Atherosclerosis Plaque Reduction by Lycopene Is Mediated by Increased Energy Expenditure through AMPK and PPARα in ApoE KO Mice Fed with a High Fat Diet
Abstract
:1. Introduction
2. Material and Methods
2.1. Animals and Drugs
2.2. Measurement of Cholesterol and Triglyceride Levels
2.3. Quantification of Atherosclerosis
2.4. Histological Evaluation of Aortas
2.5. Immunofluorescence Evaluation of Nrf2
2.6. Real-Time Quantitative PCR Amplification (RTqPCR)
2.7. Isolation of Total Proteins and Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Lycopene Effects on Body Weight and Food Intake
3.2. Lycopene Effects on Triglycerides and Cholesterol Levels
3.3. Effects of Lycopene Treatment on Atherosclerotic Lesions
3.4. Lycopene Reduced Histological Damage
3.5. Immunofluorescence Evaluation of Nrf2
3.6. Lycopene Effects on PPARα, SREBF-1 and AMPK-α Expression
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Taleb, S. Inflammation in atherosclerosis. Arch. Cardiovasc. Dis. 2016, 109, 708–715. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.A.; Hashim, M.J.; Mustafa, H.; Baniyas, M.Y.; Al Suwaidi, S.K.B.M.; AlKatheeri, R.; Alblooshi, F.M.K.; Almatrooshi, M.E.A.H.; Alzaabi, M.E.H.; Al Darmaki, R.S.; et al. Global Epidemiology of Ischemic Heart Disease: Results from the Global Burden of Disease Study. Cureus 2020, 12, e9349. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Xian, X.; Wang, Z.; Bi, Y.; Chen, Q.; Han, X.; Tang, D.; Chen, R. Research Progress on the Relationship between Atherosclerosis and Inflammation. Biomolecules 2018, 8, 80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.; Li, W.; Li, X.; Zhou, H. Inflammation: A Novel Therapeutic Target/Direction in Atherosclerosis. Curr. Pharm. Des. 2017, 23, 1216–1227. [Google Scholar] [CrossRef] [PubMed]
- Geovanini, G.R.; Libby, P. Atherosclerosis and inflammation: Overview and updates. Clin. Sci. 2018, 132, 1243–1252. [Google Scholar] [CrossRef]
- Ou, H.; Liu, C.; Feng, W.; Xiao, X.; Tang, S.; Mo, Z. Role of AMPK in atherosclerosis via autophagy regulation. Sci. China Life Sci. 2018, 61, 1212–1221. [Google Scholar] [CrossRef]
- Hou, X.; Xu, S.; Maitland-Toolan, K.A.; Sato, K.; Jiang, B.; Ido, Y.; Lan, F.; Walsh, K.; Wierzbicki, M.; Verbeuren, T.J.; et al. SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase. J. Biol. Chem. 2008, 283, 20015–20026. [Google Scholar] [CrossRef] [Green Version]
- Rao, A.V. Lycopene, tomatoes, and the prevention of coronary heart disease. Exp. Biol. Med. 2002, 227, 908–913. [Google Scholar] [CrossRef]
- Müller, L.; Caris-Veyrat, C.; Lowe, G.; Böhm, V. Lycopene and its antioxidant role in the prevention of cardiovascular diseases—A critical review. Crit. Rev. Sci. Nutr. 2016, 56, 1868–1879. [Google Scholar]
- Visioli, F.; Riso, P.; Grande, S.; Galli, C.; Porrini, M. Protective action of tomato products in in vivo markers of lipid oxidation. Eur. J. Nutr. 2003, 42, 201–206. [Google Scholar] [CrossRef]
- Liu, H.; Liu, J.; Liu, Z.; Wang, Q.; Liu, J.; Feng, D.; Zou, J. Lycopene Reduces Cholesterol Absorption and Prevents Atherosclerosis in ApoE-/- Mice by Downregulating HNF-1α and NPC1L1 Expression. J. Agric. Food Chem. 2021, 69, 10114–10120. [Google Scholar] [CrossRef] [PubMed]
- Verschuren, L.; Wielinga, P.Y.; van Duyvenvoorde, W.; Tijani, S.; Toet, K.; van Ommen, B.; Kooistra, T.; Kleemann, R. A dietary mixture containing fish oil, resveratrol, lycopene, catechins, and vitamins E and C reduces atherosclerosis in transgenic mice. J. Nutr. 2011, 141, 863–869. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thies, F.; Mills, L.M.; Moir, S.; Masson, L.F. Cardiovascular benefits of lycopene: Fantasy or reality? Proc. Nutr. Soc. 2017, 76, 122–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heber, D.; Lu, Q.Y. Overview of mechanisms of action of lycopene. Exp. Biol. Med. 2002, 227, 920–923. [Google Scholar] [CrossRef] [PubMed]
- Ahuja, K.D.; Pittaway, J.K.; Ball, M.J. Effects of olive oil and tomato lycopene combination on serum lycopene, lipid profile, and lipid oxidation. Nutrition 2006, 22, 259–265. [Google Scholar] [CrossRef] [Green Version]
- Riccioni, G.; Gammone, M.A.; Currenti, W.; D’Orazio, N. Effectiveness and Safety of Dietetic Supplementation of a New Nutraceutical on Lipid Profile and Serum Inflammation Biomarkers in Hypercholesterolemic Patients. Molecules 2018, 23, 1168. [Google Scholar] [CrossRef] [Green Version]
- Cantò, C.; Auwerx, J. PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr. Opin. Lipidol. 2009, 20, 98–105. [Google Scholar] [CrossRef] [Green Version]
- Pfluger, P.T.; Herranz, D.; Velasco-Miguel, S.; Serrano, M.; Tschop, M.H. Sirt1 protects against high-fat diet-induced metabolic damage. Proc. Natl. Acad. Sci. USA 2008, 105, 9793–9798. [Google Scholar] [CrossRef] [Green Version]
- McGrath, J.; Drummond, G.; Kilkenny, C.; Wainwright, C. Guidelines for reporting experiments involving animals: The ARRIVE guidelines. Br. J. Pharmacol. 2010, 160, 1573–1576. [Google Scholar] [CrossRef] [Green Version]
- Fuhrman, B.; Elis, A.; Aviram, M. Hypocholesterolemic effect of lycopene and beta-carotene is related to suppression of cholesterol synthesis and augmentation of LDL receptor activity in macrophages. Biochem. Biophys. Res. Commun. 1997, 233, 658–662. [Google Scholar] [CrossRef] [Green Version]
- Daugherty, A.; Whitman, S.C. Quantification of atherosclerosis in mice. Methods Mol. Biol. 2003, 209, 293–309. [Google Scholar] [PubMed]
- Irrera, N.; Arcoraci, V.; Mannino, F.; Vermiglio, G.; Pallio, G.; Minutoli, L.; Bagnato, G.; Anastasi, G.P.; Mazzon, E.; Bramanti, P.; et al. Activation of A2A Receptor by PDRN Reduces Neuronal Damage and Stimulates WNT/β-CATENIN Driven Neurogenesis in Spinal Cord Injury. Front. Pharmacol. 2018, 9, 506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pizzino, G.; Irrera, N.; Galfo, F.; Pallio, G.; Mannino, F.; D’amore, A.; Pellegrino, E.; Ieni, A.; Russo, G.T.; Calapai, M.; et al. Effects of the antagomiRs 15b and 200b on the altered healing pattern of diabetic mice. Br. J. Pharmacol. 2018, 175, 644–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Picciolo, G.; Pallio, G.; Altavilla, D.; Vaccaro, M.; Oteri, G.; Irrera, N.; Squadrito, F. β-Caryophyllene Reduces the Inflammatory Phenotype of Periodontal Cells by Targeting CB2 Receptors. Biomedicines 2020, 8, 164. [Google Scholar] [CrossRef] [PubMed]
- Benvenga, S.; Marini, H.R.; Micali, A.; Freni, J.; Pallio, G.; Irrera, N.; Squadrito, F.; Altavilla, D.; Antonelli, A.; Ferrari, S.M.; et al. Protective Effects of Myo-Inositol and Selenium on Cadmium-Induced Thyroid Toxicity in Mice. Nutrients 2020, 12, 1222. [Google Scholar] [CrossRef]
- Minutoli, L.; Marini, H.; Rinaldi, M.; Bitto, A.; Irrera, N.; Pizzino, G.; Pallio, G.; Calò, M.; Adamo, E.B.; Trichilo, V.; et al. A dual inhibitor of cyclooxygenase and 5-lipoxygenase protects against kainic acid-induced brain injury. Neuromolecular. Med. 2015, 17, 192–201. [Google Scholar] [CrossRef]
- Pizzino, G.; Irrera, N.; Bitto, A.; Pallio, G.; Mannino, F.; Arcoraci, V.; Aliquò, F.; Minutoli, L.; De Ponte, C.; D’andrea, P.; et al. Cadmium-Induced Oxidative Stress Impairs Glycemic Control in Adolescents. Oxid. Med. Cell Longev. 2017, 2017, 6341671. [Google Scholar] [CrossRef]
- Getz, G.S.; Reardon, C.A. Atherogenic lipids and macrophage subsets. Curr. Opin. Lipidol. 2015, 26, 357–361. [Google Scholar] [CrossRef]
- Sugamura, K.; Keaney, J.F., Jr. Reactive oxygen species in cardiovascular disease. Free Radic. Biol. Med. 2011, 51, 978–992. [Google Scholar] [CrossRef] [Green Version]
- Sung, L.C.; Chao, H.H.; Chen, C.H.; Tsai, J.C.; Liu, J.C.; Hong, H.J.; Cheng, T.H.; Chen, J.J. Lycopene inhibits cyclic strain-induced endothelin-1 expression through the suppression of reactive oxygen species generation and induction of heme oxygenase-1 in human umbilical vein endothelial cells. Clin. Exp. Pharmacol. Physiol. 2015, 42, 632–639. [Google Scholar] [CrossRef]
- Lorenz, M.; Fechner, M.; Kalkowski, J.; Fröhlich, K.; Trautmann, A.; Böhm, V.; Liebisch, G.; Lehneis, S.; Schmitz, G.; Ludwig, A.; et al. Effects of lycopene on the initial state of atherosclerosis in New Zealand White (NZW) rabbits. PLoS ONE 2012, 7, e30808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verghese, M.; Richardson, J.E.; Boateng, J.; Shackelford, L.A.; Howard, C.; Walker, L.T.; Chawanet, C.B. Dietary lycopene has a protective effect on cardiovascular disease in New Zeeland male rabbits. J. Biol. Sci. 2008, 8, 268–277. [Google Scholar] [CrossRef] [Green Version]
- Ried, K.; Fakler, P. Protective effect of lycopene on serum cholesterol and blood pressure: Meta-analyses of intervention trials. Maturitas 2011, 68, 299–310. [Google Scholar] [CrossRef]
- Mozos, I.; Stoian, D.; Caraba, A.; Malainer, C.; Horbańczuk, J.O.; Atanasov, A.G. Lycopene and Vascular Health. Front. Pharmacol. 2018, 9, 521. [Google Scholar] [CrossRef]
- Lomb, D.J.; Laurent, G.; Haigis, M.C. Sirtuins regulate key aspects of lipid metabolism. Biochim. Biophys. Acta 2010, 1804, 1652–1657. [Google Scholar] [CrossRef] [PubMed]
- Purushotham, A.; Schug, T.T.; Xu, Q.; Surapureddi, S.; Guo, X.; Li, X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab. 2009, 9, 327–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Zhang, S.; Blander, G.; Tse, J.G.; Krieger, M.; Guarente, L. SIRT1 deacetylates and positively regulates the nuclear receptor LXR. Mol. Cell 2007, 28, 91–106. [Google Scholar] [CrossRef]
- Hu, M.Y.; Li, Y.L.; Jiang, C.H.; Liu, Z.Q.; Qu, S.L.; Huang, Y.M. Comparison of lycopene and fluvastatin effects on atherosclerosis induced by a high-fat diet in rabbits. Nutrition 2008, 24, 1030–1038. [Google Scholar] [CrossRef]
- Hung, C.F.; Huang, T.F.; Chen, B.H.; Shieh, J.M.; Wu, P.H.; Wu, W.B. Lycopene inhibits TNF-alpha-induced endothelial ICAM-1 expression and mon- ocyte-endothelial adhesion. Eur. J. Pharmacol. 2008, 586, 275–282. [Google Scholar] [CrossRef]
- Gianetti, J.; Pedrinelli, R.; Petrucci, R.; Lazzerini, G.; De Caterina, M.; Bellomo, G.; De Caterina, R. Inverse association between carotid intima-media thickness and the antioxidant lycopene in atherosclerosis. Am. Heart J. 2002, 143, 467–474. [Google Scholar] [CrossRef]
- Riccioni, G.; Scotti, L.; Di Ilio, E.; Bucciarelli, V.; Ballone, E.; De Girolamo, M.; D’ Orazio, N.; Martini, F.; Aceto, A.; Bucciarelli, T. Lycopene and preclinical carotid atherosclerosis. J. Biol. Regul. Homeost. Agents 2011, 25, 435–441. [Google Scholar] [PubMed]
- Karppi, J.; Kurl, S.; Ronkainen, K.; Kauhanen, J.; Laukkanen, J.A. Serum carotenoids reduce progression of early atherosclerosis in the carotid artery wall among Eastern Finnish men. PLoS ONE 2013, 8, e64107. [Google Scholar]
- Mathur, P.; Ostadal, B.; Romeo, F.; Mehta, J.L. Gender-Related Differences in Atherosclerosis. Cardiovasc. Drugs Ther. 2015, 29, 319–327. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence |
---|---|
β-actin | Fw:5′AGCCATGTACGTAGCCATCC3′ |
Rw:5′CTCTCAGCTGTGGTGGTGAA3′ | |
PPAR-α | Fw:5′AGCCCCATCTGTCCTCTCTC3′ |
Rw:5′TTCGACACTCGATGTTCAGG3′ | |
SREBF-1 | Fw:5′GATCAAAGAGGAGCCAGTGC3′ |
Rw:5′TAGATGGTGGCTGCTGAGTG3′ | |
AMPK-α | Fw:5′CGAAGCTCAAGGAAAGCCCT3′ |
Rw:5′CCTGGTCTTGGAGCTACGTC3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mannino, F.; Pallio, G.; Altavilla, D.; Squadrito, F.; Vermiglio, G.; Bitto, A.; Irrera, N. Atherosclerosis Plaque Reduction by Lycopene Is Mediated by Increased Energy Expenditure through AMPK and PPARα in ApoE KO Mice Fed with a High Fat Diet. Biomolecules 2022, 12, 973. https://doi.org/10.3390/biom12070973
Mannino F, Pallio G, Altavilla D, Squadrito F, Vermiglio G, Bitto A, Irrera N. Atherosclerosis Plaque Reduction by Lycopene Is Mediated by Increased Energy Expenditure through AMPK and PPARα in ApoE KO Mice Fed with a High Fat Diet. Biomolecules. 2022; 12(7):973. https://doi.org/10.3390/biom12070973
Chicago/Turabian StyleMannino, Federica, Giovanni Pallio, Domenica Altavilla, Francesco Squadrito, Giovanna Vermiglio, Alessandra Bitto, and Natasha Irrera. 2022. "Atherosclerosis Plaque Reduction by Lycopene Is Mediated by Increased Energy Expenditure through AMPK and PPARα in ApoE KO Mice Fed with a High Fat Diet" Biomolecules 12, no. 7: 973. https://doi.org/10.3390/biom12070973
APA StyleMannino, F., Pallio, G., Altavilla, D., Squadrito, F., Vermiglio, G., Bitto, A., & Irrera, N. (2022). Atherosclerosis Plaque Reduction by Lycopene Is Mediated by Increased Energy Expenditure through AMPK and PPARα in ApoE KO Mice Fed with a High Fat Diet. Biomolecules, 12(7), 973. https://doi.org/10.3390/biom12070973