beta-lactams [32]. Based on possessing the three components of an efflux pump system, MexAB-OprM is the most common in this study, with a frequency of 93%. Similarly, another study reported MexAB-OprM as the most prevalent efflux pump [29]. In addition, the P. aeruginosa isolates were also positive for MexCD-OprJ and MexX-OprN operons in 60% and 49% of the MDR P. aeruginosa isolates, respectively. Varying prevalence rates were observed for MexA (96–98%), OprM (95–96.5%), MexD (74–76%), OprJ (62–65%), MexX (86–89.6%), and OprN (51–52%) across beta-lactams, fluoroquinolones, carbapenems, and aminoglycosides antibiotic classes in MDR P. aeruginosa isolates. However, MexB and MexC were present in all MDR P. aeruginosa isolates across the abovementioned classes of antibiotics.
The regulatory proteins of the efflux pumps in this study showed the highest occurrence of NfxB (31.6%), followed closely by NalC and NalD, with a prevalence rate of 15.8% and 12.2%, respectively, in the MDR P. aeruginosa isolates. The exact incidence rate of 3.5% was found for MexZ and MexR. The absence of regulatory genes in most of the MDR P. aeruginosa isolates in this study may have enabled the transcription of efflux pump operons, which is evident in the high occurrence of efflux pump genes and eventual increase in multidrug resistance.
Antibiotic resistance has emerged due to alterations brought on by mutations [33]. Mutation in the DNA sequences alters efflux pump genes’ regulation, resulting in species-specific gene expression patterns and evolutionary changes [34]. Modifying the main transporters can enable RND multidrug efflux pumps, increasing expression. Mutation due to hypervariable regions leads to increased expression of antibiotic resistance in Pseudomonas aeruginosa isolates. The level of variation seen in the main transporter MexB efflux pump gene in this study indicates its role in multidrug resistance in Pseudomonas aeruginosa. In this study, the MexB DNA sequences are not homologous and have numerous substitutions, hence their poor alignment with divergent regions. However, the differences observed in the nucleotide sequence of the bacteria strains investigated in this study led to different amino acid coding. The differences in the nucleotide sequence among the organisms resulted in differences in the phylogenetic evolution. Moreover, evolutionary differences occur in bacteria due to errors during translation to transcription at the molecular level. This explains the current differences in bacteria strains, as shown in the phylogenetic relatedness. The higher levels of sequence variation allow the differentiation of closely related strains. Diversity in the bacteria strains might be due to changes in the bacteria nucleotide sequence due to mutation.
5. Conclusions
The roles of efflux pump genes and regulatory proteins in antibiotic resistance to commonly used antibiotics for therapeutic purposes are of great concern. This study’s data expose the alarming environmental burden of efflux pump genes harboured in MDR P. aeruginosa isolates from hospital wastewater effluent. This further reveals the minimal occurrence of regulatory proteins of these RND efflux pimps in MDR P. aeruginosa isolates, and hence the increased multidrug resistance. Antibiotic resistance is more frequently expressed in Pseudomonas aeruginosa isolates due to mutations caused by hypervariable areas. This study exposed the increased level of treatment failure of P. aeruginosa due to antibiotic resistance. However, there is a need to control the improper discharge of hospital wastewater into aquatic environments, mainly in rural areas of South Africa.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/app132011241/s1.
Author Contributions
Conceptualization, U.U.N.; Funding acquisition, U.U.N.; Methodology, J.U.O.; Supervision, U.U.N.; Writing—original draft, J.U.O.; Writing—review and editing, J.U.O. All authors have read and agreed to the published version of the manuscript.
Funding
The NRF-TWAS bursary support (Grant Number: 139049) and the Medical Research Council research grant supported the research.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Further information will be provided on request.
Acknowledgments
We thank the University of Fort Hare and the Patho-Biocatalysis Group (PBG).
Conflicts of Interest
The authors declare no conflict of interest.
References
- Adabi, M.; Talebi-Taher, M.; Arbabi, L.; Afshar, M.; Fathizadeh, S.; Minaeian, S.; Moghadam-Maragheh, N.; Majidpour, A. Spread of efflux pump overexpressing-mediated fluoroquinolone resistance and multidrug resistance in Pseudomonas aeruginosa by using an efflux pump inhibitor. Infect. Chemother. 2015, 47, 98–104. [Google Scholar] [CrossRef] [PubMed]
- Aires, J.R.; Köhler, T.; Nikaido, H.; Plésiat, P. Involvement of an active efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob. Agents Chemother. 1999, 43, 2624–2628. [Google Scholar] [CrossRef] [PubMed]
- Aloush, V.; Navon-Venezia, S.; Seigman-Igra, Y.; Cabili, S.; Carmeli, Y. Multidrug-resistant Pseudomonas aeruginosa: Risk factors and clinical impact. Antimicrob. Agents Chemother. 2006, 50, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Wang, D.; Zhou, W.; Sang, H.; Liu, X.; Ge, Z.; Zhang, J.; Lan, L.; Yang, C.G.; Chen, H. Novobiocin binding to NalD induces the expression of the MexAB-OprM pump in Pseudomonas aeruginosa. Mol. Microbiol. 2016, 100, 749–758. [Google Scholar] [CrossRef]
- Chenna, R.; Sugawara, H.; Koike, T.; Lopez, R.; Gibson, T.J.; Higgins, D.G.; Thompson, J.D. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 2003, 31, 3497–3500. [Google Scholar] [CrossRef]
- Choudhury, D.; Ghosh, A.; Chanda, D.D.; Das Talukdar, A.; Choudhury, M.D.; Paul, D.; Maurya, A.P.; Chakravorty, A.; Bhattacharjee, A. Premature termination of MexR leads to overexpression of MexAB-OprM efflux pump in Pseudomonas aeruginosa in a tertiary referral hospital in India. PLoS ONE 2016, 11, e0149156. [Google Scholar] [CrossRef]
- Choudhury, D.; Das Talukdar, A.; Choudhury, M.D.; Maurya, A.P.; Paul, D.; Chanda, D.D.; Chakravorty, A.; Bhattacharjee, A. Transcriptional analysis of MexAB-OprM efflux pumps system of Pseudomonas aeruginosa and its role in carbapenem resistance in a tertiary referral hospital in India. PLoS ONE 2015, 10, e0133842. [Google Scholar] [CrossRef]
- Eicher, T.; Brandsta, L. Structural and functional aspects of the multidrug efflux pump AcrB. Biol. Chem. 2009, 390, 693–699. [Google Scholar] [CrossRef]
- Issa, K.H.B.; Phan, G.; Broutin, I. Functional mechanism of the efflux pumps transcription regulators from Pseudomonas aeruginosa based on 3D structures. Front. Mol. Biosci. 2018, 5, 57. [Google Scholar] [CrossRef]
- Kishk, R.M.; Abdalla, M.O.; Hashish, A.A.; Nemr, N.A.; Nahhas, N.; El Alkahtani, S.; Mohamed, M.; Abdel-Daim, S.M.K. Efflux MexAB-Mediated Resistance in P. aeruginosa Isolated from Patients with Healthcare. Pathogens 2020, 9, 471. [Google Scholar] [CrossRef]
- Li, X.Z.; Zhang, L.; Poole, K. Role of the multidrug efflux systems of Pseudomonas aeruginosa in organic solvent tolerance. J. Bacteriol. 1998, 180, 2987–2991. [Google Scholar] [CrossRef] [PubMed]
- López, C.A.; Travers, T.; Pos, K.M.; Zgurskaya, H.I.; Gnanakaran, S. Dynamics of Intact MexAB-OprM Efflux Pump: Focusing on the MexA-OprM Interface. Sci. Rep. 2017, 7, 16521. [Google Scholar] [CrossRef] [PubMed]
- Madden, T. NCBI_blast information. In The NCBI Handbook; National Institutes of Health: Bethesda, MD, USA, 2002; pp. 1–15. [Google Scholar]
- Mapipa, Q.; Digban, T.O.; Nnolim, N.E.; Nwodo, U.U. Antibiogram profile and virulence signatures of Pseudomonas aeruginosa isolates recovered from selected agrestic hospital effluents. Sci. Rep. 2021, 11, 11800. [Google Scholar] [CrossRef]
- Masuda, N.; Sakagawa, E.; Ohya, S.; Gotoh, N.; Tsujimoto, H.; Nishino, T. Substrate specificities of MexAB-OprM, MexCD-OprJ, and MexXY-OprM efflux pumps in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2000, 44, 3322–3327. [Google Scholar] [CrossRef] [PubMed]
- Murugan, N.; Malathi, J.; Therese, K.L.; Madhavan, H.N.R. Application of six multiplex PCR’s among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes. Kaohsiung J. Med. Sci. 2018, 34, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Nogbou, N.D.; Nkawane, G.M.; Ntshane, K.; Wairuri, C.K.; Phofa, D.T.; Mokgokong, K.K.; Ramashia, M.; Nchabeleng, M.; Obi, L.C.; Musyoki, A.M. Efflux Pump Activity and Mutations Driving Multidrug Resistance in Acinetobacter baumannii at a Tertiary Hospital in Pretoria, South Africa. Int. J. Microbiol. 2021, 2021, 9923816. [Google Scholar] [CrossRef]
- Okafor, J.U.; Nwodo, U.U. Molecular Characterization of Antibiotic Resistance Determinants in Klebsiella pneumoniae Isolates Recovered from Hospital Effluents in the Eastern Cape Province, South Africa. Antibiotics 2023, 12, 1139. [Google Scholar] [CrossRef]
- Ozer, B.; Duran, N.; Onlen, Y.; Savas, L. Efflux pump genes and antimicrobial resistance of Pseudomonas aeruginosa strains isolated from lower respiratory tract infections acquired in an intensive care unit. J. Antibiot. 2012, 65, 9–13. [Google Scholar] [CrossRef]
- Pan, Y.-P.; Xu, Y.-H.; Wang, Z.-X.; Fang, Y.-P.; Shen, J.-L. Overexpression of MexAB-OprM efflux pump in carbapenem-resistant Pseudomonas aeruginosa. Arch. Microbiol. 2016, 198, 565–571. [Google Scholar] [CrossRef]
- Poole, K.; Srikumar, R. Multidrug Efflux in Pseudomonas aeruginosa Components, Mechanisms and Clinical Significance. Curr. Top. Med. Chem. 2005, 1, 59–71. [Google Scholar] [CrossRef]
- Poonsuk, K.; Chuanchuen, R. The multidrug-resistant Pseudomonas aeruginosa clinical isolates from dogs and cats expressed three multidrug efflux systems simultaneously. Thai J. Vet. Med. 2014, 44, 453–459. [Google Scholar] [CrossRef]
- Pos, K.M. Drug transport mechanism of the AcrB efflux pump. Biochim. Biophys. Acta-Proteins Proteom. 2009, 1794, 782–793. [Google Scholar] [CrossRef] [PubMed]
- Pourakbari, B.; Yaslianifard, S.; Yaslianifard, S.; Mahmoudi, S.; Keshavarz-Valian, S.; Mamishi, S. Evaluation of efflux pumps gene expression in resistant Pseudomonas aeruginosa isolates in an Iranian referral hospital. Iran. J. Microbiol. 2016, 8, 249–256. [Google Scholar] [PubMed]
- Prabhakar, S.; Noonan, J.P.; Pääbo, S.; Rubin, E.M. Accelerated evolution of conserved noncoding sequences in humans. Science 2006, 314, 786. [Google Scholar] [CrossRef]
- Quale, J.; Bratu, S.; Gupta, J.; Landman, D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 2006, 50, 1633–1641. [Google Scholar] [CrossRef]
- Safaei, H.; Faghri, J.; Fazeli, H.; Vaez, H.; Isfahani, B.; Moghim, S.; Yadegari, S.; Moghofeei, M. Efflux pump regulatory genes mutations in multidrug resistance Pseudomonas aeruginosa isolated from wound infections in Isfahan hospitals. Adv. Biomed. Res. 2014, 3, 117. [Google Scholar] [CrossRef]
- Schweizer, H.P. Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: Unanswered questions. Genet. Mol. Res. 2003, 2, 48–62. [Google Scholar]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef]
- Singh, S.B.; Young, K.; Silver, L.L. What is an ‘ideal’ antibiotic? Discovery challenges and path forward. Biochem. Pharmacol. 2017, 133, 63–73. [Google Scholar] [CrossRef]
- Sobel, M.L.; Hocquet, D.; Cao, L.; Plesiat, P.; Poole, K. Mutations in PA3574 (nalD) lead to increased MexAB-OprM expression and multidrug resistance in laboratory and clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2005, 49, 1782–1786. [Google Scholar] [CrossRef]
- Strateva, T.; Yordanov, D. Pseudomonas aeruginosa—A phenomenon of bacterial resistance. J. Med. Microbiol. 2009, 58, 1133–1148. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhong, M.; Lu, W.; Chai, Q.; Wei, Y. Repressive mutations restore function-loss caused by the disruption of trimerization in Escherichia coli multidrug transporter AcrB. Front. Microbiol. 2015, 6, 4. [Google Scholar] [CrossRef] [PubMed]
- Zahedani, S.S.; Tahmasebi, H.; Jahantigh, M. Coexistence of Virulence Factors and Efflux Pump Genes in Clinical Isolates of Pseudomonas aeruginosa: Analysis of Biofilm-Forming Strains from Iran. Int. J. Microbiol. 2021, 2021, 5557361. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
MDR P. aeruginosa isolates distributed according to the number of antibiotic classes.
Figure 2.
Resistance patterns of P. aeruginosa isolates. KEY: CAZ—ceftazidime; ATM—aztreonam; MEM—meropenem; GM—gentamicin; CIP—ciprofloxacin; AK—amikacin; NOR—norfloxacin; TOB—tobramycin; LEV—levofloxacin; IMI—imipenem.
Figure 2.
Resistance patterns of P. aeruginosa isolates. KEY: CAZ—ceftazidime; ATM—aztreonam; MEM—meropenem; GM—gentamicin; CIP—ciprofloxacin; AK—amikacin; NOR—norfloxacin; TOB—tobramycin; LEV—levofloxacin; IMI—imipenem.
Figure 3.
The overall distribution of efflux pump genes and outer membrane proteins in MDR Pseudomonas aeruginosa.
Figure 3.
The overall distribution of efflux pump genes and outer membrane proteins in MDR Pseudomonas aeruginosa.
Figure 4.
Distribution of regulatory proteins in MDR P. aeruginosa.
Figure 5.
Phylogenetic relationship of the bacteria harbouring MexB.
Table 1.
Primer sequences of efflux pump genes and regulatory proteins of P. aeruginosa.
| Gene | Primer | Sequence (5′–3′) | Product Size (bp) | Reference |
|---|---|---|---|---|
| MexA | MexA-F MexA-R | CGACCAGGCCGTGAGCAAGCAGC GGAGACCTTCGCCGCGTTGTCGC | 256 | [17] |
| MexB | MexB-F MexB-R | CCGTGAATCCCGACCTGATG TGACATGATGGCTTCCGCAT | 242 | [18] |
| OprM | Opr M-F Opr M-R | TACCAGAAGAGTTTCGACCTGAC CATGTGTCAAAACAGTCACCTCC | 186 | [19] |
| MexC | Mex-C-F Mex-C-R | GTACCGGCGTCATGCAGGGTTC TTACTGTTGCGGCGCAGGTGACT | 164 | [17] |
| MexD | Mex D-F Mex D-R | AGGTGATCAACGACTTCACCAA CAGCCAGACGAAACAGATAGGT | 656 | [19] |
| OprJ | Opr J-F Opr J-R | CACGCTGGATTGGAAGAGTTTC CATCGAACAGGCCGGACATT | 851 | [19] |
| MexX | Mex X-F Mex X-R | CTATCGGCATCACCAGCGAG CTTTGGGTTGACCACCTTGACC | 842 | [19] |
| MexY | Mex Y-F Mex Y-R | ATCGTTACCCTTACCTCCTCCA GACGTTCTCCACCACGATGAT | 834 | [19] |
| OprN | OprN-F OprN-R | CTGAACCAGTTGGTCGAACAGT AAGGCATTCGCCGATTCTTCCA | 971 | [19] |
| MexR | MexR-F MexR-R | CTGGATCAACCACATTTACA CTTCGAAAAGAATGTTCTTAAA | 503 | [20] |
| NfxB | NfxB-F NfxB-R | ACGCGAGGCCAGTTTTCT ACTGATCTTCCCGAGTGTCG | 731 | [20] |
| NalC | NalC-F NalC-R | TCAACCCTAACGAGAAACGCT TCCACCTCACCGAACTGC | 814 | [21] |
| NalD | NalD-F NalD-R | GCGGCTAAAATCGGTACACT ACGTCCAGGTGGATCTTGG | 789 | [22] |
| MexZ | MexZ-F MexZ-R | TATGATCTGCGGCGCCTTTC TTCGGAACAAGGCGTCTGCA | 862 | [23] |
Table 2.
Distribution of MDR P. aeruginosa according to antimicrobial class.
| Antimicrobial Class | Number of Isolates (%) |
|---|---|
| Beta-lactams | 50 (88) |
| Carbapenems | 43 (75) |
| Aminoglycosides | 57 (100) |
| Fluoroquinolones | 50 (88) |
Table 3.
Distribution of efflux pump genes, outer membrane proteins, and resistance patterns of MDR P. aeruginosa isolates.
Table 3.
Distribution of efflux pump genes, outer membrane proteins, and resistance patterns of MDR P. aeruginosa isolates.
| Isolates | MexA | MexB | OprM | MexC | MexD | OprJ | MexX | MexY | OprN | Resistance Pattern |
|---|---|---|---|---|---|---|---|---|---|---|
| J01 | + | + | + | + | − | − | − | − | − | AK-LEV-ATM |
| J02 | + | + | + | + | + | + | + | − | − | GM-AK-LEV-CAZ-MEM |
| J03 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-CAZ-MEM |
| J04 | + | + | + | + | + | + | + | − | − | AK-CAZ-MEM |
| J05 | + | + | + | + | − | − | − | − | − | GM-CIP-AK-CAZ-MEM |
| J06 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-MEM |
| J07 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-CAZ-MEM |
| J08 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-NOR-CAZ-MEM |
| J09 | + | + | + | + | + | + | + | − | − | GM-CIP-AK-LEV-CAZ-MEM |
| J10 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-NOR-CAZ-ATM |
| J11 | + | + | + | + | + | + | + | − | + | GM-LEV-MEM |
| J12 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-CAZ-MEM-ATM |
| J13 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-MEM-ATM |
| J14 | + | + | + | + | + | + | + | − | + | CIP-AK-CAZ |
| J15 | + | + | + | + | − | + | + | − | − | GM-AK-CAZ-MEM |
| J16 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-IMI-LEV-NOR-CAZ-MEM-TOB |
| J17 | + | + | + | + | + | + | + | − | + | GM-AK-MEM-ATM |
| J18 | + | + | + | + | + | + | + | − | − | GM-CIP-AK-LEV-ATM |
| J19 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-MEM |
| J20 | + | + | + | + | + | + | + | − | + | CIP-AK-LEV-NOR-CAZ-ATM |
| J21 | + | + | + | + | + | + | + | − | − | GM-AK-MEM-ATM |
| J22 | + | + | + | + | + | + | − | − | − | GM-CIP-AK-CAZ-MEM |
| J23 | + | + | − | + | − | − | − | − | − | CIP-AK-LEV-NOR-CAZ-MEM-ATM |
| J24 | + | + | + | + | + | + | + | − | − | CIP-AK-LEV-CAZ |
| J25 | + | + | + | + | + | + | + | − | − | CIP-AK-CAZ |
| J26 | + | + | + | + | − | − | + | − | − | GM-AK-LEV-MEM-ATM |
| J27 | + | + | + | + | − | − | + | − | + | GM-CIP-AK-LEV-NOR-CAZ-MEM-ATM |
| J28 | + | + | + | + | + | + | + | − | − | AK-CAZ-MEM |
| J29 | + | + | + | + | + | − | + | − | − | GM-CIP-AK-LEV-CAZ-MEM |
| J30 | + | + | + | + | + | + | + | − | − | AK-IMI-LEV-CAZ |
| J31 | + | + | + | + | + | + | + | − | − | GM-CIP-AK-LEV-NOR-CAZ-MEM |
| J32 | + | + | + | + | − | + | − | − | + | GM-CIP-MEM |
| J33 | + | + | + | + | + | − | + | − | − | GM-LEV-CAZ-MEM-TOB |
| J34 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-CAZ-MEM |
| J35 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-MEM |
| J36 | + | + | + | + | + | + | − | − | + | GM-AK-LEV-CAZ-MEM |
| J37 | + | + | − | + | − | − | + | − | − | GM-CIP-AK-IMI-LEV-CAZ |
| J38 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-NOR-MEM |
| J39 | + | + | + | + | + | + | + | − | + | CIP-IMI-LEV-CAZ-MEM-TOB |
| J40 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-CAZ-MEM |
| J41 | + | + | + | + | + | + | + | − | + | AK-CAZ-ATM |
| J42 | + | + | + | + | − | − | − | − | − | GM-CIP-AK-LEV-CAZ-MEM-ATM |
| J43 | + | + | + | + | + | + | + | − | + | GM-AK-LEV-MEM |
| J44 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-CAZ-MEM-ATM-TOB |
| J45 | + | + | + | + | − | + | + | − | + | GM-AK-CAZ-ATM |
| J46 | + | + | + | + | + | − | + | − | + | GM-CIP-AK-LEV-CAZ-MEM-ATM-TOB |
| J47 | + | + | + | + | + | + | + | − | + | GM-CIP-AK-LEV-CAZ-ATM |
| J48 | + | + | + | + | + | − | + | − | + | GM-CIP-AK-LEV-CAZ-ATM |
| J49 | + | + | + | + | + | − | + | − | + | GM-CIP-AK-LEV-NOR-CAZ-ATM-TOB |
| J50 | + | + | + | + | − | − | − | − | + | GM-CIP-AK-LEV-NOR-CAZ |
| J51 | + | + | + | + | − | − | + | − | + | GM-AK-CAZ-MEM-ATM-TOB |
| J52 | + | + | + | + | − | − | + | − | − | GM-CIP-AK-LEV-NOR-CAZ-TOB |
| J53 | + | + | + | + | − | − | + | − | − | GM-CIP-AK-LEV-NOR-CAZ-MEM-ATM-TOB |
| J54 | + | + | + | + | + | − | + | − | − | GM-AK-LEV-CAZ-MEM-ATM-TOB |
| J55 | − | + | + | + | − | − | + | − | − | GM-CIP-AK-CAZ-MEM-ATM-TOB |
| J56 | − | + | + | + | + | − | + | − | − | GM-CIP-AK-CAZ-MEM-ATM-TOB |
| J57 | + | + | + | + | + | − | + | − | − | GM-CIP-AK-IMI-LEV-CAZ |
KEY: CAZ—ceftazidime; ATM—aztreonam; MEM—meropenem; GM—gentamicin; CIP—ciprofloxacin; AK—amikacin; NOR—norfloxacin; TOB—tobramycin; LEV—levofloxacin; IMI—imipenem, + indicates the presence of gene, − indicates absence of gene.
Table 4.
Efflux pumps genes and antibiotics resistance of P. aeruginosa isolates.
| Antibiotics | MexA | MexB | OprM | MexC | MexD | OprJ | MexX | MexY | OprN | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | P (n) | N (n) | |
| Ceftazidime | 43 | 2 | 45 | 0 | 43 | 2 | 45 | 0 | 33 | 12 | 27 | 18 | 40 | 5 | 0 | 45 | 21 | 24 |
| Aztreonam | 22 | 2 | 24 | 0 | 23 | 1 | 24 | 0 | 15 | 9 | 11 | 13 | 21 | 3 | 0 | 24 | 14 | 10 |
| Meropenem | 38 | 2 | 40 | 0 | 39 | 1 | 40 | 0 | 30 | 10 | 27 | 13 | 35 | 5 | 0 | 40 | 22 | 18 |
| Imipenem | 5 | 0 | 5 | 0 | 4 | 1 | 5 | 0 | 4 | 1 | 3 | 2 | 5 | 0 | 0 | 5 | 2 | 3 |
| Gentamicin | 43 | 2 | 45 | 0 | 44 | 1 | 45 | 0 | 32 | 13 | 27 | 18 | 40 | 5 | 0 | 45 | 26 | 19 |
| Tobramycin | 10 | 2 | 12 | 0 | 12 | 0 | 12 | 0 | 9 | 3 | 3 | 9 | 12 | 0 | 0 | 12 | 6 | 6 |
| Amikacin | 53 | 0 | 53 | 0 | 53 | 0 | 53 | 0 | 52 | 1 | 52 | 1 | 52 | 1 | 0 | 53 | 52 | 1 |
| Ciprofloxacin | 31 | 2 | 33 | 0 | 32 | 1 | 33 | 0 | 24 | 9 | 29 | 4 | 29 | 4 | 0 | 33 | 23 | 10 |
| Levofloxacin | 43 | 0 | 43 | 0 | 41 | 2 | 43 | 0 | 33 | 10 | 38 | 5 | 38 | 5 | 0 | 43 | 23 | 20 |
| Norfloxacin | 12 | 0 | 12 | 0 | 11 | 1 | 12 | 0 | 7 | 5 | 10 | 2 | 10 | 2 | 0 | 12 | 7 | 5 |
Table 5.
The frequency of P. aeruginosa MDR efflux pump genes arranged as operons.
| Operon | Number (%) |
|---|---|
| MexAB-OprM | 53 (93) |
| MexCD-OprJ | 34 (60) |
| MexX-OprN | 28 (49) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Okafor, J.U.; Nwodo, U.U. Detection of Multidrug-Resistant RND Efflux Pumps and Regulatory Proteins in Antibiotic-Resistant P. aeruginosa Recovered from Hospital Wastewater Effluent in the Eastern Cape Province of South Africa. Appl. Sci. 2023, 13, 11241. https://doi.org/10.3390/app132011241
AMA Style
Okafor JU, Nwodo UU. Detection of Multidrug-Resistant RND Efflux Pumps and Regulatory Proteins in Antibiotic-Resistant P. aeruginosa Recovered from Hospital Wastewater Effluent in the Eastern Cape Province of South Africa. Applied Sciences. 2023; 13(20):11241. https://doi.org/10.3390/app132011241
Chicago/Turabian StyleOkafor, Joan U., and Uchechukwu U. Nwodo. 2023. "Detection of Multidrug-Resistant RND Efflux Pumps and Regulatory Proteins in Antibiotic-Resistant P. aeruginosa Recovered from Hospital Wastewater Effluent in the Eastern Cape Province of South Africa" Applied Sciences 13, no. 20: 11241. https://doi.org/10.3390/app132011241
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
