Physiological and Molecular Mechanisms of ABA and CaCl2 Regulating Chilling Tolerance of Cucumber Seedlings
Abstract
:1. Introduction
2. Results
2.1. Effects of Single and Combined Treatments on Phenoypes of Cucumber Seedlings under Low-Temperature Stress
2.2. Effects of Single and Combined Treatments on Chilling Injury Index and Relative Electrical Conductivity of Leaves under Low-Temperature Stress
2.3. Effects of Single and Combined Treatments on Antioxidant Enzyme Activities and MDA Content of Cucumber Seedlings under Low-Temperature Stress
2.4. Effects of Single and Combined Treatments on Leaf Anatomical Structure of Cucumber Seedlings under Low-Temperature Stress
2.5. Effects of Single and Combined Treatments on Leaf Tissue Thickness under Low-Temperature Stress
2.6. Effects of Single and Combined Treatments on the Expression of Antioxidant Enzyme Gene under Low-Temperature Stress
2.7. Quality Assessment of Sequencing Data
2.8. Analysis of Differentially Expressed Genes
2.9. GO Classification Analysis of Differentially Expressed Genes
2.10. Enrichment Analysis of Differentially Expressed Genes, KEGG
2.11. Quantitative qRT-PCR Verification
3. Discussion
4. Materials and Methods
4.1. Test Materials and Growth Conditions
4.2. Experimental Design
4.2.1. Single Treatment Concentration Screening of ABA and CaCl2
4.2.2. Combined Treatment Concentration Screening of ABA and CaCl2
4.2.3. Effects of Single and Combined Treatments on Chilling Resistance
4.3. Determination Indexes and Methods
4.3.1. Determination of Chilling Injury Index
4.3.2. Determination of Relative Electrical Conductivity
4.3.3. Determination of MDA Content and Antioxidant Enzyme Activity
4.3.4. Observation of Paraffin Sections of Cucumber Leaves
4.3.5. RNA-Seq Method
4.3.6. Real-Time Quantitative PCR
4.4. Data Processing
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- An, Z.-X.; Meng, Q.-L.; Liu, W.-M. Primary study on origin and propagation of Cucumis sativus L. J. Chang. Veg. 2006, 1, 39–40. [Google Scholar]
- Thomashow, M.F. Molecular basis of plant cold acclimation: Insights gained from studying the CBF cold response pathway. J. Plant Physiol. 2010, 154, 571–577. [Google Scholar] [CrossRef] [Green Version]
- Li, C.-X.; Dong, S.Y.; Bo, K.-L.; Miao, H.; Zhang, S.-P.; Gu, X.-F. Research progress in physiological and mechanism of low temperature stress response in cucumber. China Veg. 2019, 5, 17–24. [Google Scholar]
- Wang, Y.-J.; Zhang, F.; Xu, Y. Study on the mechanism and its application for tolerance ability to low temperature and poor light on cucumber. China Veg. 2005, s1, 7–12. [Google Scholar]
- Sakina, A.; Wani, W.; Mushtaq, M.; Wani, S.H.; Shikari, A.B. Omics approaches for cold stress tolerance in plants. In Recent Approaches in Omics for Plant Resilience to Climate Change; Springer: Cham, Switzerland, 2019; pp. 331–356. [Google Scholar]
- Adams, W.W.; Stewart, J.J.; Cohu, C.M.; Onno, M.; Barbara, D.A. Habitat temperature and precipitation of Arabidopsis thaliana ecotypes determine the response of foliar vasculature, photosynthesis, and transpiration to growth temperature. Front. Plant Sci. 2016, 7, 1026–1048. [Google Scholar] [CrossRef] [Green Version]
- Wei, L.-J.; Deng, X.-G.; Zhu, T.; Zheng, T.; Li, P.-X.; Wu, J.-Q.; Zhang, D.-W.; Lin, H.-H. Ethylene is involved in brassinosteroids induced alternative respiratory pathway in cucumber seedlings response to abiotic stress. Front. Plant Sci. 2015, 6, 982. [Google Scholar] [CrossRef] [Green Version]
- Shu, S.; Tang, Y.; Yuan, Y.; Sun, J.; Zhong, M.; Guo, S. The role of 24-epibrassinolide in the regulation of photosynthetic characteristics and nitrogen metabolism of tomato seedlings under a combined low temperature and weak light stress. Plant Physiol. Biochem. 2016, 107, 344–353. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.-F.; Li, X.-X.; Dong, H.-X.; Wang, H.-P.; Song, J.-P.; Qiu, Y.; Zhang, X.-H.; Shen, D. Cold tolerance identification at germination stage of cucumber core germplasm. J. Plant Genet. Resour. 2016, 17, 6–12. [Google Scholar]
- Li, S.-J.; Ding, Y.-Y.; Cheng, Z.-H. Research progress on cucumber cold and wet tolerance and its identification. China Veg. 2020, 6, 23–30. [Google Scholar]
- Dong, S.-Y.; Wang, W.-P.; Bo, K.-L.; Miao, H.; Song, Z.-C.; Wei, S.; Zhang, S.-P.; Gu, X.-F. Quantitative trait loci mapping and candidate gene analysis of low temperature tolerance in cucumber seedlings. Front. Plant Sci. 2019, 10, 1620. [Google Scholar] [CrossRef]
- Zhang, X.-W.; Liu, F.-J.; Zhai, J.; Li, F.-D.; Ai, X.-Z. Auxin acts as a downstream signaling molecule involved in hydrogen sulfide-induced chilling tolerance in cucumber. Planta 2020, 251, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.H.; Li, P.H.; Brenner, M.-L. Involvement of abscisic acid in potato cold acclimation. J. Plant Physiol. 1983, 71, 362–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, J.; Cang, J.; Lu, Q.; Fan, B.; Wang, X. Aba enhanced cold tolerance of wheat ‘dn1’ via increasing ros scavenging system. Plant Signal. Behav. 2020, 15, 1780403. [Google Scholar] [CrossRef]
- Huang, Y.; Lin, Z.-Y.; Rong, J.-D.; Chen, L.-G.; Zheng, Y.-S. Effects of exogenous abscisic acid (ABA) on the photosynthesis and chlorophyll fluorescence parameters of Tripterygium wilfordii seedlings exposed to low temperature. Chin. J. Appl. Ecol. 2011, 22, 3150–3156. [Google Scholar]
- Carpaneto, A.; Ivashikina, N.; Levchenko, V.; Krol, E.; Jeworutzki, E.; Zhu, J.-K.; Hedrich, R. Cold transiently activates calcium permeable channels in Arabidopsis mesophyll cells. J. Plant Physiol. 2007, 143, 487–494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, J.-K.; Zhu, X.-X.; Hu, X.-Y.; Ma, Y.; Zhao, K.; Yang, L. Physiological responses of cotton seedlings to exogenous calcium under low temperature stress. Acta Agric. Boreali-Occident. Sin. 2013, 22, 60–64. [Google Scholar]
- Zhou, F.; Zhao, Y.-X.; Wang, W.-Y.; Li, X.-F.; Wang, L.-Q. Effects of calcium on growth of winter wheat seedlings and nutrient uptake under partial-root water stress. Agric. Res. Arid Areas 2015, 33, 7. [Google Scholar]
- He, X.-R.; Chen, J.; Hu, D.; Yang, S.; Wang, D.; Xie, Q.J. Effects of CaCl2 solution treatment on cold resistance of Machilus chienkweiensis seedlings. Yangtze Univ. 2019, 16, 75–78+87. [Google Scholar]
- Shi, H.; Ye, T.; Ba, O.Z.; Liu, X.; Chan, Z. Comparative proteomic and metabolomic analyses reveal mechanisms of improved cold stress tolerance in bermudagrass (cynodon dactylon (l.) pers.) by exogenous calcium. J. Integr. Plant Biol. 2015, 11, 1064–1079. [Google Scholar] [CrossRef] [PubMed]
- Anwar, A.; Yan, Y.; Liu, Y.; Li, Y.; Yu, X. 5-Aminolevulinic acid improves nutrient uptake and endogenous hormone accumulation, enhancing low-temperature stress tolerance in cucumbers. Int. J. Mol. Sci. 2018, 19, 3379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, A.-M.; Zhou, G.-S.; Fu, L.-J.; Li, J.; Lu, Q.; Ren, R.-X. Effects of brassinosteroids on seed germination and seedling growth of cucumber under low temperature stress. China Cucurbits Veg. 2019, 32, 31–36. [Google Scholar]
- Zhang, Z.-Z.; Zhang, X.; Zhang, Y.; Chen, J.-Y.; Mu, X.-N. Study on effects of low temperature stress on leaf structure of eggplant seedlings. J. Sci. Teach. Coll. Univ. 2021, 41, 5. [Google Scholar]
- Rakei, A.; Maali-Amiri, R.; Zeinali, H.; Ranjbar, M. DNA methylation and physio-biochemical analysis of chickpea in response to cold stress. Protoplasma 2016, 253, 61–76. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Liang, D.-Y.; Pei, X.-N.; Zhang, Q.-H.; Zhang, P.; Zhang, J.-Q.; Lu, Z.-M.; Yang, Y.-C.; Liu, G.-F.; Zhao, X.-Y. Study on the physiological indices of Pinus sibirica and Pinus koraiensis seedlings under cold stress. J. For. Res. 2019, 30, 1255–1265. [Google Scholar] [CrossRef]
- Cho, U.H.; Park, J.O. Mercury-induced oxidative stress in tomato seedings. Plant Sci. 2000, 156, 1–9. [Google Scholar] [CrossRef]
- Hernández, J.A.; Ferrer, M.A.; Jiménez, A.; Barceló, A.R.; Sevilla, F. Antioxidant systems and O2−/H2O2 production in the apoplast of pea leaves. Its relation with salt-induced necrotic lesions in minor veins. J. Plant Physiol. 2001, 127, 817–831. [Google Scholar] [CrossRef]
- Huang, Y.-C.; Qin, Y.-X. Advances on reactive oxygen species in plants. Chin. Agric. Sci. Bull. 2012, 28, 219–226. [Google Scholar]
- Liu, X.-L.; Zhang, H.; Jin, Y.-Y.; Wang, M.-M.; Yang, H.-Y.; Ma, H.-Y.; Jiang, C.-J.; Liang, Z.-W. Abscisic acid primes rice seedlings for enhanced tolerance to alkaline stress by upregulating antioxidant defense and stress tolerance-related genes. Plant Soil 2019, 438, 39–55. [Google Scholar] [CrossRef]
- Gao, J.-C.; Wang, C.-Z.; Wang, J.-G.; Li, X.-X.; Gao, W.-H.; Li, X.-G. Determination methods of cold resistance of chinese jujube. J. Northwest For. Univ. 2011, 26, 72–75. [Google Scholar]
- Zhang, Q.; Wang, J.-Y.; Dong, Y.-L.; Xiao, X.-T.; Zhang, M.; Chen, T.-C.; Wu, Y.-Y. The vital roles of abscisic acid signal transduction pathway in response to abiotic stress in plants. Chem. Life 2021, 41, 06. [Google Scholar]
- Duan, S.-Y.; Wang, M.-L.; Zhang, X.-C.; Gu, J.-T. Effects of exogenous abscisic acid, salicylic acid and gibberellin on chilling resistance of tomato seedlings. J. Beijing Univ. Agric. 2020, 35, 50–56. [Google Scholar]
- Liu, L.-J.; Cang, J.; Li, H.-W.; Yu, J.; Wang, X.; Wang, J.-F.; Huang, R.; Xu, C. Effects of exogenous abscisic acid on key enzymes of respiratory metabolism and sugar metabolism of winter wheat in the wintering period. J. Triticeae Crop. 2013, 1, 71–78. [Google Scholar]
- Xu, S.-S.; Shi, X.-Y.; Li, Q. Effects of exogenous ABA on chilling resistance of pepper seedlings. J. Changjiang Veg. 2015, 398, 55–58. [Google Scholar]
- Zhang, Y.; Jiang, W.-J.; Yu, H.-J.; Yang, X.-Y. Exogenous abscisic acid alleviates low temperature-induced oxidative damage in seedlings of Cucumis sativus.L. Trans. Chin. Soc. Agric. Eng. 2012, 28, 221–228. [Google Scholar]
- Wang, L.-R.; Xue, Y.-Z.; Chang, M.-H.; Wang, L. Effects of exogenous hormones on cold resistant physiological index of kernel apricot. J. Nucl. Agric. Sci. 2016, 30, 396–403. [Google Scholar]
- Umezawa, T.; Nakashima, K.; Miyakawa, T.; Kuromori, T.; Tanokura, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Molecular basis of the core regulatory network in ABA responses: Sensing, signaling and transport. Plant Cell Physiol. 2010, 51, 1821–1839. [Google Scholar] [CrossRef]
- Tian, X.-J.; Wang, Z.-Y.; Li, X.-F.; Lü, T.-X.; Liu, H.-Z.; Wang, L.-Z.; Niu, H.-B.; Bu, Q.-Y. Characterization and functional analysis of pyrabactin resistance-like abscisic acid receptor family in rice. Rice 2015, 8, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Hu, W.; Yan, Y.; Shi, H.-T.; Liu, J.-H.; Miao, H.-X.; Tie, W.-W.; Ding, Z.-H.; Ding, X.-P.; Wu, C.-L.; Liu, Y.; et al. The core regulatory network of the abscisic acid pathway in banana: Genome-wide identification and expression analyses during development, ripening, and abiotic stress. BMC Plant Biol. 2017, 17, 145. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.-F.; Mo, L.-L.; Niu, Y.-F.; Peng, S.-J.; Wang, D.-K.; Geng, K.-Y. Physiological mechanism of exogenous betaine and calcium chloride on improving cold tolerance in duranta repens. North Hortic. 2016, 359, 162–167. [Google Scholar]
- Zhang, L.; Wang, J.-C.; Zuo, Q.; Xiao, Q.; Gu, J.-L. Study on effect of Ca on low temperature stress tomato seedling physiological index and membrane system. North Hortic. 2011, 12, 24–26. [Google Scholar]
- Plieth, C. Temperature Sensing by Plants: Calcium-Permeable Channels as Primary Sensors—A Model. J. Membr. Biol. 1999, 172, 121–127. [Google Scholar] [CrossRef]
- Tang, K.-Q.; Liu, S.-W.; Wu, F.-Z.; Zhao, Q. Effect of exogenous CaCl2 on the cold resistance and blossom and tomato under cold stress. North Hortic. 2013, 11, 10–14. [Google Scholar]
- Alcázar, R.; Altabella, T.; Marco, F.; Bortolotti, C.; Reymond, M.; Koncz, C.; Carrasco, P.; Tiburcio, A.F. Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance. Planta 2010, 231, 1237–1249. [Google Scholar] [CrossRef]
- Liu, T.-T. Effects of Treatment of Exogenous Substances on Cold Resistance of Cucumber Seedlings; Northeast Agricultural University: Harbin, China, 2016. [Google Scholar]
- Zhang, Z.-G.; Shang, Q.-M.; Dong, T. Studies on the effect of SA and CaCl2 mixture on induced resistance to cucumber seedling under compound stress. J. Inn. Mong. Agric. Univ. 2007, 28, 6. [Google Scholar]
- Liu, W. Effect of Salicylic Acid and Calcium on Tolerance to Low Temperature and Light Intensity in Cucumber Seedlings; Shandong Agricultural University: Tai’an, China, 2009. [Google Scholar]
- Oláh, C.; Ludmerszki, E.; Rácz, I.; Balassa, G.; Rudnóy, S. S-methylmethionine-salicylate pretreatment reduces low temperature stress in maize. Russ. J. Plant Physiol. 2018, 65, 63–68. [Google Scholar] [CrossRef]
- Xiao, Y.-J.; Li, Z.-M.; Yi, P.-F.; Hu, R.-S.; Zhang, X.-W.; Zhu, L.-S. Research progress on response mechanism of transcription factors involved in plant cold stress. Biotechnol. Bull. 2018, 34, 1–9. [Google Scholar]
- Dong, C.-J.; Cao, N.; Shang, Q.-M. Effects of salicylic acid on fatty acid compositions in the roots of cucumber seedlings under low temperature. Acta Hortic. Sin. 2017, 44, 1319–1326. [Google Scholar]
- Li, D.-D.; Zhang, X.-W.; Liu, F.-J.; Pan, D.-Y.; Ai, X.-Z. Hydrogen sulfide interacting with abscisic acid counteracts oxidative damages against chilling stress in cucumber seedlings. Acta Hortic. Sin. 2018, 45, 2395–2406. [Google Scholar]
- Wu, G.-X.; Li, S.-L.; Li, Y.; Li, Y.-M.; Bi, H.-G.; Ai, X.-Z. Effects of hydrogen sulfide, nitric oxide and their interaction on photosynthesis of cucumber seedlings under chilling stress. Plant Physiol. Commun. 2020, 56, 2221–2232. [Google Scholar]
- Yu, X.-C.; Xing, Y.-X.; Ma, H.; Wei, M. Effect of different rootstocks and scions on chilling tolerance in grafted cucumber seedlings. Sci. Agric. Sin. 1998, 2, 41–47. [Google Scholar]
- Jiang, M.; Zhang, J. Effect of Abscisic Acid on Active Oxygen Species, Antioxidative Defence System and Oxidative Damage in Leaves of Maize Seedlings. Plant Cell Physiol. 2001, 42, 1265–1273. [Google Scholar] [CrossRef] [PubMed]
- Lu, F.-S. Effect of Drought Stress on Physiological Indexes and Structure in Leaves of Potato (Solanum tuberosum L.); Northeast Agricultural University: Harbin, China, 2013. [Google Scholar]
Treatments | Upper Epidermal | Lower Epidermal | Palisade Tissue Cells | Spongy Tissue Cells | Thickness of Leaf |
---|---|---|---|---|---|
CK0 | 9.54 ± 1.30 a | 7.11 ± 0.62 a | 19.81 ± 2.16 b | 44.35 ± 6.15 a | 78.20 ± 2.10 b |
CK | 6.64 ± 1.57 b | 6.36 ± 0.54 a | 13.76 ± 0.88 c | 27.88 ± 6.90 b | 55.18 ± 11.43 c |
E1 | 8.68 ± 1.85 ab | 6.87 ± 1.42 a | 17.62 ± 2.31 b | 43.08 ± 5.78 a | 77.77 ± 10.48 b |
E2 | 10.53 ± 1.34 a | 8.56 ± 0.31 b | 25.07 ± 1.93 a | 48.23 ± 0.80 a | 96.21 ± 1.64 a |
E3 | 8.83 ± 0.73 ab | 6.85 ± 0.35 a | 19.52 ± 1.54 b | 41.46 ± 0.10 a | 75.95 ± 3.20 b |
Samples | Total Reads | Clean Reads | Clean Bases | GC Content | % ≥ Q30 | Mapped Reads | Uniq Mapped Reads | Multiple Map Reads | Reads Map to ‘+’ | Reads Map to ‘−’ |
---|---|---|---|---|---|---|---|---|---|---|
CK-1 | 44,618,310 | 22,309,155 | 6,670,561,854 | 45.07% | 92.95% | 42,447,730 (95.14%) | 41,467,828 (92.94%) | 979,902 (2.20%) | 21,163,186 (47.43%) | 21,160,656 (47.43%) |
CK-2 | 49,222,556 | 24,611,278 | 7,342,704,106 | 45.46% | 93.19% | 47,198,149 (95.89%) | 46,176,017 (93.81%) | 1,022,132 (2.08%) | 23,486,116 (47.71%) | 23,516,941 (47.78%) |
CK-3 | 47,991,182 | 23,995,591 | 7,161,992,462 | 45.40% | 93.39% | 46,006,438 (95.86%) | 44,979,931 (93.73%) | 1,026,507 (2.14%) | 22,862,658 (47.64%) | 22,925,469 (47.77%) |
E1-1 | 46,593,340 | 23,296,670 | 6,962,313,210 | 44.52% | 93.63% | 44,751,389 (96.05%) | 43,819,837 (94.05%) | 931,552 (2.00%) | 22,278,382 (47.81%) | 22,300,619 (47.86%) |
E1-2 | 41,426,060 | 20,713,030 | 6,191,201,142 | 44.54% | 93.54% | 39,811,450 (96.10%) | 38,945,058 (94.01%) | 866,392 (2.09%) | 19,785,979 (47.76%) | 19,820,662 (47.85%) |
E1-3 | 47,878,380 | 23,939,190 | 7,158,833,810 | 44.56% | 93.57% | 45,923,173 (95.92%) | 44,898,067 (93.78%) | 1,025,106 (2.14%) | 22,858,624 (47.74%) | 22,869,652 (47.77%) |
E2-1 | 61,136,178 | 30,568,089 | 9,125,858,838 | 45.17% | 93.70% | 58,691,249 (96.00%) | 57,195,375 (93.55%) | 1,495,874 (2.45%) | 29,188,498 (47.74%) | 29,248,521 (47.84%) |
E2-2 | 39,594,192 | 19,797,096 | 5,917,625,040 | 45.23% | 93.61% | 38,070,280 (96.15%) | 37,202,631 (93.96%) | 867,649 (2.19%) | 18,922,921 (47.79%) | 18,960,436 (47.89%) |
E2-3 | 38,751,786 | 19,375,893 | 5,792,658,928 | 45.03% | 93.40% | 36,989,221 (95.45%) | 36,190,762 (93.39%) | 798,459 (2.06%) | 18,380,305 (47.43%) | 18,422,299 (47.54%) |
E3-1 | 46,552,240 | 23,276,120 | 6,950,477,954 | 44.87% | 93.09% | 44,571,839 (95.75%) | 43,602,148 (93.66%) | 969,691 (2.08%) | 22,165,634 (47.61%) | 22,194,830 (47.68%) |
E3-2 | 46,518,224 | 23,259,112 | 6,948,491,590 | 44.74% | 94.03% | 44,610,658 (95.90%) | 43,662,215 (93.86%) | 948,443 (2.04%) | 22,228,239 (47.78%) | 22,246,386 (47.82%) |
E3-3 | 39,071,642 | 19,535,821 | 5,825,747,050 | 44.53% | 93.47% | 37,427,027 (95.79%) | 36,655,676 (93.82%) | 771,351 (1.97%) | 18,634,330 (47.69%) | 18,656,942 (47.75%) |
Gene ID | p-Value | log2 Fold Change | Regulation | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|---|---|---|
Csa6G486930 | 2.50 × 10−12 | 1.58103343 | up | GGCTCAGTCTCTGGTTGCTT | GGTCACACTCACTGGTCACA |
Csa3G127780 | 1.39 × 10−6 | 1.715534501 | up | AGGAGGTTCATCCATGCCAA | GGCATTGTCATCAGTGGGTG |
Csa1G445860 | 3.30 × 10−22 | −3.093382086 | down | TTCCCAGAGCTTCTTTCCCG | GCTAGAATGCTTTGGGCGTG |
Csa6G522690 | 2.64 × 10−15 | −2.402005435 | down | AGTTGAAGAATGGAAGGTTGGC | GCCAAGTTTTCCAAAGGACCC |
Csa6G483300 | 6.61 × 10−13 | −1.52695047 | down | TCTCCTGGGGTTGTGGGTTA | GCAGTCCTCCTTCCATCGTT |
Actin | / | / | / | TTCTGGTGATGGTGTGAGTC | GGCAGTGGTGGTGAACATG |
Gene ID | p-Value | log2 Fold Change | Regulation | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|---|---|---|
Csa2G258690 | 0.013669262 | −1.744223754 | down | AGCTGCCAAGCAAGTTCTCA | TTCTGTCGGTTTCTCCCACG |
Csa7G062810 | 0.010998375 | −1.612041763 | down | AGCAACCATCTGTCTGGCTC | TCTCTTTTGGCAGCACACCA |
Csa1G589140 | 0.008039942 | −1.594646598 | down | ATGGAAGGCAACACCCAGTT | CATTCTCCTGCTCTTTAACACCT |
Csa3G357110 | 8.40 × 10−5 | −2.407987186 | down | AACCCCCAAAGTCCGATGAC | ACTCCGTGTGGTACTCCTCA |
Csa5G021300 | 1.36 × 10−7 | −1.602384465 | down | GAGTGGCGCAGAGTAAGTGT | ACTGCCACATCCCCCAAAAA |
Actin | / | / | / | TTCTGGTGATGGTGTGAGTC | GGCAGTGGTGGTGAACATG |
Gene ID | p-Value | log2 Fold Change | Regulation | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|---|---|---|
Csa6G151110 | 2.27 × 10−6 | −1.584198668 | down | CTTTTCATTCCGTCGCCGTC | TAACCGACGCAACAACTCCA |
Csa1G153510 | 0.002037282 | −1.570926378 | down | CTCGGGGATGATAAGCAGCA | ACAGAGCCAATGCCGATCTT |
Csa2G417830 | 1.27 × 10−6 | 2.11518284 | up | GGGGTTGCCAGGTTCATACA | TAGTTGCGATGGATGCTCCC |
Csa1G445860 | 2.14 × 10−6 | −2.81315738 | down | TTCTAGCCATTTGGGCCTCC | TGGGTAGATGGGATCGGTCA |
Csa6G522690 | 0.000125907 | −2.135788485 | down | ATCTGGGCTTGCCAGGTTG | TGCCAACCTTCCATTCTTCAACT |
Actin | / | / | / | TTCTGGTGATGGTGTGAGTC | GGCAGTGGTGGTGAACATG |
Treatments | Concentration |
---|---|
CK | Fresh water |
T1 | 15 mg/L ABA + 500 mg/L CaCl2 |
T2 | 25 mg/L ABA + 500 mg/L CaCl2 |
T3 | 35 mg/L ABA + 500 mg/L CaCl2 |
T4 | 15 mg/L ABA + 1000 mg/L CaCl2 |
T5 | 25 mg/L ABA + 1000 mg/L CaCl2 |
T6 | 35 mg/L ABA + 1000 mg/L CaCl2 |
T7 | 15 mg/L ABA + 1500 mg/L CaCl2 |
T8 | 25 mg/L ABA + 1500 mg/L CaCl2 |
T9 | 35 mg/L ABA + 1500 mg/L CaCl2 |
Gene | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|
ZnSOD | ACGGGTAATGTTTCTGGTCTCAA | GGAATCTGGCAGTCAGTAATGGT |
CAT | ACCCACCTTACTTGTGCTGATTT | TCATACCATCACGGACGAAAAAT |
Actin | TTCTGGTGATGGTGTGAGTC | GGCAGTGGTGGTGAACATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Q.; Yang, S.; Wang, Y.; Lu, L.; Sun, M.; He, C.; Wang, J.; Li, Y.; Yu, X.; Li, Q.; et al. Physiological and Molecular Mechanisms of ABA and CaCl2 Regulating Chilling Tolerance of Cucumber Seedlings. Plants 2021, 10, 2746. https://doi.org/10.3390/plants10122746
Feng Q, Yang S, Wang Y, Lu L, Sun M, He C, Wang J, Li Y, Yu X, Li Q, et al. Physiological and Molecular Mechanisms of ABA and CaCl2 Regulating Chilling Tolerance of Cucumber Seedlings. Plants. 2021; 10(12):2746. https://doi.org/10.3390/plants10122746
Chicago/Turabian StyleFeng, Qian, Sen Yang, Yijia Wang, Lu Lu, Mintao Sun, Chaoxing He, Jun Wang, Yansu Li, Xianchang Yu, Qingyun Li, and et al. 2021. "Physiological and Molecular Mechanisms of ABA and CaCl2 Regulating Chilling Tolerance of Cucumber Seedlings" Plants 10, no. 12: 2746. https://doi.org/10.3390/plants10122746