Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses
Abstract
:1. Introduction
2. Results
2.1. Identification of LpHsp90 Genes in Perennial Ryegrass
2.2. Phylogenetic Analysis and Multiple Sequence Alignment
2.3. Conserved Motif and Gene Structure Analysis of LpHsp90 Proteins
2.4. Expression Profile of LpHsp90 in Response to Abiotic Stresses
3. Discussion
4. Materials and Methods
4.1. Identification of LpHsp90 Genes in Perennial Ryegrass
4.2. Phylogenetic Analysis and Multiple Sequence Alignment
4.3. Exon-Intron Structure, Conserved Motif, Characteristics Analysis of LpHsp90
4.4. Plant Materials, Growth Conditions and Stress Application
4.5. RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR Expression Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xu, Y.; Wang, J.; Bonos, S.A.; Meyer, W.A.; Huang, B. Candidate Genes and Molecular Markers Correlated to Physiological Traits for Heat Tolerance in Fine Fescue Cultivars. Int. J. Mol. Sci. 2018, 19, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, B.; Dacosta, M.; Jiang, Y. Research advances in mechanisms of turfgrass tolerance to abiotic stresses: From physiology to molecular biology. Crit. Rev. Plant Sci. 2014, 3, 141–189. [Google Scholar] [CrossRef]
- Huang, L.; Yan, H.; Jiang, X.; Yin, G.; Zhang, X.; Qi, X.; Zhang, Y.; Yan, Y.; Ma, X.; Peng, Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS ONE 2014, 9, e93724. [Google Scholar]
- Holmes, W.; Robson, M.J.; Parsons, A.J.; Williams, T.E.; Gill, M.; Beever, D.E.; Osbourn, D.F.; Murdoch, J.C.; Nix, J.S.; Green, B.H. Grass: Its production and utilization. N. Z. J. Agric. Res. 2010, 33, 351. [Google Scholar]
- Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef]
- Nakashima, K.; Yamaguchi-Shinozaki, K. Regulons involved in osmotic stress-responsive and cold stress-responsive gene expression in plants. Physiol. Plant. 2006, 126, 62–71. [Google Scholar] [CrossRef]
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought—From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef]
- Bailey-Serres, J.; Voesenek, L. Flooding stress: Acclimations and genetic diversity. Annu. Rev. Plant Biol. 2008, 59, 313–339. [Google Scholar] [CrossRef] [Green Version]
- Norris, I.B. Relationships between growth and measured weather factors among contrasting varieties of Lolium, Dactylis and Festuca species. Grass Forage Sci. 2010, 40, 151–159. [Google Scholar] [CrossRef]
- Ollerenshaw, J.H. Influence of waterlogging on the emergence and growth of Lolium perenne L. shoots from seed coated with calcium peroxide. Plant Soil 1985, 85, 131–141. [Google Scholar] [CrossRef]
- Pearson, A.; Cogan, N.O.I.; Baillie, R.C.; Hand, M.L.; Bandaranayake, C.K.; Erb, S.; Wang, J.; Kearney, G.A.; Gendall, A.R.; Smithet, K.F. Identification of QTLs for morphological traits influencing waterlogging tolerance in perennial ryegrass (Lolium perenne L.). Theor. Appl. Genet. 2011, 122, 609–622. [Google Scholar] [CrossRef]
- Xiong, Y.; Fei, S.Z.; Arora, R.; Brummer, E.C.; Warnke, S.E. Identification of quantitative trait loci controlling winter hardiness in an annual x perennial ryegrass interspecific hybrid population. Mol. Breed. 2007, 19, 125–136. [Google Scholar] [CrossRef]
- Queitsch, C.; Sangster, T.A.; Lindquist, S. Hsp90 as a capacitor of phenotypic variation. Nature 2002, 417, 618–624. [Google Scholar] [CrossRef]
- Robert, J. Evolution of heat shock protein and immunity. Dev. Comp. Immunol. 2003, 27, 449–464. [Google Scholar] [CrossRef]
- Hsu, A.L.; Murphy, C.T.; Kenyon, C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science 2003, 300, 1142–1145. [Google Scholar] [CrossRef] [Green Version]
- Krishna, P. Plant responses to heat stress. In Plant Responses to Abiotic Stress; Topics in Current Genetics; Springer: Berlin/Heidelberg, Germany, 2003; Volume 4, pp. 73–101. [Google Scholar]
- Czar, M.J.; Galigniana, M.D.; Silverstein, A.M.; Pratt, W.B. Geldanamycin, a Heat Shock Protein 90-Binding Benzoquinone Ansamycin, Inhibits Steroid-Dependent Translocation of the Glucocorticoid Receptor from the Cytoplasm to the Nucleus. Biochemistry 1997, 36, 7776–7785. [Google Scholar] [CrossRef]
- Pratt, W.B.; Krishna, P.; Olsen, L.J. Hsp90-binding immunophilins in plants: The protein movers. Trends Plant Sci. 2001, 6, 54–58. [Google Scholar] [CrossRef]
- Lindquist, S. The Heat-Shock Response. Annu. Rev. Biochem. 1986, 55, 1151–1191. [Google Scholar] [CrossRef]
- Iqbal, N.; Farooq, S.; Arshad, R.; Hameed, A. Differential accumulation of high and low molecular weight heat shock proteins in basmati rice (Oryza sativa L.) cultivars. Genet. Resour. Crop. Evol. 2010, 57, 65–70. [Google Scholar] [CrossRef]
- Lindquist, S.; Craig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
- Tapia, H.; Morano, K. Hsp90 nuclear accumulation in quiescence is linked to chaperone function and spore development in yeast. Mol. Biol. Cell 2010, 21, 63–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashemi-petroudi, S.H.; Nematzadeh, G.; Mohammadi, S.; Kuhlmann, M. Analysis of expression pattern of genome and analysis of HSP90 gene family in Aeluropus littoralis under salinity stress. J. Crop. Breed. 2019, 11, 134–143. [Google Scholar] [CrossRef]
- Chaudhary, R.; Baranwal, V.K.; Kumar, R.; Sircar, D.; Chauhan, H. Genome-wide identification and expression analysis of Hsp70, Hsp90, and Hsp100 heat shock protein genes in barley under stress conditions and reproductive development. Funct. Integr. Genom. 2019, 19, 1007–1022. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Gao, T.; Wan, S.; Zhang, Y.; Yang, J.; Yu, Y.; Wang, W. Genome-Wide identification, classification and expression analysis of the HSP gene superfamily in tea plant (Camellia sinensis). Int. J. Mol. Sci. 2018, 19, 2633. [Google Scholar] [CrossRef] [Green Version]
- Zhang, K.; He, S.; Sui, Y.; Gao, Q.; Jia, S.; Lu, X.; Jia, L. Genome-Wide Characterization of HSP90 Gene Family in Cucumber and Their Potential Roles in Response to Abiotic and Biotic Stresses. Front. Genet. 2021, 12, 584886. [Google Scholar] [CrossRef]
- Zhang, Z.; Quick, M.K.; Kanelakis, K.C.; Gijzen, M.; Krishna, P. Characterization of a plant homolog of hop, a cochaperone of hsp90. Plant Physiol. 2003, 131, 525–535. [Google Scholar] [CrossRef] [Green Version]
- Yamano, T.; Mizukami, S.; Murata, S.; Chiba, T.; Tanaka, K.; Udono, H. Hsp90-mediated assembly of the 26 S proteasome is involved in major histocompatibility complex class I antigen processing. J. Biol. Chem. 2008, 283, 28060–28065. [Google Scholar] [CrossRef] [Green Version]
- Feng, J.; Fan, P.; Jiang, P.; Lv, S.; Chen, X.; Li, Y. Chloroplast targeted Hsp90 plays essential roles in plastid development and embryogenesis in Arabidopsis possibly linking with VIPP1. Physiol. Plant. 2014, 150, 292–307. [Google Scholar] [CrossRef]
- Oh, S.E.; Yeung, C.; Babaei-Rad, R.; Zhao, R. Cosuppression of the chloroplast localized molecular chaperone HSP90.5 impairs plant development and chloroplast biogenesis in Arabidopsis. BMC Res. Notes 2014, 7, 643. [Google Scholar] [CrossRef] [Green Version]
- Reddy, R.K.; Chaudhary, S.; Patil, P.; Krishna, P. The 90 kDa heat shock protein (hsp90) is expressed throughout Brassica napus seed development and germination. Plant Sci. 1998, 131, 131–137. [Google Scholar] [CrossRef]
- Sable, A.; Rai, K.M.; Choudhary, A.; Yadav, V.K.; Agarwal, S.K.; Sawant, S.V. Inhibition of heat shock proteins HSP90 and HSP70 induce oxidative stress, suppressing cotton fiber development. Sci. Rep. 2018, 8, 3620. [Google Scholar] [CrossRef]
- Hoffmann, T.; Hovemann, B. Heat-shock proteins, Hsp84 and Hsp86, of mice and men: Two related genes encode formerly identified tumour-specific transplantation antigens. Gene 1988, 74, 491–501. [Google Scholar] [CrossRef]
- Rebbe, N.F.; Ware, J.; Bertina, R.M.; Modrich, P.; Stafford, D.W. Nucleotide sequence of a cDNA for a member of the human 90-kDa heat-shock protein family. Gene 1987, 53, 235–245. [Google Scholar] [CrossRef]
- Krone, P.H.; Sass, J.B. Hsp 90α and Hsp 90β genes are present in the zebrafish and are differentially regulated in developing embryos. Biochem. Biophys. Res. Commun. 1994, 204, 746–752. [Google Scholar] [CrossRef]
- Chen, B.; Zhong, D.; Monteiro, A. Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms. BMC Genom. 2006, 7, 156. [Google Scholar] [CrossRef] [Green Version]
- Song, H.; Fan, P.; Li, Y. Overexpression of organellar and cytosolic AtHSP90 in Arabidopsis thaliana impairs plant tolerance to oxidative stress. Plant Mol. Biol. Rep. 2009, 27, 342–349. [Google Scholar] [CrossRef]
- Hu, W.; Hu, G.; Han, B. Genome-wide survey and expression profiling of heat shock proteins and heat shock factors revealed overlapped and stress specific response under abiotic stresses in rice. Plant Sci. 2009, 176, 583–590. [Google Scholar] [CrossRef]
- Krishna, P.; Gloor, G. The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones 2001, 6, 238–246. [Google Scholar] [CrossRef]
- Yang, X.; Zhu, W.; Zhang, H.; Liu, N.; Tian, S. Heat shock factors in tomatoes: Genome-wide identification, phylogenetic analysis and expression profiling under development and heat stress. PeerJ 2016, 4, e1961. [Google Scholar] [CrossRef] [Green Version]
- Yamada, K.; Fukao, Y.; Hayashi, M.; Fukazawa, M.; Nishimura, M. Cytosolic HSP90 regulates the heat shock response that is responsible for heat acclimation in Arabidopsis thaliana. J. Biol. Chem. 2007, 282, 37794–37804. [Google Scholar] [CrossRef] [Green Version]
- McLellan, C.A.; Turbyville, T.J.; Wijeratne, E.M.K.; Kerschen, A.; Vierling, E.; Queitsch, C.; Whitesell, L.; Gunatilaka, A.A.L. A rhizosphere fungus enhances Arabidopsis thermotolerance through production of an HSP90 inhibitor. Plant Physiol. 2007, 145, 174–182. [Google Scholar] [CrossRef]
- Takahashi, A.; Casais, C.; Ichimura, K.; Shirasu, K. HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2003, 100, 11777–11782. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Burch-Smith, T.; Schiff, M.; Feng, S.; Dinesh-Kumar, S.P. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J. Biol. Chem. 2004, 279, 2101–2108. [Google Scholar] [CrossRef]
- Tominaga, H.; Coury, D.A.; Amano, H.; Miki, W.; Kakinuma, M. cDNA cloning and expression analysis of two heat shock protein genes, Hsp90 and Hsp60, from a sterile Ulva pertusa (Ulvales, Chlorophyta). Fish. Sci. 2012, 78, 415–429. [Google Scholar] [CrossRef]
- Sołtys-Kalina, D.; Szajko, K.; Sierocka, I.; Śliwka, J.; Strzelczyk-Żyta, D.; Wasilewicz-Flis, I.; Jakuczun, H.; Szweykowska-Kulinska, Z.; Marczewski, W. Novel candidate genes AuxRP and Hsp90 influence the chip color of potato tubers. Mol. Breed. 2015, 35, 224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manchado, M.; Salas-Leiton, E.; Infante, C.; Ponce, M.; Asensio, E.; Crespo, A.; Zuasti, E.; Cañavate, J.P. Molecular characterization, gene expression and transcriptional regulation of cytosolic Hsp90s in the flatfish Senegalese sole (Solea senegalensis Kaup). Gene 2008, 416, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Galea-Lauri, J.; Latchman, D.S.; Katz, D.R. The role of the 90-kDa heat shock protein in cell cycle control and differentiation of the monoblastoid cell line U937. Exp. Cell Res. 1996, 226, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, L.; Ye, T.; Chen, R.; Gao, X.; Xu, Z. Molecular characterization, expression pattern and function analysis of the OsHSP90 family in rice. Biotechnol. Biotechnol. Equip. 2016, 30, 669–676. [Google Scholar] [CrossRef] [Green Version]
- Bai, J.; Pennill, L.A.; Ning, J.; Lee, S.W.; Ramalingam, J.; Webb, C.A.; Zhao, B.; Sun, Q.; Nelson, J.C.; Leach, J.E.; et al. Diversity in nucleotide binding site-leucine-rich repeat genes in cereals. Genome Res. 2002, 12, 1871–1884. [Google Scholar] [CrossRef] [Green Version]
- Han, Y.; Chen, Y.; Yin, S.; Zhang, M.; Wang, W. Over-expression of TaEXPB23, a wheat expansin gene, improves oxidative stress tolerance in transgenic tobacco plants. J. Plant Physiol. 2015, 173, 62–71. [Google Scholar] [CrossRef]
- Chory, J.; Wu, D. Weaving the Complex Web of Signal Transduction. Plant Physiol. 2001, 125, 77–80. [Google Scholar] [CrossRef] [Green Version]
- Mach, J. Alternative splicing produces a JAZ protein that is not broken down in response to jasmonic acid. Plant Cell 2009, 21, 14. [Google Scholar] [CrossRef] [Green Version]
- Al-Whaibi, M.H. Plant heat-shock proteins: A mini review. J. King Saud Univ. Sci. 2011, 23, 139–150. [Google Scholar] [CrossRef] [Green Version]
- Genest, O.; Wickner, S.; Doyle, S.M. Hsp90 and Hsp70 chaperones: Collaborators in protein remodeling. J. Biol. Chem. 2019, 294, 2109–2120. [Google Scholar] [CrossRef] [Green Version]
- Milioni, D.; Hatzopoulos, P. Genomic organization of Hsp90 gene family in Arabidopsis. Plant Mol. Biol. 1997, 35, 955–961. [Google Scholar] [CrossRef]
- Ritossa, F. A new puffing pattern induced by temperature shock and DNP in drosophila. Experientia 1962, 18, 571–573. [Google Scholar] [CrossRef]
- Cha, J.; Ahn, G.; Kim, J.Y.; Kang, S.B.; Kim, M.R.; Su’udi, M.; Kim, W.Y.; Son, D. Structural and functional differences of cytosolic 90-kDa heat-shock proteins (Hsp90s) in Arabidopsis thaliana. Plant Physiol. Biochem. 2013, 70, 368–373. [Google Scholar] [CrossRef] [Green Version]
- Jackson, S.E.; Queitsch, C.; Toft, D. Hsp90: From structure to phenotype. Nat. Struct. Mol. Biol. 2004, 11, 1152–1155. [Google Scholar] [CrossRef]
- Shinozaki, F.; Minami, M.; Chiba, T.; Suzuki, M.; Yoshimatsu, K.; Ichikawa, Y.; Terasawa, K.; Emori, Y.; Matsumoto, K.; Kurosaki, T.; et al. Depletion of hsp90beta induces multiple defects in B cell receptor signaling. J. Biol. Chem. 2006, 281, 16361–16369. [Google Scholar] [CrossRef] [Green Version]
- Rehn, A.; Moroni, E.; Zierer, B.K.; Tippel, F.; Morra, G.; John, C.; Richter, K.; Colombo, G.; Buchner, J. Allosteric Regulation Points Control the Conformational Dynamics of the Molecular Chaperone Hsp90. J. Mol. Biol. 2016, 428, 4559–4571. [Google Scholar] [CrossRef]
- Zhang, J.; Li, J.; Liu, B.; Zhang, L.; Chen, J.; Lu, M. Genome-wide analysis of the Populus Hsp90 gene family reveals differential expression patterns, localization, and heat stress responses. BMC Genom. 2013, 14, 532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, Z.; Pan, F.; Yang, C.; Jia, H.; Jiang, H.; He, F.; Li, N.; Lu, X.; Zhang, H. Genome-wide identification and expression analysis of HSP90 gene family in Nicotiana tabacum. BMC Genet. 2019, 20, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zai, W.S.; Miao, L.X.; Xiong, Z.L.; Zhang, H.L.; Ma, Y.R.; Li, Y.L.; Chen, Y.B.; Ye, S.G. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum. Genet. Mol. Res. 2015, 14, 7811–7820. [Google Scholar] [CrossRef] [PubMed]
- Kawahara, Y.; de la Bastide, M.; Hamilton, J.P.; Kanamori, H.; McCombie, W.R.; Ouyang, S.; Schwartz, D.C.; Tanaka, T.; Wu, J.; Zhou, S.; et al. Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 2013, 6, 4. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Wan, H.; Yang, Y.; Wei, Y.; Li, Z.; Ye, Q.; Wang, R.; Ruan, M.; Yao, Z.; Zhou, G. Genome-wide identification and analysis of heat shock protein 90 in tomato. Yi Chuan 2014, 36, 1043–1052. [Google Scholar]
- Jain, M.; Tyagi, A.K.; Khurana, J.P. Genome-wide analysis, evolutionary expansion, and expression of early auxin-responsive SAUR gene family in rice (Oryza sativa). Genomics 2006, 88, 360–371. [Google Scholar] [CrossRef] [Green Version]
- Skolnick, J.; Fetrow, J.S. From genes to protein structure and function: Novel applications of computational approaches in the genomic era. Trends Biotechnol. 2000, 18, 34–39. [Google Scholar] [CrossRef]
- Singh, R.K.; Lee, J.K.; Selvaraj, C.; Singh, R.; Li, J.; Kim, S.Y.; Kalia, V.C. Protein Engineering Approaches in the Post-Genomic Era. Curr. Protein Pept. Sci. 2018, 19, 5–15. [Google Scholar] [CrossRef]
- Jin, Z.; Chandrasekaran, U.; Liu, A. Genome-wide analysis of the Dof transcription factors in castor bean (Ricinus communis L.). Genes Genom. 2014, 36, 527–537. [Google Scholar] [CrossRef]
- Byrne, S.L.; Nagy, I.; Pfeifer, M.; Armstead, I.; Asp, T. A synteny-based draft genome sequence of the forage grass Lolium perenne. Plant J. 2015, 84, 816–826. [Google Scholar] [CrossRef]
- Larkin, M.A. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
- Guidon, S.; Gascuel, O. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Hu, B.; Jin, J.; Guo, A.Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2014, 31, 1296–1297. [Google Scholar] [CrossRef] [Green Version]
- Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
Gene | Molecular Weight | Theoretical pI | Number of Amino Acids | Instability Index | Predicted Sub-Cellular Location |
---|---|---|---|---|---|
LpHsp90-1 | 80,409.24 | 4.96 | 700 | 41.43 | Cytoplasmic |
LpHsp90-2 | 89,044.8 | 5.19 | 787 | 43.15 | Cytoplasmic |
LpHsp90-3 | 80,947.92 | 4.95 | 710 | 40.22 | Cytoplasmic |
LpHsp90-4 | 96,712.15 | 5.57 | 862 | 43.84 | Nuclear |
LpHsp90-5 | 61,214.61 | 5.08 | 528 | 44.14 | Cytoplasmic |
LpHsp90-6 | 92,834.85 | 4.89 | 809 | 37.71 | Endoplasmic reticulum |
LpHsp90-7 | 88,305.63 | 4.9 | 779 | 47.45 | Cytoplasmic |
LpHsp90-8 | 88,305.63 | 4.9 | 779 | 47.4 | Cytoplasmic |
Gene | Forward-Primer (5′-3′) | Reverse-Primer (5′-3′) |
---|---|---|
Lphsp90-1 | ATCGTCTCTGACCGTGTTGT | AAGCATCACCAGGTCCTTGA |
Lphsp90-2 | GCACACTTCACAACAGAGGG | CTCGCCATCAAAGTCATCCG |
Lphsp90-3 | CATCATGGACAACTGCGAGG | GGCGTAGTCCTCCTTGTTCT |
Lphsp90-4 | AGGAGGTGTTTCTTCGGGAG | TGCAATGGTCCCAAGAGAGT |
Lphsp90-5 | TCGGAGTTCATCAGCTACCC | GCTCACCTCCTTCACCTTCT |
Lphsp90-6 | GCAAGGACTCGAAGCTCAAG | TTGATCTCCAGGACACGCTT |
Lphsp90-7 | GCCAATTGATGAGGTTGCCA | TCGCAGACCAACCAAACTTG |
Lphsp90-8 | GCGGAGGAGAAGTTCGAGTA | CATCCCAATGCCAGTGTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Appiah, C.; Yang, Z.-F.; He, J.; Wang, Y.; Zhou, J.; Xu, W.-Z.; Nie, G.; Zhu, Y.-Q. Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses. Plants 2021, 10, 2509. https://doi.org/10.3390/plants10112509
Appiah C, Yang Z-F, He J, Wang Y, Zhou J, Xu W-Z, Nie G, Zhu Y-Q. Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses. Plants. 2021; 10(11):2509. https://doi.org/10.3390/plants10112509
Chicago/Turabian StyleAppiah, Charlotte, Zhong-Fu Yang, Jie He, Yang Wang, Jie Zhou, Wen-Zhi Xu, Gang Nie, and Yong-Qun Zhu. 2021. "Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses" Plants 10, no. 11: 2509. https://doi.org/10.3390/plants10112509