Next Article in Journal
Scabicidal Potential of Coconut Seed Extract in Rabbits via Downregulating Inflammatory/Immune Cross Talk: A Comprehensive Phytochemical/GC-MS and In Silico Proof
Next Article in Special Issue
Multiplex PCR Detection of Common Carbapenemase Genes and Identification of Clinically Relevant Escherichia coli and Klebsiella pneumoniae Complex
Previous Article in Journal
The Clinical Outcome of Early Periprosthetic Joint Infections Caused by Staphylococcus epidermidis and Managed by Surgical Debridement in an Era of Increasing Resistance
Previous Article in Special Issue
The Distribution of Mobile Colistin-Resistant Genes, Carbapenemase-Encoding Genes, and Fluoroquinolone-Resistant Genes in Escherichia coli Isolated from Natural Water Sources in Upper Northeast Thailand
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh

1
Animal Biotechnology Division, National Institute of Biotechnology, Savar 1349, Bangladesh
2
Center for Cancer Immunology, Institute of Biomedicine and Biotechnology, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China
3
Department of Applied Nutrition and Food Technology, Islamic University, Kushtia 7003, Bangladesh
4
State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China
*
Authors to whom correspondence should be addressed.
Antibiotics 2023, 12(1), 41; https://doi.org/10.3390/antibiotics12010041
Submission received: 29 November 2022 / Revised: 13 December 2022 / Accepted: 22 December 2022 / Published: 27 December 2022

Abstract

:
Antimicrobials have been used to improve animal welfare, food security, and food safety that promote the emergence, selection, and dissemination of antimicrobial-resistant (AMR) bacteria. In this study, 50 E. coli were isolated from frozen chicken meat samples in Dhaka city. Antibiotic sensitivity patterns were assessed through the disk diffusion method and finally screened for the presence of antimicrobial resistance genes (ARG) using the polymerase chain reaction (PCR). Among the 160 samples, the prevalence of E. coli was observed in fifty samples (31.25%). All of these isolates were found resistant to at least one antimicrobial agent, and 52.0% of the isolates were resistant against 4–7 different antimicrobials. High resistance was shown to tetracycline (66.0%), followed by resistance to erythromycin (42.0%), ampicillin and streptomycin (38.0%), and sulfonamide (28.0%). In addition, the most prevalent ARGs were tet(A) (66.0%), ereA (64.0%), tet(B) (60.0%), aadA1 and sulI (56.0%), blaCITM (48.0%) and blaSHV (40.0%). About 90.0% of isolates were multidrug resistant. This study reveals for the first time the current situation of E. coli AMR in broilers, which is helpful for the clinical control of disease as well as for the development of policies and guidelines to reduce AMR in broilers production in Bangladesh.

1. Introduction

Antimicrobial agents have been used in humans, veterinary medicine, food security, and food safety since their discovery in the 1920s. However, due to inadequate selection, overuse, and misuse of antimicrobials have been responsible for the selection of resistant isolates, known as antimicrobial resistance (AMR) [1]. Over the past decade, AMR has become a global threat to human and animal health. Development of resistance can be the result of both chromosomal mutations and the acquisition of mobile genetic elements (MGEs), harboring AMR gene mutations [2,3]. It has been reported that, antibiotics are no longer effective against infection-causing bacteria due to increased AMR rate, as a result, every 10 min a patient dies in the USA or Europe [4,5]. However, a substantially higher prevalence of increased AMR is likely to be found in developing countries especially in Africa and Asia due to limited diagnosis facilities, unauthorized antibiotics sale, poor patient education, the inappropriate function of drug regulatory action, inappropriate prescription practices, and non-human practice of antibiotics in livestock sectors [6,7]. Due to the magnitude of the threat, the World Health Organization (WHO) recommended global surveillance programs for animal and human populations.
According to WHO, the first-ever list of antibiotic-resistant “priority pathogens”, Escherichia coli is included in the most critical group of all twelve families of bacteria that carriage the greatest threat to human and animal health [8]. The level of antimicrobial resistance in E. coli has been used as an indicator of resistance dissemination in bacterial populations, and of selective pressure imposed by antimicrobials used in food animals and humans [9,10,11,12]. However, the frequency of AMR in E. coli depends on the source of the isolates. Animal origin has been reported to be the cause of drug-resistant E. coli infections in humans, and that these agents harbored the same mobile resistance genes found in diverse bacterial species from a variety of animal sources [13,14,15,16,17]. However, a high prevalence of AMR E. coli was isolated from chicken compared with other animals’ origins [18]. Additionally, AMR E. coli isolated from humans is similar to E. coli from poultry [19]. It has been reported that commensal E. coli, can serve as a good reservoir of resistance genes with the ability to transfer these genes to pathogens in the hosts as well as in the human intestinal tract after the consumption of contaminated foods of animal origin [20]. Furthermore, a number of studies have established the transfer of AMR between commensal bacteria and zoonotic pathogens in various ecological environments [21,22,23].
Poultry meat production has been increased and doubled over the past 20 years. Poultry is traded at live bird markets, and products are sold unprocessed with bigger clusters of them in city areas which presents significant public and poultry health challenges. A number of companies have already integrated their operations. Poultry and meat processing is a very new movement in the food processing industry in Bangladesh. It has been said that frozen chickens are mostly obtainable through high-end supermarkets charging premium prices and this market is growing every year. Another market segment is food preparation for the main fast-food chains. The local frozen food market is also growing, at a rate of almost 30% in 2011–2012 over the preceding year. City dwellers, are progressively becoming more conscious of their accessibility and the lifestyle they permit, as they desire to go to supermarket instead of to wet markets to buy their everyday stuff, including frozen chicken meat [24]. Tenants in the city becoming more conscious of their accessibility to safe food. Nonetheless, warranting the microbiological safety of frozen chicken meat evolves as a challenge.
Few studies have already reported bacterial contamination in frozen chicken meat from different cities in Bangladesh. Customers in cities have a habit of buying frozen chicken meat along with other frozen and ready-to-cook foodstuffs as these frozen items need slight processing for cooking and, thus, they can save time [25,26,27]. Two of these studies were bacteriological along with AMR phenotype. Another study includes a few genes related to extended spectrum beta-lactamase (ESBL) and non- ESBL producing E. coli. However, recent reviews reported the uses of nineteen and ten different types of antibiotics in the broiler and layer farms, respectively in Bangladesh [28]. Therefore, further study is needed for genotyping which shows higher diversity than phenotypes and consequently allows for more accurate comparisons between resistant bacterial populations [29,30]. The aim of this study was to determine the prevalence of E. coli in frozen chicken and phenotypic AMR profile as well as the detection of ARG.

2. Results

2.1. Prevalence of E. coli in Frozen Chicken Meat

E. coli was isolated and identified in fifty samples out of 160 samples with an overall prevalence of 31.25%. However, the prevalence of E. coli was found to range from 20.0–40.0% in the tested samples (Table 1). The highest prevalence (40.0%) was found in chickens purchased from supermarkets in the Mirpur region while the lowest prevalence (20.0%) was in samples of the Gulshan region.

2.2. Antimicrobial Resistance Profiles of E. coli

Antimicrobial resistance among E. coli isolates was determined by the disc diffusion method using seven different antibiotics spanning six different classes. The distribution of AMR patterns is presented in Table 2 and Figure 1.
Overall, 35.7, 16.0 and 48.3% of the isolates were found resistant, intermediate, and sensitive, respectively to all the antibiotics used in this study. About 2.0% of isolates showed resistance to seven antibiotics spanning six classes of antimicrobial agents (Str-Gen-Tet-Amp-Ery-Chl-Sul) ( Supplementary Table S1).
About 90.0% of the isolates were found to MDR and about 52.0% of the isolates showed resistance against 4–7 different antimicrobials (Table 3).

2.3. Antimicrobial Resistance Genes (ARGs) in E. coli

Ten ARGs were detected using PCR in all isolated E. coli and the results are presented in Table 5. Tetracycline efflux genes tet(A) and tet(B) were found in 66.0 % and 60.0 % of the total isolates in this study, respectively. Both tet(A) and tet(B) genes were found in 60.0% of the isolates. About 64.0% of the isolates harbored the erythromycin esterase (ereA) gene. Besides, 56.0 %, 56.0 %, 44.0% of the isolates were found to carrying aadA1, sul1, aac(3)-IV genes, respectively. The presence of the AmpC beta-lactamase-producing gene (blaCITM) was observed in 48.0% of chicken E. coli isolates. Moreover, about 40.0% of chicken E. coli isolates carried genes coding for extended-spectrum SHV (blaSHV) beta-lactamases (Table 4).
Antimicrobial resistance genes (3-9) were detected in 84.0% of the isolates. While 70.0% of the isolates were found to carry 5–9 of the ten ARGs investigated in this study (Figure 2).

2.4. Antimicrobial Resistance Phenotype and Genotype Association

Strong positive associations were found among AMR phenotypes and the corresponding resistance genes except for tetracycline-tet(B) (OR: 1.33, 95% CI 0.41–4.31, p = 0.63) (Table 5). The observed strongest associations were between the following pairs of antibiotics and corresponding genes: tetracycline-tet(A) (OR: 512.0, 95% CI: 30.03–8728.99, p ≤ 0.0001), streptomycin-aadA1 (OD: 270.0, 95% CI: 22.86–3189.39, p < 0.0001), erythromycin-ere(A) (OD: 255, 95% CI: 21.50–3024.21, p ≤ 0.0001), sulfonamide-sulI (OD: 82.33, 95% CI: 12.51–542.00, p ≤ 0.0001), gentamicin-aac(3)-IV (OD: 52.0, 95% CI: 9.57–291.19, p ≤ 0.0001). Positive associations were also observed for other antibiotics and corresponding genes analyzed in this study. By pairwise association analysis, non-significant positive and negative associations were found within AMR phenotypes and genotypes ( Supplementary Tables S2 and S3).

3. Discussion

E. coli is recognized as a common inhabitant of the vertebrate intestinal tract which frequently causes contamination in retail meat products. It is one of the most common food-borne pathogens associated with mortality in commercial poultry as well as condemning the carcasses in slaughterhouses and has been considered a significant public health threat and economic burden [31]. It has been reported that resistant strains from the gut readily contaminate poultry carcasses at slaughter, and consequently, poultry meats are often contaminated with resistant E. coli [32]. Antibiotics have been widely used for preventing economic losses caused by E. coli and increasing production efficiency [33]. However, with increased consumption of these drugs may lead to scattering them into manure and other poultry wastes and transferring them to humans by their residues in carcasses and can be the origin of bacterial resistance, mortality, and increase in human hospitalization [34]. In this study, the overall prevalence of E. coli in frozen chicken was found 31.25% which is lower than the prevalence (76.1%) reported from frozen chicken [25]. Our findings are also lower than the findings of the previous study [35]. It has been reported about a 63.5% prevalence of E. coli in raw chicken meat covering both layer and broiler swab samples. We have taken about 10 g of meat from the surface of the breast and thigh muscles of each of the broilers. However, processed meat samples for E. coli isolation from various parts of the body of layer, broiler and cockerel has been examined [25,35]. On the other hand, the present study was limited only to Dhaka city. Moreover, sampling time, season, etc. were also different. All of these factors may contribute to the differences of E. coli prevalence in frozen meat samples. Moreover, broilers sold in supermarkets especially come from contract farms that manage their farms more hygienically than the general farmers may also contribute to lower occurrences of E. coli. A contract farm is defined as a farm where farmers have a contract with the company (supermarket authority) that the company provides the chicks, the feed, veterinary care, and technical advice, etc. while the farmers provide the day-to-day care of the birds, land, and housing, as well as utilities/maintenance of the housing and finally share benefits as per contract [25]. Additionally, the prevalence may not show actual prevalence as we have examined a portion of muscle sample from the surface of the frozen chicken. The source of E. coli may be the chicken itself or it comes from contamination during the dressing and packing of chicken. It is to be mentioned that we have ensured the aseptic handling of samples in the laboratory to avoid laboratory-acquired contamination.
From Bangladesh, many studies have been reported on AMR and the majority of them concentrate on the isolation and investigation of the antibiotic resistance patterns of E. coli by disc diffusion technique [36,37]. Although the conventional method is most widely used for determining AMR because of convenience, efficiency, and cost; it has some limitations. Results may be unexpected or borderline in addition to some other limitations such as its inapplicability to many fastidious organisms and anaerobes [38], unable to obtain minimal inhibitory concentration (MIC) values [39], labor-intensive and time-consuming [40]. In this study, we have used both phenotypic detection of AMR as well as detection of ARGs from the same isolates. It has been reported that tetracycline resistance E. coli was found more frequently [28]. Besides, resistances were also found against almost all antibiotics used in this study. ESBL E. coli isolates from frozen meat displayed resistance to oxytetracycline and amoxicillin (91.9%), ampicillin and trimethoprim–sulfamethoxazole (89.2%), pefloxacin (87.8%), cefepime (81.1%), piperacillin–tazobactam (73.0%), and doxycycline (70.3%) [25]. A recent review [28] reported that nineteen and ten different types of antibiotics are used in the broiler and layer farms, respectively in Bangladesh. The most commonly used antibiotics included ciprofloxacin, ampicillin, amoxicillin, trimethoprim, oxytetracycline, tylosin tartrate, tiamulin, norfloxacin, enrofloxacin, doxycycline, and colistin sulfate. Information regarding the use of antimicrobials in broiler was not available to the research team to draw further insights.
MDR bacteria are an emerging clinical challenge in the poultry sector as well as the livestock sector. In this study, about 90.0% of the E. coli isolates were found MDR, and 52% of the isolates showed resistance against 4–7 different antimicrobials. Our findings are within the findings of recent reports regarding MDR phenotypes of E. coli. It has been reported eighty-six E. coli isolates from frozen chicken meat against sixteen antimicrobials and found that all the isolates are MDR [25] and as suggested by other literature reported 49.23 and 51.09% MDR E. coli isolates from broiler and layer meat samples [35]. AMR pattern (streptomycin-gentamicin-tetracycline-ampicillin-erythromycin-chloramphenicol-sulfonamide) of one E. coli isolates ( Supplementary Table S1) indicates the necessity of prudent use of antibiotics. AmpC beta-lactamase-producing gene (blaCITM) and the gene coding for extended-spectrum SHV beta-lactamases (bla SHV) were detected in broiler chicken E. coli isolates in the present study. It has been also reported that 12.8% of broiler chicken E. coli isolates carried blaSHV and 4.56% of isolates possess blaCITM genes [35]. Differences in findings might reflect the sources and number of samples etc. In Bangladesh, blaCTX-M-1 (94.4%) and blaTEM (50–91.3%) ESBL-producing E. coli were reported in the droppings of chickens [41,42]. Strong correlations between most of the antimicrobial-resistant phenotypes and genotypes were observed among the investigated E. coli isolates that the similar findings are reported earlier [35].
In E. coli, the AMR phenotypic-genotypic agreement of 33–85% [29] has been reported for different antimicrobial agents and related genes. In the present study, it was found that few isolates with resistance phenotypes lacked the corresponding ARGs tested, indicating the occurrence of multi-gene mediated AMR. On the other hand, some isolates carry the resistance genes but phenotypically not resistant to the corresponding antibiotics used in this study. The occurrence of similar AMR phenomena was also reported previously [29]. Sometimes, the phenotype or the genotype alone is unable to accurately predict the outcome of the other, as molecular mechanisms of AMR are multifaceted. Thus, the presence or absence of a specific gene corresponding to a particular phenotype does not necessarily infer that the particular strain is resistant or susceptible [43]. The differences between the genotype and phenotype observed in this study might be due to not testing for all possible resistance genes, or genes not being turned on, or the presence of ‘silent gene cassettes’ in certain isolates.
It is established that the use of a specific antibiotic can result in its own resistance. It can also play a role as a co-selection marker for other antibiotics. This may happen in completely unrelated drug classes [44,45]. The use of chloramphenicol in the poultry sector is very rare. However, about 22.0% of the isolates showed resistance to chloramphenicol. Moreover, chloramphenicol resistance genes viz. catA1 and cmlA were detected in 36.0 and 34.0% of the E. coli isolates, respectively. Resistance to chloramphenicol might be due to the co-selection dynamics among chloramphenicol, oxytetracycline, and sulfonamide [30,44]. A non-significant poor association between tet(A) and tet(B) resistance genes among E. coli isolates (Supplementary Table S3) was observed which may be due to the incompatibility of plasmids carrying the tetracycline resistance determinants [30]. However, further study is required to enumerate the relationships among the resistance gene(s) and the probable link to antimicrobial exposure.
The findings of this study indicated that more caution are required for personnel hygiene in the processing and handling of poultry and poultry products to prevent the transfer of AMR E. coli from frozen poultry sold in supermarkets in Bangladesh. Present findings also highlighted the necessity of cautious use of antimicrobials in chickens to minimize the development of antibiotic-resistant bacterial strains. The study has limitations and these include a small sample size and fewer antibiotic-resistance genes tested. Further detailed investigation using a large number of samples, targeting more antibiotics including latest antibiotics as well as more ARGs, etc. would provide broader insights into the AMR patterns, prevalent ARGs, etc. among clinically important pathogens from food producing animals.

4. Materials and Methods

4.1. Collection of Whole Frozen Chicken

This cross-sectional study was conducted in Dhaka district in Bangladesh. A total of 160 frozen chicken meat were purchased from different supermarkets located in Gulshan, Dhanmondi, Mirpur, and Uttara regions in Dhaka city (Figure 3) during the period of July 2018 to June 2019 for the isolation and identification of E. coli. After purchase chicken samples were individually placed in a sterile zipper bag, kept in an ice box, and immediately brought to the laboratory of the Animal Biotechnology Division, National Institute of Biotechnology. Samples were either shortly stored in the refrigerator (4 °C) in case of immediate processing or at −20 °C in case of processing after 1–2 days of purchase.

4.2. Sample Processing and Isolation of E. coli

The preparation of the meat samples was based on the slight modification of the European standard ISO-16654:2001 [46] About 10 g of meat sample, thigh and breast muscles each 5 g, was obtained from the surface of each of the chickens, cut into small pieces, added with 90 ml of sterile 1% peptone and mixed well. Enrichment was performed for 16 to 24 h at 150 rpm at 37 °C in a shaking incubator. A portion of enriched samples (25 µL) were plated on MacConkey’s agar (MCA; Difco) and incubated at 37 °C for 24 h. Typical colonies of E. coli were randomly picked, mixed with 100 µL phosphate-buffer saline, inoculated onto eosine methyline blue (EMB) agar, and incubated at 37 °C for 18–24 h. After incubation, the selected bacterial colonies from EMB agar were inoculated into 5 mL of sterile Luria Bertani (LB) broth and placed into a shaking incubator at 37 °C for overnight. This culture was used for further analysis.

4.3. Identification of E. coli by Polymerase Chain Reaction (PCR)

Genomic DNA was isolated from selected bacteria cultured in LB broth by using a mixture of phenol: chloroform: isoamyl alcohol (25:24:1) [47], followed by precipitation with isopropanol. Finally, the DNA was dissolved in 50 µL of Tris-EDTA buffer. The concentration (ng/µL) and absorbance ratio (260 nm/280 nm) was determined by spectrophotometry (NanoDrop 2000, Thermo Scientific). PCR amplification was performed using primers (16E1-F: 5′-GGGAGTAAAGTTAATCCTTTGCTC-3′ and 16E2-R: 5′-TTCCCGAAGGCACATTCT-3′) targeting 584 bp fragment of 16S rRNA gene as reported earlier [48]. PCR amplification was performed on 25 μL scale, containing 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 200 μM of each dNTP, 1 μM primers, 1 unit of Taq DNA polymerase, and 5 μL (~50 ng/μL) of genomic DNA in Gene Atlas thermocycler (ASTEC Gene Atlas, G02, Japan). The thermal condition included an initial denaturation for 5 m at 95 °C, followed by 35 cycles consisting of denaturation at 94 °C for 1 m, annealing at 55 °C for 90 s and extension at 72 °C for 1 m, and a final extension of 10 m at 72 °C. Amplified DNA was separated on 1.5% agarose gel and visualized under ultraviolet light in an Axygen™ Gel documentation system (Corning Inc., Corning, NY, USA).

4.4. Antimicrobial Resistance Profiling (ARP) of the Isolates

AMR profiling of the E. coli was performed by disc diffusion method according to Clinical and Laboratory Standards Institute (CLSI) guidelines, 2018 [49]. A total of seven antimicrobials from six different classes were used in the AMR profile test. These included (i) aminoglycosides: gentamicin (10 µg) and streptomycin (10 µg), (ii) tetracyclines: tetracycline (30 µg), (iii) β-lactam: ampicillin (10 µg), (iv) macrolides: erythromycin (15 µg) (v) phenicols: chloramphenicol (30 µg), and (vi) sulfonamides: sulfonamide (300 µg) (oxoidTM). E. coli (ATCC 25922) strain was used as a reference strain for interpretations of the antimicrobial susceptibility test results. The isolates were categorized as resistant, intermediate, or sensitive based on the diameter of the zone of inhibition according to CLSI guidelines. As there is no standard zone of inhibition mentioned for erythromycin with Enterobacteriaceae, the interpretation was performed based on the zone of inhibition for Staphylococcus spp. E. coli showed resistance to three or more than three different classes of antimicrobials, which was defined as multidrug-resistance (MDR) [50].

4.5. Detection of Antimicrobial Resistance Genes (ARGs) in the Isolates

All the isolates were tested for the presence of aadA1, aac(3)-IV, tet(A), tet(B), blaSHV, blaCITM, ereA, catA1, cmlA, and sulI ARGs by PCR as described [51,52,53]. Details of the primer sequences, annealing temperature, PCR product size, etc. are presented in Table 6. Basic thermal conditions were initial denaturation for 5 m at 95 °C, 35 cycles consisting of denaturation for 1 m at 94 °C, annealing for 40 s at the temperature of each respective gene and extension for 1 m at 72 °C, followed by a final extension step of 10 m at 72 °C. The annealing temperature varied for each gene (Table 6).

4.6. Statistical Analysis

Descriptive and association-based statistical analyses were conducted using Microsoft Excel v.13.0 and GraphPad Prism v.8.0 statistical tools, respectively. The association between specific AMR phenotype and the ARG was calculated and an association was considered significant at a p-value of <0.05 and was reported as an odds ratio (OR) with 95% confidence intervals (CI). An OR of > 1 was considered a positive association or the increasing probability of the co-occurrence of the genotype or phenotype, while an OR of <1 was considered a negative association or the decreasing probability of the co-occurrence of the genotype or phenotype. The degree of agreement between phenotypic and genotypic relations was assessed by Kappa coefficients (κ) [54].

5. Conclusions

The results of the present study indicate that a good percentage of frozen chicken sold in supermarkets in Dhaka city carries E. coli and they are resistant to commonly used antibiotics and the majority of them are MDR. Furthermore, more cautions are necessary for choosing a drug for the treatment of clinical cases of poultry because the transfer of drug resistant gene from one bacterium to other may be hazardous for human being too. Therefore, careful use of antimicrobials in poultry production is recommended.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics12010041/s1, Table S1: Antimicrobial resistance patterns of E. coli (n = 50), Table S2: Pairwise association analysis of phenotypic antimicrobial resistance patterns, Table S3: Pairwise association analysis antimicrobial resistance genes (ARGs).

Author Contributions

Author Contributions: This work was carried out in collaboration with all authors. Conceptualization, M.M.K.H. and J.A.; Methodology, M.M.K.H., M.S.U., R.R., A.A.B. and J.A.; Software, M.M.K.H., M.A.I., M.A.A. and J.A.; Validation, M.M.K.H., M.S.U., M.A.I., M.S.I., J.A. and J.L.; Formal Analysis, M.M.K.H., M.S.U., M.S.I. and J.A.; Investigation, M.M.K.H., M.S.U., R.R. and A.A.B.; Resources, M.M.K.H. and J.A.; Data Curation, M.M.K.H., M.S.U., N.J. and R.R.; Writing—Original Draft Preparation, M.M.K.H., M.S.U., A.A.B. and M.S.I.; Writing—Review and Editing, A.T.M.M.R., A.U.-D., M.A.A., J.A. and J.L.; Visualization, M.M.K.H., R.R., N.J. and J.A.; Supervision, M.A.A. and J.A.; Project Administration, M.M.K.H.; Funding Acquisition, J.A. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Ministry of Science and Technology (MoST, R&D: BMN-124), Bangladesh through a R&D project.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Authors would like to acknowledge to MoST, Bangladesh for the funding this research.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Kolár, M.; Urbánek, K.; Látal, T. Antibiotic selective pressure and development of bacterial resistance. Int. J. Antimicrob. Agents 2001, 17, 357–363. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, L.; Kinkelaar, D.; Huang, Y.; Li, Y.; Li, X.; Wang, H.H. Acquired antibiotic resistance: Are we born with it? Appl. Environ. Microbiol. 2011, 77, 7134–7141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Fu, Y.; Zhang, W.; Wang, H. Specific patterns of gyrA mutations determine the resistance difference to ciprofloxacin and levofloxacin in Klebsiella pneumoniae and Escherichia coli. BMC Infect. Dis. 2013, 13, 8. [Google Scholar] [CrossRef] [Green Version]
  4. Centers for Disease Control and Prevention. Antimicrobial Resistance Threat Report. 2013. Available online: http://www.cdc.gov/drugresistance/threat-report-2013 (accessed on 21 October 2015).
  5. European Commission. Action Plan against the Rising Threats from Antimicrobial Resistance. Communication from the Commission to the European Parliament and the Council. COM (2011) 748. Available online: http://ec.europa.eu/dgs/health_food-safety/docs/communication_amr_2011_748_en.pdf (accessed on 21 October 2015).
  6. Byarugaba, D.K. A view on antimicrobial resistance in developing countries and responsible risk factors. Int. J. Antimicrob. Agents 2004, 24, 105–110. [Google Scholar] [CrossRef]
  7. Ayukekbong, J.A.; Ntemgwa, M.; Atabe, A.N. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrob. Resist. Infect. Control. 2017, 6, 47. [Google Scholar] [CrossRef] [PubMed]
  8. WHO. List of Bacteria for Which New Antibiotics Are Urgently Needed. Available online: http://www.who.int/mediacentre/news/releases/2017/bacteria-antibiotics-needed/en/ (accessed on 27 February 2017).
  9. Alhaj, N.; Mariana, N.; Raha, A.; Ishak, Z. Prevalence of antimicrobial resistance among Escherichia coli from different sources in Malaysia. Int. J. Poultry Sci. 2007, 6, 293–297. [Google Scholar] [CrossRef] [Green Version]
  10. Saenz, Y.; Zarazaga, M.; Brinas, L.; Lantero, M.; Ruiz-Larrea, F.; Torres, C. Antibiotic resistance in Escherichia coli isolates obtained from animals, foods and humans in Spain. Int. J. Antimicrob. Agents 2001, 18, 353–358. [Google Scholar] [CrossRef]
  11. Scott, H.M.; Campbell, L.D.; Harvey, R.B.; Bischoff, K.M.; Alali, W.Q.; Barling, K.S.; Anderson, R.C. Patterns of antimicrobial resistance among commensal Escherichia coli isolated from integrated multi-site housing and worker cohorts of humans and swine. Foodborne Pathog. Dis. 2005, 2, 24–37. [Google Scholar] [CrossRef]
  12. Sorum, H.; Sunde, M. Resistance to antibiotics in the normal flora of animals. Vet. Res. 2001, 32, 227–241. [Google Scholar] [CrossRef] [Green Version]
  13. Pereira, J.G.; Fernandes, J.; Duarte, A.R.; Fernandes, S.M. β-Lactam Dosing in Critical Patients: A Narrative Review of Optimal Efficacy and the Prevention of Resistance and Toxicity. Antibiotics. 2022, 11, 1839. [Google Scholar] [CrossRef]
  14. Hammerum, A.M.; Heuer, O.E. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin. Infect. Dis. 2009, 48, 916–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Johnson, J.R.; McCabe, J.S.; White, D.G.; Johnston, B.; Kuskowski, M.A.; McDermott, P. Molecular Analysis of Escherichia coli from retail meats (2002–2004) from the United States National Antimicrobial Resistance Monitoring System. Clin. Infect. Dis. 2009, 49, 195–201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Johnson, J.R.; Sannes, M.R.; Croy, C.; Johnston, B.; Clabots, C.; Kuskowski, M.A.; Bender, J.; Smith, K.E.; Winokur, P.L.; Belongia, E.A. Antimicrobial drug-resistant Escherichia coli from humans and poultry products, Minnesota and Wisconsin, 2002-2004. Emerg. Infect. Dis. 2007, 13, 838–846. [Google Scholar] [CrossRef] [PubMed]
  17. Von, B.; Marre, R. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int. J. Med. Microbiol. 2005, 295, 503–511. [Google Scholar]
  18. Kikuvi, G.M.; Schwarz, S.; Ombui, J.N.; Mitema, E.S.; Kehrenberg, C. Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya. Microb. Drug Resist. 2007, 1, 62–68. [Google Scholar] [CrossRef]
  19. Vieira, A.R. Association between antimicrobial resistance in Escherichia coli isolates from food animals and blood stream isolates from humans in Europe: An ecological study. Foodborne Pathog. Dis. 2011, 8, 1295–1301. [Google Scholar] [CrossRef]
  20. Blake, D.P.; Hillman, K.; Fenlon, D.R.; Low, J.C. Transfer of antibiotic resistance between commensal and pathogenic members of the Enterobacteriaceae under ideal conditions. J. Appl. Microbiol. 2003, 95, 428–436. [Google Scholar] [CrossRef]
  21. Mathew, A.G.; Liamthong, S.; Lin, J.; Hong, Y. Evidence of class 1 integron transfer between Escherichia coli and Salmonella spp. on livestock farms. Foodborne Pathog. Dis. 2009, 6, 959–964. [Google Scholar] [CrossRef] [PubMed]
  22. Walsh, C.; Duffy, G.; Nally, P.; O’Mahoney, R.; McDowell, D.A.; Fanning, S. Transfer of ampicillin resistance from Salmonella Typhimurium DT104 to Escherichia coli K12 in food. Lett. Appl. Microbiol. 2008, 46, 210–215. [Google Scholar] [CrossRef]
  23. Poppe, C.; Martin, L.C.; Gyles, C.L.; Reid-Smith, R.; Boerlin, P.; McEwen, S.A.; Prescott, J.F.; Forward, K.R. Acquisition of resistance to extended-spectrum cephalosporins by Salmonella Newport and Escherichia coli in the intestinal tract of turkey poults. Appl. Environ. Microbiol. 2005, 71, 1184–1192. [Google Scholar] [CrossRef] [Green Version]
  24. Rahman, M.S.; Jang, D.H.; Yu, C.J. Poultry industry of Bangladesh: Entering a new phase. Korean J. Agric. Sci. 2017, 44, 272–282. [Google Scholar]
  25. Parvin, M.S.; Talukder, S.; Ali, M.Y.; Chowdhury, E.H.; Rahman, M.T.; Islam, M.T. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens 2020, 9, 420. [Google Scholar] [CrossRef]
  26. Uddin, J.; Hossain, K.; Hossain, S.; Saha, K.; Jubyda, F.T.; Haque, R.; Billah, B.; Talukder, A.A.; Parvez, A.K.; Dey, S.K. Bacteriological assessments of foodborne pathogens in poultry meat at different super shops in Dhaka, Bangladesh. Ital. J. Food Saf. 2019, 8, 6720. [Google Scholar] [CrossRef]
  27. Alam, S.T.; Howard, M.; Fatema, K.; Haque, K.M.F. Antibiogram of pre-processed raw chicken meat from different super shops of Dhaka city, Bangladesh. J. Allied Health Sci. 2015, 2, 45–52. [Google Scholar]
  28. Al-Amin, M.; Hoque, M.N.; Siddiki, A.Z.; Saha, S.; Kamal, M.M. Antimicrobial resistance situation in animal health of Bangladesh. Vet. World. 2020, 13, 2713–2727. [Google Scholar] [CrossRef]
  29. Rosengren, L.B.; Waldner, C.L.; Reid-Smith, R.J. Associations between antimicrobial resistance phenotypes, antimicrobial resistance genes, and virulence genes of fecal E. coli isolates from healthy grow-finish pigs. Appl. Environ. Microbiol. 2009, 75, 1373–1380. [Google Scholar] [CrossRef] [Green Version]
  30. Gow, S.P.; Waldner, C.L.; Harel, J.; Boerlin, P. Associations between antimicrobial resistance genes in fecal generic E. coli isolates from cow-calf herds in western Canada. Appl. Environ. Microbiol. 2008, 74, 3658–3666. [Google Scholar] [CrossRef] [Green Version]
  31. Ewers, C.; Janßen, T.; Kießling, S.; Philipp, H.-C.; Wieler, L.H. Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Vet. Microbiol. 2004, 104, 91–101. [Google Scholar] [CrossRef]
  32. Turtura, G.C.; Massa, S.; Chazvinizadeh, H. Antibiotic resistance among coliform bacteria isolated from carcasses of commercially slaughtered chickens. Int. J. Food Microbiol. 1990, 11, 351–354. [Google Scholar] [CrossRef]
  33. Angulo, F.J.; Johnson, K.R.; Tauxe, R.V.; Cohen, M.L. Origins and consequences of antimicrobial-resistant nontyphoidal Salmonella: Implications for the use of fluoroquinolones in food animals. Microb. Drug Resist. 2000, 6, 77–83. [Google Scholar] [CrossRef]
  34. Miles, T.D.; McLaughlin, W.; Brown, P.D. Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet. Res. 2006, 2, 1–9. [Google Scholar] [CrossRef] [Green Version]
  35. Rahman, M.M.; Husna, A.; Elshabrawy, H.A.; Alam, J.; Runa, N.Y.; Badruzzaman, A.T.M.; Banu, N.A.; Al Mamun, M.; Paul, B.; Das, S.; et al. Isolation and molecular characterization of multidrug-resistant Escherichia coli from chicken meat. Sci. Rep. 2020, 10, 21999. [Google Scholar] [CrossRef]
  36. Akond, M.A.; Hassan, S.M.R.; Alam, S.; Shirin, M. Antibiotic Resistance of Escherichia Coli Isolated From Poultry and Poultry Environment of Bangladesh. Am. J. Environ. Sci. 2009, 5, 47–52. [Google Scholar]
  37. Hasan, B.; Faruque, R.; Drobni, M.; Waldenström, J.; Sadique, A.; Ahmed, K.U.; Islam, Z.; Parvez, M.B.; Olsen, B.; Alam, M. High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011, 55, 689–692. [Google Scholar] [CrossRef]
  38. Sader, H.S.; Pignatari, A.C.C. E Test: A novel technique for antimicrobial susceptibility testing. Sao Paulo Med. J. 1994, 112, 635–638. [Google Scholar] [CrossRef]
  39. Dickert, H.; Machka, K.; Braveny, I. The uses and limitations of disc diffusion in the antibiotic sensitivity testing of bacteria. Infection 1981, 9, 18–24. [Google Scholar] [CrossRef]
  40. Klancnik, A.; Piskernik, S.; Jersek, B.; Mozina, S.S. Evaluation of diffusion and dilution methods to determine the antibacterial activity of plant extracts. J. Microbiol. Methods 2010, 81, 121–126. [Google Scholar] [CrossRef]
  41. Al Azad, M.; Rahman, A.; Rahman, M.; Amin, R.; Begum, M.; Ara, I.; Fries, R.; Husna, A.; Khairalla, A.S.; Badruzzaman, A. Susceptibility and multidrug resistance patterns of Escherichia coli isolated from cloacal swabs of live broiler chickens in Bangladesh. Pathogens 2019, 8, 118. [Google Scholar] [CrossRef] [Green Version]
  42. Parvez, M.A.K.; Marzan, M.; Liza, S.M.; Mou, T.J.; Azmi, I.J.; Rahman, M.S.; Mahmud, Z.H. Prevalence of inhibitor resistant beta lactamase producing E. coli in human and poultry origin of Bangladesh. J. Bacteriol. Parasitol. 2016, 7, 1–3. [Google Scholar]
  43. Aarts, H.J.M.; Guerra, B.; Malorny, B. Molecular methods for detection of antimicrobial resistance. In Aarestrup (ed) Antimicrobial Resistance in Bacteria of Animal Origin; ASM Press: Washington, DC, USA, 2006. [Google Scholar]
  44. O’Connor, A.M.; Poppe, C.; McEwen, S.A. Changes in the prevalence of resistant E. coli in cattle receiving subcutaneously injectable oxytetracycline in addition to in-feed chlortetracycline comparing with cattle receiving only in-feed chlortetracycline. Can. J. Vet. Res. 2002, 66, 145–150. [Google Scholar]
  45. Yang, Y.; Du, H.; Zou, G.; Song, Z.; Zhou, Y.; Li, H.; Tan, C.; Chen, H.; Fischetti, V.A.; Li, J. Encapsulation and delivery of phage as a novel method for gut flora manipulation in situ: A review. J. Control. Release 2022, 1, S0168–S3659. [Google Scholar] [CrossRef]
  46. WHO. Laboratory protocol. In Isolation of Salmonella spp. From Food and Animal Faeces, 5th ed.; WHO: Geneva, Switzerland, 2010; Volume 13, pp. 4–8. [Google Scholar]
  47. Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
  48. Tsen, H.Y.; Lin, C.K.; Chi, W.R. Development and use of 16S rRNA gene targeted PCR primers for the identification of Escherichia coli cells in water. J. Appl. Microbiol. 1998, 85, 554–560. [Google Scholar] [CrossRef]
  49. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  50. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  51. Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.V.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [Green Version]
  52. Van, T.T.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food. Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef]
  53. Toro, C.; Farfán, M.; Contreras, I.; Flores, O.; Navarro, N.; Mora, G.; Prado, V. Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiol. Infect. 2005, 133, 81–86. [Google Scholar] [CrossRef]
  54. Landis, J.R.; Koch, G.G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef]
Figure 1. Distribution of antimicrobial resistance phenotype and antimicrobial resistance genes of E. coli isolated from chicken meat from supermarkets of Dhaka city. Str: streptomycin, Gen: gentamicin, Tet: tetracycline, Amp: ampicillin, erythromycin, Chl: chloramphenicol, Sul: sulfonamide.
Figure 1. Distribution of antimicrobial resistance phenotype and antimicrobial resistance genes of E. coli isolated from chicken meat from supermarkets of Dhaka city. Str: streptomycin, Gen: gentamicin, Tet: tetracycline, Amp: ampicillin, erythromycin, Chl: chloramphenicol, Sul: sulfonamide.
Antibiotics 12 00041 g001
Figure 2. A number of antimicrobial resistance genes (ARGs) detected in isolated E. coli from chicken meat from supermarkets in Dhaka city (n = 50).
Figure 2. A number of antimicrobial resistance genes (ARGs) detected in isolated E. coli from chicken meat from supermarkets in Dhaka city (n = 50).
Antibiotics 12 00041 g002
Figure 3. Sample collection from supermarkets of four different locations in Dhaka city, Bangladesh.
Figure 3. Sample collection from supermarkets of four different locations in Dhaka city, Bangladesh.
Antibiotics 12 00041 g003
Table 1. Prevalence of E. coli in frozen chicken meat collected from different supermarkets located in Dhaka city.
Table 1. Prevalence of E. coli in frozen chicken meat collected from different supermarkets located in Dhaka city.
LocationNumber of Supermarkets No. of Chicken SampleSources of Chicken No. of Positive SamplePrevalence (%)
Gulshan440Contract farmers820.0
Dhanmondi440Contract farmers1435.0
Mirpur440Contract farmers1640.0
Uttara440Contract farmers1230.0
Overall 160 5031.25
Table 2. Antimicrobial resistance profile of E. coli isolated from frozen chicken meat (n = 50).
Table 2. Antimicrobial resistance profile of E. coli isolated from frozen chicken meat (n = 50).
Antimicrobial ClassAntimicrobial Agent (Conc.)No. of
E. coli Tested
No. of Isolates (%)
ResistanceIntermediateSensitive
AminoglycosidesStreptomycin (10 µg)5019 (38.0)10 (20.0)21 (42.0)
Gentamicin (10 µg)508 (16.0)14 (28.0)28 (56.0)
TetracyclinesTetracycline (30 µg)5033 (66.0)0 (0.0)17 (34.0)
Beta-lactamsAmpicillin (10 µg)5019 (38.0)3 (6.0)28 (56.0)
MacrolidesErythromycin (15 µg)5021 (42.0)10 (20.0)19 (38.0)
PhenicolsChloramphenicol (30 µg)5011 (22.0)4 (8.0)35 (70.0)
SulfonamidesSulfonamide (300 µg)5014 (28.0)15 (30.0)21 (42.0)
Overall 350125 (35.7)56 (16.0)169 (48.3)
Table 3. Distribution of resistance profiles of E. coli (n = 50).
Table 3. Distribution of resistance profiles of E. coli (n = 50).
Antibiotic ClassNo. of
Antimicrobials
No. of Isolate Resistant (%)MDR a
No. of Isolate (%)
113 (6.00)No
222 (4.00)
33 (6.00)
3316 (32.00)Yes
44 (8.00)45 (90.00)
4413 (26.00)
53 (6.00)
553 (6.00)
62 (4.00)
671 (2.00)
a Isolate is defined as multidrug-resistant when it shows resistance to >3 classes of antimicrobial agents.
Table 4. Distribution of antimicrobial resistance genes (ARGs) in E. coli isolates (n = 50).
Table 4. Distribution of antimicrobial resistance genes (ARGs) in E. coli isolates (n = 50).
Antimicrobial ClassAntimicrobial AgentARGsNo. of E. coli Positive (%)No. of E. coli Negative (%)
AminoglycosidesStreptomycinaadA128 (56.0)22 (44.0)
Gentamicinaac(3)-IV22 (44.0)28 (56.0)
TetracyclinesTetracyclinetet(A)33 (66.0)17 (34.0)
tet(B)30 (60.0)20 (40.0)
Beta-lactamsAmpicillinblaCITM24 (48.0)26 (52.0)
blaSHV20 (40.0)30 (60.0)
MacrolidesErythromycinereA32 (64.0)18 (36.0)
PhenicolsChloramphenicolcmlA17 (34.0)33 (66.0)
cat118 (36.0)32 (64.0)
SulfonamidesSulfonamidesul128 (56.0)22 (44.0)
Table 5. Comparison of AMR in E. coli isolates according to phenotypic and genotypic results.
Table 5. Comparison of AMR in E. coli isolates according to phenotypic and genotypic results.
AntimicrobialNPARGNGP+/G+P+/G-P-/G+P-/G-Odds Ratio95% CIp
Streptomycin29aadA128272120270.0022.86–3189.39<0.0001
Gentamycin22aac(3)-IV2219332552.789.57–291.19<0.0001
Tetracycline33tet(A)33321116512.0030.03–8728.99<0.0001
tet(B)3020121081.330.41–4.310.63
Ampicillin22blaCITM241579194.521.37–14.980.01
blaSHV201397214.331.30–14.470.02
Erythromycin31ereA32301217255.0021.50–3024.21<0.0001
Chloramphenicol15cmlA1711462913.293.14–56.270.0004
cat11812362919.334.14–90.240.0002
Sulfonamide29sulI2826321982.3312.51–542.00<0.0001
NP: number of E. coli isolates expressing phenotypic resistance; ARG: antibiotic resistance gene; NG: number of E. coli isolates carrying the indicated resistance gene; P+/G+: number of phenotypically resistant E. coli isolates (P+) with resistance gene (G+) for the drug identified; P+/G-: number of phenotypically resistant E. coli isolates (P+) with no resistance gene (G-) for the drug identified; P-/G+: number of phenotypically susceptible E. coli isolates (P-) with resistance gene (G-) for the drug identified; P-/G-: number of phenotypically susceptible E. coli isolates (P-) with no resistance gene (G-) for the drug identified; CI: confidence interval.
Table 6. Primers used for amplification of antimicrobial resistance genes (ARGs) from E. coli.
Table 6. Primers used for amplification of antimicrobial resistance genes (ARGs) from E. coli.
Antimicrobial AgentResistance GeneSequence (5″-3″)Size (bp)Annealing
Temp (°C)
References
StreptomycinAdenylyl transferases (aadA1)F- TATCCAGCTAAGCGCGAACT44758[51]
R- ATTTGCCGACTACCTTGGTC
GentamicinAminoglycoside acetyltransferases (aac(3)-IV)F- CTTCAGGATGGCAAGTTGGT28655[52]
R- TCATCTCGTTCTCCGCTCAT
TetracyclineEfflux pump resistance (tet(A))F- GGTTCACTCGAACGACGTCA57757[51]
R- CTGTCCGACAAGTTGCATGA
Efflux pump resistance (tet(B))F -CCTCAGCTTCTCAACGCGTG63456
R- GCACCTTGCTGATGACTCTT
Ampicillinβ-lactamase encoding penicillin resistance (BlaSHV)F- TCGCCTGTGTATTATCTCCC76852[52]
R- CGCAGATAAATCACCACAATG
β-lactamase encoding cephalosporin resistance (BlaCITM)F- TGGCCAGAACTGACAGGCAAA46247
R- TTTCTCCTGAACGTGGCTGGC
ErythromycinErythromycin esterase (ereA)F- GCCGGTGCTCATGAACTTGAG41960
R- CGACTCTATTCGATCAGAGGC
ChloramphenicolAcetyltransferases (catA1)F-AGTTGCTCAATGTACCTATAACC54755
R- TTGTAATTCATTAAGCATTCTGCC
Transporter resistance (cmlA)F- CCGCCACGGTGTTGTTGTTATC69833
R- CACCTTGCCTGCCCATCATTAG
SulfonamideDihydropteroate synthase (sul1)F- TTCGGCATTCTGAATCTCAC82247[53]
R- ATGATCTAACCCTCGGTCTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hossain, M.M.K.; Islam, M.S.; Uddin, M.S.; Rahman, A.T.M.M.; Ud-Daula, A.; Islam, M.A.; Rubaya, R.; Bhuiya, A.A.; Alim, M.A.; Jahan, N.; et al. Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh. Antibiotics 2023, 12, 41. https://doi.org/10.3390/antibiotics12010041

AMA Style

Hossain MMK, Islam MS, Uddin MS, Rahman ATMM, Ud-Daula A, Islam MA, Rubaya R, Bhuiya AA, Alim MA, Jahan N, et al. Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh. Antibiotics. 2023; 12(1):41. https://doi.org/10.3390/antibiotics12010041

Chicago/Turabian Style

Hossain, Mridha. Md. Kamal, Md. Sharifull Islam, Md. Salah Uddin, A. T. M. Mijanur Rahman, Asad Ud-Daula, Md. Ariful Islam, Rubaya Rubaya, Anjuman Ara Bhuiya, Md. Abdul Alim, Nusrat Jahan, and et al. 2023. "Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh" Antibiotics 12, no. 1: 41. https://doi.org/10.3390/antibiotics12010041

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop