Next Article in Journal
Establishment of a Novel and Efficient Agrobacterium-Mediated in Planta Transformation System for Passion Fruit (Passiflora edulis)
Next Article in Special Issue
An R2R3-MYB Transcription Factor OsMYBAS1 Promotes Seed Germination under Different Sowing Depths in Transgenic Rice
Previous Article in Journal
Metabolic Changes in Seed Embryos of Hypoxia-Tolerant Rice and Hypoxia-Sensitive Barley at the Onset of Germination
Previous Article in Special Issue
Differential Physiological Responses to Salt Stress between Salt-Sensitive and Salt-Tolerant japonica Rice Cultivars at the Post-Germination and Seedling Stages
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Opposite Roles of White Light in Regulating Germination of Fresh and Aged Seed in Tobacco

1
College of Agriculture, University of Guizhou, Guiyang 550025, China
2
Key Laboratory of Plant Resource Conservation and Germplasm Innovation in Mountainous Region (Ministry of Education), University of Guizhou, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Plants 2021, 10(11), 2457; https://doi.org/10.3390/plants10112457
Submission received: 5 October 2021 / Revised: 10 November 2021 / Accepted: 10 November 2021 / Published: 14 November 2021

Abstract

:
Light is one of the important environmental factors for seeds to evaluate whether the natural environment is appropriate for germination and subsequent seedlings emergence. The mechanism of light-mediated germination is mainly concerned with fresh seeds (FS) of model plants but is poorly understood in aged seeds. Here, the effects of light on germination of FS and naturally aged seeds (NAS) in tobacco and their relationship with plant hormones gibberellins (GA) and abscisic acid (ABA) were investigated. The results demonstrated that light promoted and inhibited the germination of FS and NAS, respectively. GA and ABA were involved in the germination control of NAS, as well as in FS. However, light suppressed GA signal and stimulated ABA signal in NAS, whereas it stimulated GA signal and suppressed ABA signal in FS. In addition, light stimulated the GA accumulation and reduction in ABA in FS while inhibiting the increase in GA level in NAS. Together, the present study demonstrates that light has opposite effects on the germination of FS and NAS, which are closely related to the metabolism and/or signaling of plant hormones ABA and GA.

1. Introduction

Seed dormancy can be considered as the inability of viable seeds to germinate under favorable conditions [1]. Germination begins with the uptake of water by dry seed and ends with the protrusion of their radicles [2,3]. The essential role of the plant hormones abscisic acid (ABA) and gibberellin (GA) in the control of dormancy and germination has been recognized in photophilic, photoneutral, and photophobic seeds [4,5,6,7,8]. ABA is a positive regulator of dormancy induction and maintenance and acts as a negative regulator of germination. GA releases dormancy and promotes germination by antagonizing ABA actions [9,10,11]. Genetic evidence suggests that seed germination is not only regulated by hormone levels but also by hormone signals. ABA-deficient mutants, such as aba1-1 and ABA-insensitive mutants, such as abi3, show reduced seed dormancy [12,13,14]. In contrast, GA-deficient mutants such as ga1-3 and GA-insensitive mutants such as gid1-receptor triple, sly1-10, and gai show impaired seed germination [15,16,17].
Light is an important environmental signal that regulates seed germination of small-seeded plants, such as Arabidopsis, lettuce, and tomato (Solanum lycopersicum), and it controls seed germination by affecting biosynthesis and/or signals ABA/GA [18,19]. In Arabidopsis, PIF1 (PHYTOCHROME-INTERACTING FACTOR 1) strongly inhibits PHYA- and (or) PHYB-induced germination under dark [20]. On the one hand, PIF1 promotes the transcription of the genes (GA2ox2, ABA DEFICIENT1 (ABA1) and NCED6, 9) and inhibits the expression of genes (GA3ox1 and CYP707A2), leading to a low GA/ABA ratio and consequently inhibiting seed germination [21,22,23]. On the other hand, PIF1 also promotes the expression of genes (ABI3 and ABI5), which positively regulate ABA signaling and genes (RGA and GA-INSENSITIVE) that negatively regulate GA signaling, thereby inhibiting seed germination [24,25,26]. Under light, PHYA and (or) PHYB are activated by light and subsequently promote the degradation of PIF1 [27,28], thereby releasing those genes controlled by PIF1, leading to an increase in the GA/ABA ratio and stimulating GA signaling for seed germination. In lettuce, light regulates GA biosynthesis and light- and GA-mediated regulation of ABA metabolism during germination of photoblastic lettuce seeds [29,30].
It is assumed that light has at least two effects on the germination of tobacco seeds [31]. First, it activates the PHY signal pathway to release photodormancy and promote germination. Second, light accelerates rupture of the endosperm in non-photodormant tobacco seeds. In tobacco, testa rupture and endosperm rupture are separate events during seed germination. ABA delays endosperm rupture but not testa rupture [32]. GA can substitute for the red-light trigger needed to release photodormancy and to induce both testa rupture and the subsequent endosperm rupture of tobacco seeds imbibed in the dark. GA also can promote the germination of non-photodormant tobacco seeds by counteracting the inhibitory effects of ABA on endosperm rupture [33]. Several specific target enzymes, such as XTHs (xyloglucan endotransglycosylases),areinduced by GA in the micropylar endosperm during seed germination and proposed to promote endosperm weakening [3].
In photophilic seeds, light determines the levels and signals of gibberellin (GA) and abscisic acid (ABA), which promote and inhibit germination, respectively. Although this effect has been known in fresh seeds (FS) of Arabidopsis (Arabidopsis thaliana) and lettuce (Lactuca sativa), the molecular basis of light-regulated germination in aged seeds is still poorly understood. With the storage of seeds, the germination ratio of seed batches gradually decreases, and G50 (50% germination) is used as the standard to judge the survival of a batch of seeds. In this study, we noticed that the germination of FS was strongly inhibited by the entire spectrum of visible light in tobacco, while germination of NAS (G50) was promoted by the light. Kinetic curve analysis of hormones and related genes revealed that NAS has similar regulatory components as in FS for germination but with opposite responses to light.

2. Results

2.1. FS and NAS Germinate Better under Light and Dark Conditions

As shown in Figure 1, the germination ratio of FS was above 90% under light, which was significantly higher than that of 40% under dark. On the contrary, the germination ratio of NAS was higher under dark conditions and lower under light, with a difference of about 20%. The results indicated that the light promoted the germination of FS while inhibiting the germination of NAS.

2.2. GA Replaced Light to Promote and Inhibit Germination of FS and NAS

Under dark, the germination of FS was significantly improved by the application of exogenous GA3; however, the germination of NAS was inhibited by GA3 application, and the inhibiting effects were enhanced with an increase in its concentration. Under light, exogenous GA3 unaffected the germination of FS, and it promoted the germination of NAS at a high concentration of 10−3 mol/L (Figure 2).
The germination of FS was inhibited by ABA treatment either under light or dark. The higher the concentration, the more obvious the inhibition. The germination of NAS was inhibited by ABA treatment under light, while the germination was promoted at some concentrations by ABA under dark (Figure 2). The above results indicated that the FS was sensitive to ABA and GA during the germination, while the NAS seems to have lost their sensitivity to ABA and GA, or at least the sensitivity is much lower. The sensitivity of FS to ABA was not affected by light, while its sensitivity to GA was affected by light.

2.3. The Germination of FS Depending on Light to Promote GA Biosynthesis and ABA Reduction

In dry seeds, the ABA level in NAS was higher than that in FS (Figure 3A). After imbibition, ABA levels of NAS continued to decrease under light, while increased first and then subsequently decreased under dark. ABA levels of FS showed opposite changes, which continuously decreased and increased when they were incubated under light and dark, respectively. These results indicated that light promotes the decrease in ABA levels in both FS and NAS.
In dry seeds, GA6, GA9, and GA15 levels were significantly higher in NAS than those in FS (Figure 3D–F), while GA1, GA3, and GA34 levels showed no significant differences. (Figure 3B,C,G). After imbibition, the levels of GA9 and GA15 continued to decrease in NAS under both light and dark, reaching a level similar to those in FS. In both FS and NAS, the GA34 level was higher when the seeds were cultivated under light than under dark, or at least equal. The level of GA6 increased first and then decreased in FS or NAS, and its levels in FS showed that cultivated under light is lower than under dark, while showed higher under light in NAS. The changes of active GAs are similar in FS and NAS incubated under dark, with GA1 and GA3 showing a gradual increase after imbibition. Notably, the changes of active GAs are different in FS and NAS under light, with a significant increase in GA1 and GA3 on the third day in FS and not in NAS.
In dry seeds, the ABA/GA ratio in FS was significantly higher than that in NAS (Figure 3H). After imbibition, the ratios of ABA/GAs in both FS and NAS decreased quickly under light. Under dark, the ratio of ABA/GA in FS appears to decrease first and then increase, while ABA/GA ratio in NAS showed, increase first and then decrease. The ABA/GA ratios of both FS and NAS were lower under light than those under dark.
The above results indicate that the higher germination rate of FS under light conditions depends on the increase in active GA and the decrease in ABA level resulting in a lower ABA/GA ratio; while the lower germination under dark conditions is due to the decrease in active GA and the increase in ABA level leading to a higher ABA/GA ratio. However, there was no similar regulatory mechanism in NAS as FS.

2.4. The Effect of ABA Catabolism on Germination of FS Promoted by Light

In Arabidopsis, NCED6 is considered to be a key gene regulating ABA biosynthesis, whereasCYP707A1 is involved in regulating ABA catabolic metabolism. No significant differences in the expression levels of NtNCED6 and NtCYP707A1 were observed between FS and NAS in the dry state (Figure 4A,B). After imbibition, the expression levels of NtNCED6 were generally decreased either in FS or NAS under light and dark, but the decline speed of FS was significantly faster than that of NAS. The expression of NtNCED6 was down- and upregulated by light in FS and NAS, respectively. Notably, NtCYP707A1 was specifically highly expressed in FS on the first day, and its expression was significantly upregulated by light. These results indicate that ABA anabolism could be inhibited and stimulated by light in FS and NAS, respectively, while ABA catabolism could be stimulated by light in FS.
ABI3 and ABI5 are considered positive regulators of ABA signaling pathways, and they inhibit seed germination significantly in Arabidopsis. NtABI5 and NtABI3 were more highly expressed in the dry state of FS than that of NAS (Figure 4C,D). The expression level of NtABI3 was quickly decreased in both FS and NAS on the first day, and light decelerated the decline speed. Notably, the NtABI3 expression level specificity increased on the third day of dark culture in NAS. The expression of NtABI5 showed a different trend, and its expression level in FS showed a continuous decrease, while in NAS, it showed an increase first and then a decrease. Light accelerated the decrease in the expression level of NtABI5 in FS. These results suggest that the light-promoted germination of FS could be due to the reduction in ABA levels and suppression of its signal, while ABA anabolism and its signaling appear to be stimulated at the imbibition stage in NAS.

2.5. The Effect of GA Levels on Germination of FS Promoted by Light

GA3ox is the key regulatory gene for GA biosynthesis, whereasGA2ox mediates GA degradation. As shown in Figure 4E, the expression level of NtGA3ox2 did not show a significant difference between NAS and FS. After imbibition, the expression of NtGA3ox2 showed an opposite change between FS and NAS. The expression level of NtGA3ox2 in FS increased first, then decreased, and then increased, while the expression level in NAS decreased first, followed by an increase and then a decline. The expression of NtGA3ox2 in FS is upregulated by light while not in NAS.
NtGA2ox2 expression is significantly higher in the dry state of NAS than that in FS (Figure 4F). The expression level of NtGA2ox2 in NAS is decreasing both under light and dark. The expression level of NtGA2ox2 in FS increased first, followed by a decline under light, which decreased first and then increased under dark. Light up-regulates the expression of NtGA2ox2 in NAS. These results indicated that light-promoted FS germination might be due to inhibition of GA catabolism and promotion of GA anabolism, while GA catabolism seems to be stimulated in NAS.
In the dry state, the expression level of NtGAI in NAS was significantly higher than that in FS (Figure 4G). After imbibition, its expression level in NAS was significantly reduced, especially under dark. However, the expression level in FS was significantly increased and then reduced. These results indicated that the photo-inhibited NAS germination might be due to the inhibition of the GA signal.

2.6. The Effect of Cell Wall Hydrolysis on Light-Promoted and -Inhibited Germination of FS and NAS

XTHs are induced by GA to promote the germination of Arabidopsis seeds. As shown in Figure 4H, the expression level of NtXTH2 was significantly higher in NAS than FS in the dry state. After imbibition, NtXTH2 was specificity highly expressed on DAI24inFS under light. These results suggest that the light-promoted germination of FS could be due to the cell wall hydrolysis, while light-inhibited germination of NAS may be due to the partial inhibition of cell wall hydrolysis.

3. Discussion

Light is an important environmental signal. That is involved in regulating the germination of photosensitive seeds. The freshly harvested tobacco seeds are photodormant, their germination is strongly inhibited in the dark, and light can initiate the germination of photodormant seeds [34,35]. In other small-seeded species, such as lettuce [29,30,36,37] and Arabidopsis, light has also been shown to be necessary to initiate the germination of fresh seeds [38,39]. In contrast, seed germination of tomato and Aethionema arabicum are inhibited by light [8,40]. Overall, the germination of light-requiring (positive photoblastic) seeds requires light initiation, whereas light-inhibited (negative photoblastic) seeds need to avoid the participation of light signals. In this study, we noticed that light does promote the germination of FS in tobacco but partly inhibits the germination of NAS. To date, there is no relevant report on photo-inhibition of the germination of positive photoblastic seeds in the literature. We, therefore, speculate that light may provide suitable and unsuitable environments for germination of FS and NAS in tobacco, respectively.
ABA is the main plant hormone involved in inducing and maintaining seed dormancy and inhibiting germination, and GA is a key phytohormone that promotes seed germination by antagonizing ABA [9,33]. It has been reported that exogenous addition of GA and ABA promotes and inhibits seed germination, respectively. The effect of GA is more obvious under dark conditions, while the effect of ABA inhibiting seed germination is significant under both light and dark conditions [34]. This study also found that exogenous GA significantly promoted the germination of FS in the dark; however, the germination of NAS was inhibited under dark at the same concentration of GA application. In addition, the inhibitory effect of ABA on NAS is not obvious, especially in dark conditions. It has been reported that 10 or 100 μmol/L ABA strongly inhibited seed germination under light or dark [34,41]. No obvious inhibitory effect was observed in this study. We speculate that this difference could be the genotypes of the seeds or the different cultivation environments of the mother plants. In addition, the germination bed may also affect the results of the experiment. Agar germination beds were chosen instead of paper beds in this study.
It is well known that light regulates seed germination in Arabidopsis by integrating ABA and GA metabolism, including decreased ABA level and increased GA level [18,28]. Similarly, the germination of lettuce seeds also depends on light to regulate the anabolism of gibberellin and the catabolism of abscisic acid [29,30]. In this study, we noticed that light promoted the germination of FS in tobacco, which depended on the reduction in ABA levels and increase in GA levels. However, light also stimulated the reduction in ABA level in NAS but inhibited its germination. Recently, it has been illustrated that the same ABA/GA key regulatory components are required in light-inhibited and light-requiring germination in the Brassicaceae, but the difference between the expression of genes for key regulators upon light exposure [8]. Overall, light-regulated germination is related to hormone balance [8]. In this study, we noted that the germination ratio of FS was higher under light with a lower ABA/GA ratio, while the germination was lower under dark with a higher ABA/GA ratio. However, the germination ratio of NAS was higher under dark with a higher ABA/GA ratio, while the germination was lower under light with a lower ABA/GA ratio.
In Arabidopsis thaliana seeds, the expression of GA anabolic genes GA3ox1 and GA3ox2 are enhanced by light, whereas GA-inactivated gene GA2ox2 is repressed, resulting in an increase in GA level [42,43,44,45]. In this study, the expression of NtGA3ox2 is upregulated by light in FS whereas down-regulated in NAS. NtGA2ox2 is down-regulated by light in FS, whereas itis upregulated in NAS. This indicates that light promotes the increase in GA levels in FS because it not only promotes GA biosynthesis but also inhibits GA catabolism. However, light promotes the catabolism of active GA in NAS. The expression of ABA biosynthesis genes ABA1, NCED6 (9-CIS-EPOXYCAROTENOID DIOXYGENASE 6), and NCED9 are repressed by light in Arabidopsis seed, while ABA catabolism gene CYP707A2 is upregulated, resulting in a decrease in ABA level [21,24,45]. In lettuce seeds, the expression of LsNCED2 and LsNCED4 is repressed by light, whereas LsABA8ox4 is upregulated [29]. In this study, the expression of NtNCED6 was repressed and promoted when they were incubated under light in FS and NAS, respectively. NtCYP707A1 was specifically highly expressed in FS, and its expression was significantly upregulated by light. This indicates that light promotes the decrease in ABA level in FS because it not only inhibits ABA biosynthesis but also promotes ABA catabolism. However, light inhibits the biosynthesis of active GA in NAS.
The expressions of GAI (GIBBERELLIC ACID-IN-SENSITIVE, a negative regulator of GA signal) [24] and ABI3, ABI 5 (ABSCISIC ACID-INSENSITIVE 3, 5, positive regulators of ABA signal) [25,46] are stimulated to inhibit germination under dark in Arabidopsis seed. Furthermore, the expressions of genes required for cell wall loosening, such as EXP (EXPANSIN) and XTH (XYLOGLUCANENDO-TRANSGLYCOSYLASE/HYDROLASE), are repressed to inhibit seed germination under dark [25]. In this study, the expression of NtGAI was stimulated by light to inhibit the germination of NAS, and the expression of NtABI5 and NtXTH was, respectively, repressed and stimulated by light to promote the germination of FS.
It has been shown that the timing of GA and ABA action is different during seed germination in Arabidopsis [47]. ABA could be involved in the regulation of almost all processes in germinating tobacco seeds, including imbibition, storage mobilization, endosperm rupture, and radicle protrusion, etc. [48]. GAs, although required for the completion of germination, are not directly involved in many processes taking place during germination in Arabidopsis seed, occurring at a stage coinciding with or very close to radicle emergence [49,50]. In this study, we noticed that the ABA level of NAS in a dry state was significantly higher than that of FS, and both decreased after imbibition under light. However, their ABA level showed an opposite trend after imbibition under dark, decreasing in NAS and increasing in FS.GA level only significantly improved when FS was exposed to light and at the stage coinciding with or very close to radicle emergence. Therefore, we speculated that the insufficient of GA level leaded to the lower germination of NAS under light, while the higher germination of NAS under dark was more likely due to the reduction in ABA.

4. Materials and Methods

4.1. Plant Materials

The FS of Nicotiana tabacum L. “K326” was obtained from Tobacco Research Institute in Guizhou Province. Seed aging was carried out under natural conditions (an average daily temperature of 15 °C, a daily difference of 6 °C, and an average daily relative humidity of 76%). In the initial stage, the germination of seeds was monitored every three months. When the germination rate began to decrease, the germination of seeds was monitored every month. At the 39th month, the germination ratio reached 50% (G50), and the seeds were taken as NAS in this study. FS and NAS (G50) were used for seed germination and hormone sensitivity testing. Two independent experiments were performed to support the germination pattern of NAS in response to light conditions. Samples on the 1st, 3rd, and 5th days of germination were used to determine the hormone levels and quantify the expression levels of their metabolism and signal genes.

4.2. Seed Germination and Hormone Sensitivity Test

The seeds were disinfected with 0.5% copper sulfate solution for 15 min, then rinsed with distilled water three times, and finally surface dried with filter papers. The sterilization solution containing 0.8% AGAR was poured into disposable Petri dishes to prepare as AGAR germinating beds. A total of 10−6, 10−5, 10−4, 10−3 and 0 mol/L of GA3 (Sigma, St.Louis, MO, USA), and 10−7, 10−6, 10−5, 10−4, and 0 mol/L ABA (Sigma) solutions were prepared, respectively. Seeds were sown on AGAR germinating beds with or without supplementation of ABA or GA3. All Petri dishes were placed in artificial climate chambers with a temperature of 25 °C, light intensity of 18,000 Lux, relative humidity of 80%, and photoperiod of dark or 12 h light/dark cycle. Germination tests were performed on three replicates of 100 seeds. Seeds were checked for germination every day for a total of seven days. Germination was notarized as the length of the observed radicle approximately equal to the length of the seed.

4.3. ABA and GAs Quantification

Fresh tobacco seed materials collected on the 0, 1st, 3rd, and 5th days of germination were immediately frozen in liquid nitrogen and stored at −80 °C until needed. GAs and ABA levels were detected as Met Ware (http://www.metware.cn/) described. A total of 38 GAs were tested. In brief, each sample was ground (30 Hz, 1 min) into powder with a grinder (MM 400, Retsch). A total of 50 mg of the powder was weighed and then extracted with a mixed liquid of methanol: water: formic acid = 15:4:1 (v:v:v), containing an appropriate amount of internal standard substance. A total of 10 μL TEA and 10 μL BPTAB were added into the extraction solution, after 1 h of reaction at 90 °C, the mixture was then blown dry with nitrogen. The extract was reconstituted with 100 μL of 80% methanol-water solution, passed through a 0.22 μm PTFE filter membrane, and placed in a sample bottle for LC-MS/MS analysis. The data acquisition instrument system includes Ultra Performance Liquid Chromatography (UPLC, ExionLC™ AD) and tandem mass spectrometry (MS/MS, QTRAP® 6500+). The liquid phase conditions include: (1) Chromatographic column: ACQUITY HSS T3 column (1.8 µm, 100 mm × 2.1 mm). (2) Mobile phase: Phase A, ultrapure water (adding 0.05% formic acid), and Phase B, acetonitrile (adding 0.05% formic acid). (3) Gradient elution program: 0 min A/B is 90:10 (V/V), 0.5 min A/B is 95:5 (V/V), 8.0 min A/B is 5:95 (V/V), 9.0 min A/B is 5:95 (V/V), 9.1 min A/B is 95:5 (V/V), and 12.0 min A/B is 95:5 (V/V). (4) Flow rate 0.35 mL/min; column temperature 40 °C; injection volume 2μL. The mass spectrometry conditions mainly include: Electrospray ionization temperature was 500 °C, mass spectrometry voltage was 4500 V, curtain gas was 35 psi, and the collision-activated dissociation parameter was set to medium. In Q-Trap 6500+, each ion pair is scanned based on the optimized declustering potential and coll energy.

4.4. RNA Extraction and Quantitative RT-PCR

Total RNA was extracted by using a TIANGEN RNA prep pure plant plus kit (Polysaccharides and Polyphenolics-rich). The concentration and purity of RNA were determined by using a NanoDrop-2000. Reverse transcription of the extracted RNA was performed by using TaKaRaPrimeScript™ II 1st strand cDNA synthesis kit. RT-PCR was performed by using TaKaRaTB Green®Premix Ex Taq™ II (Tli RNaseH Plus), Bulk fluorescence quantification kit 20 µL reaction system as follow: 10 µL TB Green Premix Ex Taq (2×) (Tli RNaseH Plus), 0.4 µL ROX Reference Dye (50×), 2µL diluted to 40 ng/µL cDNA, 0.8μL of the upstream and downstream primers, respectively (Table 1), and make up the rest with water. The conditions of the RT-PCR reaction were 95 °C pre-denaturation for 0.5 min, then 95 °C for 5 s, 58 °C for 30 s and 40 cycles. The relative expression level of each gene was determined by using the Step One Plus real-time PCR instrument, and each sample was repeated three times. The relative expression level was calculated according to the method provided by Livak and Schmittgen [51]. The primers are as follows: NtGA3ox2, NtGA2ox2, NtGAI, NtNCED6, NtCYP707A1, NtABI3, NtABI5, NtXTH2, NtTOC1, NtPHYB1, Actin (Tac9).

5. Conclusions

Light is an important environmental signal that regulates seed dormancy and germination. It promoted and inhibited the germination of FS and NAS in tobacco, respectively. During germination, the FS was more sensitive to ABA and GA compared to NAS, and light would affect their sensitivity. Light promoted the germination of FS and inhibited that of NAS both by integrating metabolisms and/or signals of ABA and GA. First, a light-stimulated GA signal suppressed the ABA signal in FS, whereas it suppressed the GA signal and stimulated the ABA signal in NAS. Secondly, light promoted the increase in GA levels and the reduction in ABA levels in FS, whereas light only promoted the reduction in ABA levels in NAS. Together, the present study demonstrates that light has opposite effects on the germination of FS and NAS, which are closely related to the balance of hormones ABA and GA.

Author Contributions

Conceptualization, Z.-H.L. and Y.W.; methodology, Z.-H.L. and Y.W.; software, Y.W.; validation, Z.-H.L., Y.-L.L., S.D., M.Z. and Y.W.; formal analysis, Z.-H.L.; investigation, Y.-L.L., S.D., M.Z. and Y.W.; resources, Z.-H.L.; visualization, Y.W.; supervision, Z.-H.L.; project administration, Z.-H.L.; funding acquisition, Z.-H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (31860420, 32060512), the Science and Technology Plan Project of Guizhou Province ([2018]5781), the Natural Science Foundation of Guizhou Province ([2019]1069), Construction Program of Biology First-class Discipline in Guizhou (GNYL [2017]009), the Talent Project of Guizhou University ([2018]37).

Acknowledgments

We thank our colleague KunJiang, Yu, College of Agriculture, University of Guizhou, for critical reading of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bewley, J.D. Seed Germination and Dormancy. Plant Cell 1997, 9, 1055–1066. [Google Scholar] [CrossRef] [Green Version]
  2. Finch-Savage, W.E.; Leubner-Metzger, G. Seed dormancy and the control of germination. New Phytol. 2006, 171, 501–523. [Google Scholar] [CrossRef] [PubMed]
  3. Steinbrecher, T.; Leubner-Metzger, G. The biomechanics of seed germination. J. Exp. Bot. 2017, 68, 765–783. [Google Scholar] [CrossRef] [PubMed]
  4. Debeaujon, I.; Koornneef, M. Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid. Plant Physiol. 2000, 122, 415–424. [Google Scholar] [CrossRef] [Green Version]
  5. Piskurewicz, U.; Jikumaru, Y.; Kinoshita, N.; Nambara, E.; Kamiya, Y.; Lopez-Molina, L. The gibberellic acid signaling repressor RGL2 inhibits Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 activity. Plant Cell 2008, 20, 2729–2745. [Google Scholar] [CrossRef] [Green Version]
  6. Chen, B.; Ma, J.; Xu, Z.; Wang, X. Abscisic acid and ethephon regulation of cellulase in the endosperm cap and radicle during lettuce seed germination. J. Integr. Plant Biol. 2016, 58, 859–869. [Google Scholar] [CrossRef] [Green Version]
  7. Guo, G.; Liu, X.; Sun, F.; Cao, J.; Huo, N.; Wuda, B.; Xin, M.; Hu, Z.; Du, J.; Xia, R.; et al. Wheat miR9678 Affects Seed Germination by Generating Phased siRNAs and Modulating Abscisic Acid/Gibberellin Signaling. Plant Cell 2018, 30, 796–814. [Google Scholar] [CrossRef] [Green Version]
  8. Merai, Z.; Graeber, K.; Wilhelmsson, P.; Ullrich, K.K.; Arshad, W.; Grosche, C.; Tarkowska, D.; Tureckova, V.; Strnad, M.; Rensing, S.A.; et al. Aethionemaarabicum: A novel model plant to study the light control of seed germination. J. Exp. Bot. 2019, 70, 3313–3328. [Google Scholar] [CrossRef]
  9. Shu, K.; Liu, X.D.; Xie, Q.; He, Z.H. Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination. Mol. Plant 2016, 9, 34–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Tuan, P.A.; Kumar, R.; Rehal, P.K.; Toora, P.K.; Ayele, B.T. Molecular Mechanisms Underlying Abscisic Acid/Gibberellin Balance in the Control of Seed Dormancy and Germination in Cereals. Front. Plant Sci. 2018, 9, 668. [Google Scholar] [CrossRef] [Green Version]
  11. Ravindran, P.; Kumar, P.P. Regulation of Seed Germination: The Involvement of Multiple Forces Exerted via Gibberellic Acid Signaling. Mol. Plant 2019, 12, 1416–1417. [Google Scholar] [CrossRef] [Green Version]
  12. Groot, S.P.; Karssen, C.M. Dormancy and Germination of Abscisic Acid-Deficient Tomato Seeds: Studies with the sitiens Mutant. Plant Physiol. 1992, 99, 952–958. [Google Scholar] [CrossRef] [Green Version]
  13. Nambara, E.; Hayama, R.; Tsuchiya, Y.; Nishimura, M.; Kawaide, H.; Kamiya, Y.; Naito, S. The role of ABI3 and FUS3 loci in Arabidopsis thaliana on phase transition from late embryo development to germination. Dev. Biol. 2000, 220, 412–423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Bassel, G.W.; Mullen, R.T.; Bewley, J.D. ABI3 expression ceases following, but not during, germination of tomato and Arabidopsis seeds. J. Exp. Bot. 2006, 57, 1291–1297. [Google Scholar] [CrossRef]
  15. Steber, C.M.; Cooney, S.E.; McCourt, P. Isolation of the GA-response mutant sly1 as a suppressor of ABI1-1 in Arabidopsis thaliana. Genetics 1998, 149, 509–521. [Google Scholar] [CrossRef]
  16. Iuchi, S.; Suzuki, H.; Kim, Y.C.; Iuchi, A.; Kuromori, T.; Ueguchi-Tanaka, M.; Asami, T.; Yamaguchi, I.; Matsuoka, M.; Kobayashi, M.; et al. Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal. Plant J. 2007, 50, 958–966. [Google Scholar] [CrossRef] [PubMed]
  17. Willige, B.C.; Ghosh, S.; Nill, C.; Zourelidou, M.; Dohmann, E.M.; Maier, A.; Schwechheimer, C. The DELLA domain of GA INSENSITIVE mediates the interaction with the GA INSENSITIVE DWARF1A gibberellin receptor of Arabidopsis. Plant Cell 2007, 19, 1209–1220. [Google Scholar] [CrossRef] [Green Version]
  18. Yang, L.; Liu, S.; Lin, R. The role of light in regulating seed dormancy and germination. J. Integr. Plant Biol. 2020, 62, 1310–1326. [Google Scholar] [CrossRef] [PubMed]
  19. Neff, M.M. Light-mediated seed germination: Connecting phytochrome B to gibberellic acid. Dev. Cell 2012, 22, 687–688. [Google Scholar] [CrossRef] [Green Version]
  20. Oh, E.; Yamaguchi, S.; Kamiya, Y.; Bae, G.; Chung, W.I.; Choi, G. Light activates the degradation of PIL5 protein to promote seed germination through gibberellin in Arabidopsis. Plant J. 2006, 47, 124–139. [Google Scholar] [CrossRef]
  21. Kim, D.H.; Yamaguchi, S.; Lim, S.; Oh, E.; Park, J.; Hanada, A.; Kamiya, Y.; Choi, G. SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5. Plant Cell 2008, 20, 1260–1277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Gabriele, S.; Rizza, A.; Martone, J.; Circelli, P.; Costantino, P.; Vittorioso, P. The Dof protein DAG1 mediates PIL5 activity on seed germination by negatively regulating GA biosynthetic gene AtGA3ox1. Plant J. 2010, 61, 312–323. [Google Scholar] [CrossRef] [PubMed]
  23. Nee, G.; Xiang, Y.; Soppe, W.J. The release of dormancy, a wake-up call for seeds to germinate. Curr. Opin. Plant Biol. 2017, 35, 8–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Oh, E.; Yamaguchi, S.; Hu, J.H.; Yusuke, J.; Jung, B.; Paik, I.; Lee, H.S.; Sun, T.P.; Kamiya, Y.; Choi, G. PIL5, a phytochrome-interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA promoters in Arabidopsis seeds. Plant Cell 2007, 19, 1192–1208. [Google Scholar] [CrossRef] [Green Version]
  25. Oh, E.; Kang, H.; Yamaguchi, S.; Park, J.; Lee, D.; Kamiya, Y.; Choi, G. Genome-Wide Analysis of Genes Targeted by PHYTOCHROME INTERACTING FACTOR 3-LIKE5 during Seed Germination in Arabidopsis. Plant Cell 2009, 21, 403–419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Park, J.; Lee, N.; Kim, W.; Lim, S.; Choi, G. ABI3 and PIL5 Collaboratively Activate the Expression of SOMNUS by Directly Binding to Its Promoter in Imbibed Arabidopsis Seeds. Plant Cell 2011, 23, 1404–1415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Lee, K.P.; Piskurewicz, U.; Tureckova, V.; Carat, S.; Chappuis, R.; Strnad, M.; Fankhauser, C.; Lopez-Molina, L. Spatially and genetically distinct control of seed germination by phytochromes A and B. Genes Dev. 2012, 26, 1984–1996. [Google Scholar] [CrossRef] [Green Version]
  28. De Wit, M.; Galvao, V.C.; Fankhauser, C. Light-Mediated Hormonal Regulation of Plant Growth and Development. In Annual Review of Plant Biology; Merchant, S.S., Ed.; Annual Review of Plant Biology; Annual Reviews: Palo Alto, CA, USA, 2016; Volume 67, pp. 513–537. [Google Scholar]
  29. Sawada, Y.; Aoki, M.; Nakaminami, K.; Mitsuhashi, W.; Tatematsu, K.; Kushiro, T.; Koshiba, T.; Kamiya, Y.; Inoue, Y.; Nambara, E.; et al. Phytochrome- and gibberellin-mediated regulation of abscisic acid metabolism during germination of photoblastic lettuce seeds. Plant Physiol. 2008, 146, 1386–1396. [Google Scholar] [CrossRef] [Green Version]
  30. Toyomasu, T.; Kawaide, H.; Mitsuhashi, W.; Inoue, Y.; Kamiya, Y. Phytochrome regulates gibberellin biosynthesis during germination of photoblastic lettuce seeds. Plant Physiol. 1998, 118, 1517–1523. [Google Scholar] [CrossRef] [Green Version]
  31. Leubner-Metzger, G. Functions and regulation of ß-1,3-glucanases during seed germination, dormancy release and after-ripening. Seed Sci. Res. 2003, 13, 17–34. [Google Scholar] [CrossRef] [Green Version]
  32. Leubner-Metzger, G.; Frundt, C.; Vogeli-Lange, R.; Meins, F., Jr. Class I [beta]-1,3-Glucanases in the Endosperm of Tobacco during Germination. Plant Physiol. 1995, 109, 751–759. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Kucera, B.; Cohn, M.A.; Leubner-Metzger, G. Plant hormone interactions during seed dormancy release and germination. Seed Sci. Res. 2005, 15, 281–307. [Google Scholar] [CrossRef]
  34. Leubner-Metzger, G. Brassinosteroids and gibberellins promote tobacco seed germination by distinct pathways. Planta 2001, 213, 758–763. [Google Scholar] [CrossRef] [PubMed]
  35. Leubner-Metzger, G. Seed after-ripening and over-expression of class I beta-1,3-glucanase confer maternal effects on tobacco testa rupture and dormancy release. Planta 2002, 215, 959–968. [Google Scholar] [CrossRef]
  36. Flint, L.H. Light in Relation to Dormancy and Germination in Lettuce Seed. Science 1934, 80, 38–40. [Google Scholar] [CrossRef]
  37. Gupta, S.; Plackova, L.; Kulkarni, M.G.; Dolezal, K.; Van Staden, J. Role of Smoke Stimulatory and Inhibitory Biomolecules in Phytochrome-Regulated Seed Germination of Lactuca sativa. Plant Physiol. 2019, 181, 458–470. [Google Scholar] [CrossRef] [Green Version]
  38. Shi, H.; Wang, X.; Mo, X.; Tang, C.; Zhong, S.; Deng, X.W. Arabidopsis DET1 degrades HFR1 but stabilizes PIF1 to precisely regulate seed germination. Proc. Natl. Acad. Sci. USA 2015, 112, 3817–3822. [Google Scholar] [CrossRef] [Green Version]
  39. Shi, H.; Zhong, S.; Mo, X.; Liu, N.; Nezames, C.D.; Deng, X.W. HFR1 sequesters PIF1 to govern the transcriptional network underlying light-initiated seed germination in Arabidopsis. Plant Cell 2013, 25, 3770–3784. [Google Scholar] [CrossRef] [Green Version]
  40. Appenroth, K.J.; Lenk, G.; Goldau, L.; Sharma, R. Tomato seed germination: Regulation of different response modes by phytochrome B2 and phytochrome A. Plant Cell Environ. 2006, 29, 701–709. [Google Scholar] [CrossRef] [Green Version]
  41. Leubner-Metzger, G.; Frundt, C.; Meins, F., Jr. Effects of gibberellins, darkness and osmotica on endosperm rupture and class I β-1,3-glucanase induction in tobacco seed germination. Planta 1996, 199, 282–288. [Google Scholar] [CrossRef]
  42. Yamauchi, Y.; Ogawa, M.; Kuwahara, A.; Hanada, A.; Kamiya, Y.; Yamaguchi, S. Activation of Gibberellin biosynthesis and response pathways by low temperature during imbibition of Arabidopsis thaliana seeds. Plant Cell 2004, 16, 367–378. [Google Scholar] [CrossRef] [Green Version]
  43. Yamauchi, Y.; Takeda-Kamiya, N.; Hanada, A.; Ogawa, M.; Kuwahara, A.; Seo, M.; Kamiya, Y.; Yamaguchi, S. Contribution of gibberellin deactivation by AtGA2ox2 to the suppression of germination of dark-imbibed Arabidopsis thaliana seeds. Plant Cell Physiol. 2007, 48, 555–561. [Google Scholar] [CrossRef] [Green Version]
  44. Oh, E.; Kim, J.; Park, E.; Kim, J.I.; Kang, C.; Choi, G. PIL5, a phytochrome-interacting basic helix-loop-helix protein, is a key negative regulator of seed germination in Arabidopsis thaliana. Plant Cell 2004, 16, 3045–3058. [Google Scholar] [CrossRef] [Green Version]
  45. Seo, M.; Hanada, A.; Kuwahara, A.; Endo, A.; Okamoto, M.; Yamauchi, Y.; North, H.; Marion-Poll, A.; Sun, T.P.; Koshiba, T.; et al. Regulation of hormone metabolism in Arabidopsis seeds: Phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. Plant J. 2006, 48, 354–366. [Google Scholar] [CrossRef] [PubMed]
  46. Kim, J.; Kang, H.; Park, J.; Kim, W.; Yoo, J.; Lee, N.; Kim, J.; Yoon, T.Y.; Choi, G. PIF1-Interacting Transcription Factors and Their Binding Sequence Elements Determine the in Vivo Targeting Sites of PIF1. Plant Cell 2016, 28, 1388–1405. [Google Scholar] [CrossRef] [Green Version]
  47. Rajjou, L.; Duval, M.; Gallardo, K.; Catusse, J.; Bally, J.; Job, C.; Job, D. Seed germination and vigor. Annu. Rev. Plant Biol. 2012, 63, 507–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Manz, B.; Muller, K.; Kucera, B.; Volke, F.; Leubner-Metzger, G. Water uptake and distribution in germinating tobacco seeds investigated in vivo by nuclear magnetic resonance imaging. Plant Physiol. 2005, 138, 1538–1551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Gallardo, K.; Job, C.; Groot, S.P.; Puype, M.; Demol, H.; Vandekerckhove, J.; Job, D. Proteomics of Arabidopsis seed germination. A comparative study of wild-type and gibberellin-deficient seeds. Plant Physiol. 2002, 129, 823–837. [Google Scholar] [CrossRef] [Green Version]
  50. Ogawa, M.; Hanada, A.; Yamauchi, Y.; Kuwahara, A.; Kamiya, Y.; Yamaguchi, S. Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 2003, 15, 1591–1604. [Google Scholar] [CrossRef] [Green Version]
  51. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Light promotes and inhibits germination of freshly harvested seeds (FS) and naturally aged seeds (NAS), respectively. Percentage of germinating seeds kept in darkness (black graphics, the same Figs below) or under 12 h light/dark (white graphics, the same Figs below) cycle and 325 μmol m−2 s−1 white light condition, scored over time.
Figure 1. Light promotes and inhibits germination of freshly harvested seeds (FS) and naturally aged seeds (NAS), respectively. Percentage of germinating seeds kept in darkness (black graphics, the same Figs below) or under 12 h light/dark (white graphics, the same Figs below) cycle and 325 μmol m−2 s−1 white light condition, scored over time.
Plants 10 02457 g001
Figure 2. ABA and GA sensitivity of FS and NAS during germination. Percentage of germination on FS seeds (AD) and NAS (EH) kept in darkness or under 12 h light/dark cycle and 325 μmol m−2 s−1 white light condition, and (+) indicates that the gradient concentration of gibberellin or abscisic acid is used for seed treatment.
Figure 2. ABA and GA sensitivity of FS and NAS during germination. Percentage of germination on FS seeds (AD) and NAS (EH) kept in darkness or under 12 h light/dark cycle and 325 μmol m−2 s−1 white light condition, and (+) indicates that the gradient concentration of gibberellin or abscisic acid is used for seed treatment.
Plants 10 02457 g002
Figure 3. Kinetic curves of ABA and GA level in germinating FS and NAS. Hormone levels [in ng g−1 dry weight (DW)] of ABA (A), bioactive GA (B,C), and inactive GA (DG) are shown during seed germination in tobacco. (H) Ratio of the averages from GAs (Sum of active and inactive GA) and ABA measurements.
Figure 3. Kinetic curves of ABA and GA level in germinating FS and NAS. Hormone levels [in ng g−1 dry weight (DW)] of ABA (A), bioactive GA (B,C), and inactive GA (DG) are shown during seed germination in tobacco. (H) Ratio of the averages from GAs (Sum of active and inactive GA) and ABA measurements.
Plants 10 02457 g003
Figure 4. Expression levels of genes involved in ABA (AD) or GA (EH) metabolism or signal in FS or NAS during germination.
Figure 4. Expression levels of genes involved in ABA (AD) or GA (EH) metabolism or signal in FS or NAS during germination.
Plants 10 02457 g004
Table 1. Real-time PCR primers used for genes expression analysis.
Table 1. Real-time PCR primers used for genes expression analysis.
Gene NameForward Primer (5′–3′)Reverse Primer (5′–3′)
NtGA3ox2TGGAAAAACTAGCCGGAAGAGCCCATTTCATATCGTCCTTAC
NtGA2ox2TTGGAGGACCACCATTGAGTCAAGCTGTCTTGATCCCCTTT
NtGAITCCACTAACAACAGATGCAACAACAAGACAGCTTCAGCACACGCCATT
NtNCED6AGTTTCGGGTTGGTGGATGCTACCTGTAATACGGACGCTATACGGAAGAT
NtCYP707A1GGTGATTCTGCTGGTGTTGTCTCTGGGATATAGCTTAATGGGCAGA
NtABI3GAGTATCAGACCATGGAATCTGCTTCCATCGCGGAGAATTG
NtABI5CGCAAAAGGCGACTAACAAACACATCAAGGGCAACTCAA
NtXTH2GGCTAGTCACCACATCAAGTACCTCACACCTGAAGACCTGTCAAGAACAAGAT
NtTOC1TGCTTCCACCACTGCTGCTCATATCCTGTCTGCCGTTCATTAGTTCCT
NtPHYB1GTGTGATACTGTGGTTGAGAGTGTGATTGAGGAATGTCGGTAGCAGGATAATG
Actin(Tac9)CCTGAGGTCCTTTTCCAACCAGGATTCCGGCAGCTTCCATT
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, Y.; Zhang, M.; Dong, S.; Liu, Y.-L.; Li, Z.-H. The Opposite Roles of White Light in Regulating Germination of Fresh and Aged Seed in Tobacco. Plants 2021, 10, 2457. https://doi.org/10.3390/plants10112457

AMA Style

Wang Y, Zhang M, Dong S, Liu Y-L, Li Z-H. The Opposite Roles of White Light in Regulating Germination of Fresh and Aged Seed in Tobacco. Plants. 2021; 10(11):2457. https://doi.org/10.3390/plants10112457

Chicago/Turabian Style

Wang, Yao, Min Zhang, Shuai Dong, Yi-Ling Liu, and Zhen-Hua Li. 2021. "The Opposite Roles of White Light in Regulating Germination of Fresh and Aged Seed in Tobacco" Plants 10, no. 11: 2457. https://doi.org/10.3390/plants10112457

APA Style

Wang, Y., Zhang, M., Dong, S., Liu, Y.-L., & Li, Z.-H. (2021). The Opposite Roles of White Light in Regulating Germination of Fresh and Aged Seed in Tobacco. Plants, 10(11), 2457. https://doi.org/10.3390/plants10112457

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop