Study of Sexual-Linked Genes (OGI and MeGI) on the Performance of Androecious Persimmons (Diospyros kaki Thunb.)
by
and
Liyuan Wang
1,2,†, 
Weijuan Han
1,†,
Songfeng Diao
1,
Yujing Suo
1,
Huawei Li
1,
Yini Mai
1,
Yiru Wang
1,
Peng Sun
1,* and
Jianmin Fu
1,* 1
Key Laboratory of Non-Timber Forest Germplasm Enhancement & Utilization of State Administration of Forestry and Grassland, Non-Timber Forestry Research and Development Center, Chinese Academy of Forestry, Zhengzhou 450003, China
2
Research Institute of Forestry, Chinese Academy of Forestry, Beijing 100091, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this study.
Plants 2021, 10(2), 390; https://doi.org/10.3390/plants10020390
Submission received: 7 December 2020
/
Revised: 10 February 2021
/
Accepted: 14 February 2021
/
Published: 18 February 2021
(This article belongs to the Special Issue Plant Molecular Breeding and Biotechnology)
Abstract
:It is reported that the production of floral sexual phenotype in hexaploid monoecious persimmon (Diospyros kaki) is closely related to a pseudogene called OGI, and a short interspersed nuclear element (SINE)-like insertion (named Kali) in the OGI promoter leads to the gene silence. As a result, DNA methylation level of MeGI promoter determines the development of male or female flowers. However, the molecular mechanism in androecious D. kaki, which only bear male flowers, remains elusive. Here, real-time quantitative polymerase chain reaction (RT-qPCR), molecular cloning, and bisulfite PCR sequencing technique were carried out using 87 materials, including 56 androecious resources, 15 monoecious, and 16 gynoecious cultivars, to investigate the performance of OGI and MeGI on the specific androecious type of D. kaki in China. In conclusion, the Kali insertion was exactly located in the OGI promoter region, and the OGI gene and the Kali sequence were existing and conserved in androecious D. kaki. Meanwhile, we also demonstrated that the MeGI gene was widespread in our investigated samples. Ultimately, our result convincingly provided evidence that the low expression of OGI is probably ascribed to the presence of Kali displaying strong methylation in the OGI promoter, and low expression of MeGI, as well as high DNA methylation level, in the promoter was closely connected with the production of male flowers; this result was consistent with the monoecious persimmon model. Our findings provide predominant genetic aspects for investigation into androecious D. kaki, and future perfecting the sex-determining mechanisms in persimmon.
1. Introduction
Diospyros kaki Thunb. (D. kaki) is an economically important fruit tree species in China [1,2,3]. There were three types of D. kaki at the individual level sex expression: (i) bear only female flowers (gynoecious-type), (ii) both pistillate and staminate flowers on the same plant (monoecious-type), and (iii) hermaphroditic, pistillate, and staminate flowers on the same plant (polygamomonoecious-type) [4]. In addition, a type bearing only male flowers (androecious-type) was found in the Dabie Mountain area in China [5,6]. D. kaki shows flexible sexuality characteristics, and the reason has not yet been fully elucidated.
In the dioecious diploid persimmon, Diospyros lotus (D. lotus), which has the most closely genetic relationship with D. kaki, the floral sexual phenotype was determined by two genes called OGI (Japanese for “male tree”) and MeGI (Japanese for “female tree”). Briefly, the autosomal MeGI gene encodes a homeodomain transcription factor and promotes the development of female flowers, whereas the Y-encoded pseudogene OGI encodes small-RNAs targeting and repressing the MeGI gene and is responsible for the formation of male flowers [7]. In monoecious hexaploid D. kaki, the OGI gene exists [8], but its expression is silenced by a DNA sequence called Kali. The Kali was located in the OGI promoter and exhibited high homology to a short interspersed nuclear element (SINE)-like retrotransposon element.
Both OGI gene and MeGI gene could be found in monoecious persimmons, but there was only MeGI existing in gynoecious trees [8]. Based on the research above, Akagi et al. [9] investigated the epigenetic regulation of the sex determinate gene OGI and MeGI in D. kaki and found that the production of male and female flowers was determined by the methylation levels of MeGI, especially in the 250 bp immediately upstream of the MeGI start codon [9]. The finding provides great significance for the sex determination in monoecious D. kaki. According to the above situation, using androecious genotype patterns and some F1 progeny, Zhang et al. [10] claimed that the OGI gene marker could be used to distinguish D. kaki sexuality at an early stage. However, the molecular mechanism of sex determination in androecious types of D. kaki remains elusive due to the limited number of androecious individual available. Our group made the wild germplasm resources survey of persimmon from 2012 to 2017 nationwide, and found the distribution of male persimmons in Yunjia mountain and Mulan mountain from Hubei province, Guilin from Guangxi Zhuang Autonomous Region, Suzhou from Jiangsu province, etc. [11]. According to the current results, we highlighted the mechanisms of the sexuality of androecious D. kaki, and the following questions need further investigation: (1) whether androecious D. kaki contains kali in the promoter of OGI? (2) Whether the kali and OGI sequences were existing and conserved in male flowers of androecious D. kaki? (3) Is there any relation between the OGI gene expression and the methylation level of Kali? (4) Is the development of male floral buds of androecious D. kaki controlled by the methylation level of MeGI promoter? (5) If the answers to all the questions are same as that in monoecious D. kaki, what factors are responsible for the difference of sexuality between monoecious and androecious D. kaki?
In the present study, we make full use of the specific materials of androecious D. kaki to study the expression of OGI and MeGI, and compare the results to the findings reported by Akagi et al. [9] and Zhang et al. [10]. Hence, this finding will contribute to improving the D. kaki gender theory model, meanwhile providing the foundation for appropriate management during the flowering period, and having the potential to cultivate excellent male germplasm which is valuable in cross-breeding work.
2. Results
2.1. Kali Was Confirmed to Be Located in the Promoter Region of OGI
Schematic structure of the promoter region and the OGI gene showed that the Kali was designed to specifically amplify the Kali region; the pOGI-Kali was for part of the region of the OGI promoter, including the Kali, and the OGI-prom-gene was for the latter part of Kali following the former part of the OGI gene region (Figure 1).
To validate that the amplicon of Kali was just located in the promoter region of OGI, a pair of primers targeting pOGI-Kali was used for PCR, and the fragments amplified from seven androecious samples were cloned into Escherichia coli and sequenced. It is satisfied that the Kali was exactly located in the end of our obtained sequences of pOGI-Kali (Figure S1). Indeed, we also designed a pair of primers named OGI-prom-gene, which consistently amplified the sequences from the latter part of Kali to the front part of OGI, and the result from the seven androecious samples showed that the DNA fragments (File S1) could be connected with the pOGI-Kali and OGI sequences.
2.2. Kali and OGI Were Existing in Androecious D. kaki
PCR analysis revealed that the Kali was present in all androecious D. kaki samples tested, as well as the monoecious and gynoecious cultivars. In addition, the pOGI-Kali sequence was not found in 16 gynoecious cultivars, but was present among the 50 androecious and 10 monoecious individuals. Similarly, the specific PCR fragments confirmed the presence of OGI in a wide variety of D. kaki bearing male flowers (including androecious and monoecious individuals), and the absence in the gynoecious cultivars. All samples tested here demonstrate that the Kali exists in all types of D. kaki, whereas OGI is just found in androecious and monoecious D. kaki (Table 1).
2.3. Kali and OGI DNA Sequences Were Conserved
To characterize variation about the amplicons in D. kaki resources of androecious and the fragments obtained from monoecious by Akagi et al. [9], seven Kali fragments obtained from seven androecious samples were cloned into E. coli and sequenced. DNA sequence alignment analysis showed that over 94% identity was observed (Figure 4), suggesting the Kali sequence is conserved in D. kaki samples bearing male flowers (including androecious and monoecious persimmons).
In the sequencing of our seven OGI fragments, 54–57 termination codons consisting of 17.65–18.79% bases were found, and TAG was the most common type, followed by TAA (Table 2). It was also observed that the compositions of bases in OGI sequences derived from our D. kaki samples displayed a trend of A > T > G > C. To further investigate the universality, the OGI sequences were compared with the fragments obtained from Zhang et al. [10]. DNA sequence alignment analysis of OGI among androecious and monoecious D. kaki individuals revealed that the OGI sequence identity was over 95% (Figure 5), confirming the sequence is conserved and indispensable in androecious persimmons.
2.4. Expression of OGI and Methylation Level of Kali
In male flowers of androecious D. kaki trees, the expression trend of OGI was basically in accordance with that of monoecious D. kaki, at least at the bud/flower different developmental stages in our study (Figure 2a). The OGI levels in androecism-male on 17 June and 3 May were slightly higher than that in monoecism-male. Meanwhile, we also observed no numerous, or rather, low-expressed OGI mRNA at the stages of 5 March to 17 April.
Next, an androecious D. kaki of Yunjiashan-3 was sampled for the investigation of DNA methylation of the Kali sequence, and Figure 2b proves that the developing bud/flower at different developmental stages all presented different levels of methylation, which corresponded with the low expression of OGI. Notably, dramatically higher methylation levels were visible in Kali sequence compared with the other regions across the OGI promoter from another androecious D. kaki of Jiangxi Yeshi-1 at the stage of May 3 (Figure 2c). All in all, the Kali insertion of the OGI promoter upstream exhibited strong cytosine methylation along its entire length in developing buds and flowers, implying the repressive role on the OGI expression.
2.5. MeGI mRNA Expression Level and Promoter Methylation
To better understand the correlation between the gene expression and sex types in androecious D. kaki, the MeGI gene at the stage of 17 April, when female primordia arrested in male floral buds, and male primordia arrested in female floral buds, was further analyzed. As shown in Table 1, PCR product of MeGI gene was widespread in androecious D. kaki, which was the same as monoecious ones, and no significant difference of MeGI expression level was determined between male flowers from these two D. kaki types (Figure 3a). Meanwhile, 0–40% or even 80% of methylation levels in the 250 bp immediately upstream of the MeGI start codon were visible in androecious male flowers, and we detected all three methylation contexts (CG, CHG, and CHH), among which, the CHH sequence was identified as the most widespread context (Figure 3b).
3. Discussion
Epigenetics, an integral part of the genetics, is defined as changing the expression of genes, but the changing is reversible and heritable while maintain the DNA sequence of gene [12,13]. There are many categories of epigenetics being documented, and DNA methylation and non-coding RNA regulation are the most widely modified of genomes [14]. DNA methylation generally occurs in highly-repetitive DNA sequences such as transposons, promoter, and gene-encoding areas. It is essential to plant development and evolution, by interacting with transcription factors or affecting chromatin structure and DNA conformation to regulate the genetic information at the epigenetic level [15]. DNA methylation exists in CG, CHG, and CHH sequence contexts (where H is A, C, or T). The CG methylation is common in expressed gene bodies, while all the sequence contexts (including CG, CHG, and CHH methylation) located in gene promoter could lead to gene silence [16,17]. Meanwhile, the establishment of DNA methylation is mainly through a pathway of the RNA-directed DNA methylation (RdDM), and siRNA plays an irreplaceable role in the process [18]. Non-coding RNAs, such as microRNA, long non-coding RNAs, and circular RNAs, are a vast and heterogeneous family of RNAs; they are involved in cell differentiation and act in modulating translation and transcription of target genes, thus leading to epigenetic changes [19,20]. For example, miRNA160, miRNA396, miRNA535, and miRNA5021 regulate cell division and differentiation in yam during its expansion stage [21]. doublesex1 alpha promoter-associated long RNA (DAPALR) regulates the male-determining gene (Dsx1) expression in the Daphnia magna [22]. Although the actual mechanism underlying how DNA methylation and non-coding RNA trigger the initiation of epigenetic modification in organic evolution process is unknown, there is no doubt that they could enhance gene expression or inhibit gene silence at the transcript level, so as to play a central role in plant growth and development.
Recent studies have already recorded some sex determination sites on sex chromosomes in a small part of dioecious plants. The sex determination site of spinach (Spinacia oleracea) was located on the N3 linkage group [23], the poplar was on chromosome 19 [24], the asparagus was on chromosome 5 [25], and the papaya (Carica papaya) was on the N1 linkage group [26]. Additionally, in respect of gene, it was demonstrated that CmACS-7 and CmWIP1 were the sex-determining genes in melons [27], and CS-ACS2 and CS-ACS1G were for cucumber [28]. The roles of NA1 (associated with BR synthesis) and TS1 (associated with jasmonic acid synthesis) were identified as the sex-determining genes in the monoecious maize (Zea mays) [29,30]. Although the sex chromosome on plants has been studied for more than a century, the identified sex determination genes in dioecious trees were extremely limited [31], presumably because of the shorter evolution time and the restructure of mutations between chromosomes. At present, one gene, namely OGI, was validated as the sex-determining gene in D. lotus, which regulates sexual differentiation by targeting the autosomal MeGI gene through encoding small-RNAs [7]. In monoecious D. kaki, the OGI is silenced, and DNA methylation level of the MeGI promoter determines the development of male or female flowers [8].
In our study, seven OGI fragments derived from androecious D. kaki were cloned into E. coli and sequenced. Results of termination codons and compositions of bases in these OGI sequences were in accordance with a previous report that the coding sequence of OGI presented multiple disruptive stop codons [7]. BLAST analysis revealed that our androecious OGI sequences had high sequence identity of over 95% with that of monoecious persimmons, as reported before [10]. Additionally, results of RT-qPCR indicated that the OGI gene could have a basal, but not too much, expression level in androecious D. kaki bud/flower based on the same primer put forward by Akagi et al. [9]. Overall, we confirmed that this OGI DNA sequence is conserved and the expression is low in androecious persimmons.
Indeed, an insertion element named Kali in the OGI 5′ upstream promoter region exhibiting strong cytosine methylation potentially contributed to the silence of OGI expression in monoecious D. kaki [9]. To further confirm the existence of Kali, we took advantage of the Kali and pOGI-Kali primers described by Akagi et al. [9], and convincingly showed that the amplicon was present and conserved in all tested androecious D. kaki. Meanwhile, the sequences amplified by a new designed pair of primers called OGI-prom-gene could be connected with the pOGI-Kali and OGI region, highlighting that the conserved Kali is exactly located in the OGI promoter region in all androecious persimmons. Regarding the cytosine methylation, considerably higher levels were observed in the Kali region compared with the other parts of the OGI promoter in androecious D. kaki. In summary, in the specific materials of androecious persimmons, the OGI is low-expressed, potentially due to the presence of highly-methylated Kali in the promoter. This result was largely concordant with the findings in hexaploid monoecious persimmon documented by Akagi et al. [9]. Thus, other regulatory factors and mechanisms may be responsible for the difference of sexuality between monoecious and androecious D. kaki.
More importantly, male flower buds of monoecious D. kaki exhibited strong signal of MeGI gene methylation levels, which was consistent with the low expression of MeGI [9]. In our study, similar MeGI levels to that of monoecious D. kaki, as well as 0–40% or even 80% methylation of the MeGI promoter region in male flowers of androecious D. kaki, were recorded. As a result, we deduced that strong methylation levels of the MeGI promoter may play a remarkable role in the performance of male flowers. Akagi et al. [9] revealed that RNA-based sex-determining mechanism occurred in monoecious D. kaki, for the methylation signal present on the MeGI promoter can activate 21 nt long smMeGI production, which was abundant in male buds/flowers, while 24 nt small RNA was high, and accumulated on the Kali insertion in the OGI promoter. It is thus possible that small RNA encoded by the Y chromosome inhibited the expression of MeGI through activating RdDM pathway on the MeGI promoter in monoecious D. kaki, leading to the male organs. Thus, detailed studies on the bioinformatics characteristics of the Kali, as well as the research on the small RNA during the flower bud differentiation process, is sorely needed.
4. Materials and Methods
4.1. Plant Materials
Eighty-seven D. kaki germplasm resources, including 56 androecious individuals, 15 monoecious cultivars, and 16 gynoecious cultivars were sampled in this study (Table 1).
4.2. PCR Detection
Fresh leaves from 50 androecious resources, 10 monoecious, and 16 gynoecious cultivars (Table 1) harvested on 3 May (during the anthesis stage) were obtained to determine the existence of OGI, Kali, pOGI-Kali (amplifies sequence of OGI promoter including the Kali), and MeGI using PCR reaction.
Total genomic DNAs were extracted from fresh leaves using the cetyltrimethylammonium bromide (CTAB) method [32]. PCR was performed using Taq PCR Master Mix (Sangon Biotechnology Co., Shanghai, China). The PCR reaction was conducted with the primers provided in Table 3, and the reaction was performed in a programmable T100TM Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) with the following conditions: 3 min for denaturation at 94 °C, followed by 30 cycles at 94 °C for 30 s, annealing at 55 °C for 30 s, 72 °C for 60 s, and final extension at 72 °C for 5 min.
4.3. Cloning of the Targeted Fragments
To detect whether the OGI and Kali sequences were conserved, fresh leaves from seven androecious samples (Table 1) harvested on 3 May were tested by cloning analysis.
Total DNA was extracted from fresh leaves by the CTAB method [32]. Primers specific to OGI, Kali, pOGI-Kali, and OGI-prom-gene (amplifies the region from the latter part of Kali to the former part of OGI gene) were displayed in Table 3. PCR amplification was conducted according to the manufacturer’s instructions using Pfu DNA Polymerase (Sangon Biotechnology Co., Shanghai, China). The products were then detected by 1% agarose gel electrophoresis. After recovering from the gel, the specific PCR fragments were ligated into pUC18-T vector and transformed into Escherichia coli. After overnight culture, the single colonies were picked for detection via PCR. The positive clones were sent to Sangon Biotech for sequencing analysis. Alignment sequence was constructed using DNAMAN software (version 7.0; Lynnon Biosoft, San Ramon, CA, USA).
4.4. Real-Time Quantitative Polymerase Chain Reaction
To compare expression patterns in 14 androecious and 49 monoecious ones, male buds/flowers (Table 1) were harvested on June 17 of the previous year, and 5 March, 17 April, and 3 May for real-time quantitative polymerase chain reaction (RT-qPCR) analysis. These time periods correspond to the inflorescence primordia initiation (June), petal, carpel, and anther primordia initiation (March), microsporocyte/megasporocyte initiation (April), and mature pollen/embryo sac formation (May). Dynamic changes of OGI gene expression during primordia formation and flower development and MeGI gene on 17 April in male flowers from androecious and monoecious persimmons were detected.
The total RNA was isolated from male buds/flowers collected across different developmental stages using EZ-10 DNAaway RNA Miniprep Kits (Sangon Biotechnology Co., Shanghai, China) according to the manufacturer’s instructions. The first strand of cDNA was synthesized by a TRUEscript 1st Strand cDNA Synthesis Kit (Kemix, Beijing, China) and RT-qPCR experiments described here were performed with the 2×Sybr qPCR Mix (Kemix) using the CFX96™ Real-Time System (Bio-Rad Laboratories, Hercules, CA, USA), according to the suppliers’ manuals. RT-qPCR analyses of MeGI and OGI expression (primers in Table 3) were carried out as follows: 3 min at 95 °C for denaturation, followed by 45 cycles of 95 °C for 10 s, 57–60 °C for 5 s, and 72 °C for 15 s. Three technical replicates were performed for each sample, and GAPDH was used as the internal control.
4.5. Bisulfite PCR Sequencing for OGI Promoter and MeGI Promoter
Male bud/flower from androecious D. kaki cv. Yunjiashan-3 at developmental stages of 5 March, 30 March, 17 April, and 3 May, and male flowers from androecious D. kaki cv. Jiangxi Yeshi-1 on 3 May were sampled for bisulfite PCR sequencing for OGI promoter.
Total DNA was extracted by the CTAB method [32] and purified by phenol/chloroform extraction. Two ug DNA was subjected to bisulfite treatment to deaminate non-methylated cytosine (C) residues into uracil (U) residues. The corresponding non-methylated genome area was identified as the control. The primer set Kali (Table 3) was used for bisulfite PCR sequencing of Kali sequence, and the eluted DNA was enriched by PCR with the following conditions: 4 min at 95 °C; 35 cycles of 30 s at 94 °C, 30 s at 57 °C, and 1 min at 72 °C; and a final extension step of 8 min at 72 °C. The OGI-prom-F1, OGI-prom-F2, and OGI-prom-F3 were used for bisulfite PCR sequencing of OGI promoter (Table 3), and the PCR conditions were 4 min at 98 °C; 20 cycles of 45 s at 94 °C, 45 s at 66 °C (0.5 °C decreased per cycle), and 1 min at 72 °C; 20 cycles of 45 s at 94 °C, 45 s at 56 °C, and 1 min at 72 °C; and a final extension step of 8 min at 72 °C. Afterwards, the specific PCR fragments were ligated into pUC18-T vector and transformed into Escherichia coli. After overnight culture and single colonies were picked for detection via PCR, the positive clones were sent to Sangon Biotech for sequencing analysis.
Male flowers of androecious D. kaki individuals, including Mulan-7 and Mulan-24 on 17 April, were sampled for detection of methylated cytosine residue for MeGI promoter according to the method of Akagi et al. [9]. The bisulfite-treated sequence of the 250 bp upstream from the start codon of the MeGI gene was amplified by TaKaRa EpiTaq HS (TaKaRa) using sense- and antisense-specific primer set (Table 3).
4.6. Data Analysis
Data were expressed as means ± standard error (SE), and all RT-qPCR statistical analyses were analyzed by 2−ΔΔCt method, where ΔΔCt = ((Ct, target (test) − Ct, target (control)) − ((Ct, reference (test) − Ct, reference (control)). Each experiment consisted of three technical replicates per condition.
5. Conclusions
Collectively, OGI is indispensable and low-expressed in androecious D. kaki, and the Kali located in the OGI promoter region exhibited high methylation level. On the other hand, it is certain that methylation levels of MeGI promoter may have important influence on the male flowers formation. Overall, our result was similar with the gender theory model of monoecious D. kaki. However, the molecular mechanism of unisexual flower formation in androecious resources of D. kaki remains largely elusive, and further assessment using high-sensitivity and -specificity detection methods will provide valuable knowledge for us to hopefully identify a potential candidate regulatory factor (may be siRNAs), apart from the OGI, to uncover the reason for male phenotype.
Supplementary Materials
The following are available online at https://www.mdpi.com/2223-7747/10/2/390/s1, Figure S1: Alignment of the pOGI-Kali sequences. File S1: DNA sequences amplified by the primer of OGI-prom-gene.
Author Contributions
Conceptualization: P.S. and J.F.; methodology: L.W. and P.S.; investigation: L.W. and P.S.; writing—original draft preparation: L.W. and W.H.; writing—review and editing: Y.S., H.L., Y.M., S.D., and Y.W. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by grants from the National Key R & D Program of China (2019YFD1000600) and the Fundamental Research Funds for the Central Non-profit Research Institution of CAF (CAFYBB2017ZA005, and CAFYBB2017ZA004–3) and the National Natural Science Foundation of China (32071801).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data presented in this study are available on request from the corresponding author.
Acknowledgments
We would like to thank Ryutaro Tao (Kyoto University, Japan) and Takashi Akagi (Okayama University, Japan) for the technical assistance of methylation determination.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Luo, Z.R.; Wang, R.Z. Persimmon in China: Domestication and traditional utilizations of genetic resources. Adv. Hortic. Sci. 2008, 22, 239–243. [Google Scholar]
- Akagi, T.; Katayama-Ikegami, A.; Yonemori, K. Proanthocyanidin biosynthesis of persimmon (Diospyros kaki Thunb.) fruit. Sci. Hortic. 2011, 30, 373–380. [Google Scholar] [CrossRef]
- Xu, J.C.; Zhang, Q.L.; Xu, L.Q.; Guo, D.L.; Luo, Z.R. Recent developments in deastringency mechanism of persimmon fruit. Acta Hortic. Sin. 2016, 43, 1653–1664. (In Chinese) [Google Scholar]
- Yonemori, K.; Sugiura, A.; Tanaka, K.; Kameda, K. Floral ontogeny and sex determination in monoecious-type persimmons. J. Am. Soc. Hortic. Sci. 1993, 118, 293–297. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.Q.; Zhang, Q.L.; Luo, Z.R. Pollen-related characteristics of Diospyros Linn. (Ebenaceae) androecious germplasms newly found in China. Acta. Hortic. 2013, 996, 199–206. [Google Scholar]
- Zhang, Q.L.; Guo, D.L.; Luo, Z.R. Identification and taxonomic status of Chinese Diospyros spp. (Ebenaceae) androecious germplasms. Acta. Hortic. 2009, 833, 91–96. [Google Scholar] [CrossRef]
- Akagi, T.; Henry, I.M.; Tao, R.; Comai, L. A Y-chromosome-encoded small RNA acts as a sex determinant in persimmons. Science 2014, 346, 646–650. [Google Scholar] [CrossRef]
- Akagi, T.; Kawai, T.; Tao, R. A male determinant gene in diploid dioecious Diospyros, OGI, is required for male flower production in monoecious individuals of oriental persimmon (D. kaki). Sci. Hortic. 2016, 213, 243–251. [Google Scholar] [CrossRef] [Green Version]
- Akagi, T.; Henry, I.M.; Kawai, T.; Comai, L.; Tao, R. Epigenetic regulation of the sex determination gene MeGI in polyploid persimmon. Plant Cell 2016, 28, 2905–2915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, P.X.; Yang, S.C.; Liu, Y.F.; Zhang, Q.L.; Xu, L.Q.; Luo, Z.R. Validation of a male-linked gene locus (OGI) for sex identification in persimmon (Diospyros kaki Thunb.) and its application in F1 progeny. Plant Breed. 2016, 135, 721–727. [Google Scholar] [CrossRef]
- Wang, L.Y.; Li, H.W.; Sun, P.; Fu, J.M.; Suo, Y.J.; Zhang, J.J.; Han, W.J.; Diao, S.F.; Li, F.D.; Mai, Y.N. Genetic diversity among wild androecious germplasms of Diospyros kaki in China based on SSR markers. Sci. Hortic. 2018, 242, 1–9. [Google Scholar] [CrossRef]
- Wu, C.; Morris, J.R. Genes, genetics and epigenetics: A correspondence. Science 2001, 293, 1103–1105. [Google Scholar] [CrossRef] [Green Version]
- Suzuk, M.M.; Bird, A. DNA methylation landscapes: Provocative insights from epigenomics. Nat. Rev. Genet. 2008, 9, 465–476. [Google Scholar] [CrossRef]
- Henderson, I.R.; Jacobsen, S.E. Epigenetic inheritance in plants. Nature 2007, 447, 418–424. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zhang, Y.; Xie, L.N.; Li, Y.H. Research progress in DNA methylation in plants. Plant Physiol. J. 2012, 48, 1027–1036. (In Chinese) [Google Scholar]
- Gouil, Q.; Baulcombe, D.C. DNA methylation signatures of the plant chromomethyltransferases. PLoS Genet. 2016, 12, e1006526. [Google Scholar] [CrossRef] [Green Version]
- Zhou, S.L.; Liu, X.Y.; Zhou, C.; Zhou, Q.W.; Zhao, Y.; Li, G.L.; Zhou, D.X. Cooperation between the H3K27me3 chromatin mark and Non-CG methylation in epigenetic regulation. Plant Physiol. 2016, 172, 1131–1141. [Google Scholar] [PubMed] [Green Version]
- Li, Y.; Qian, W.Q. Mechanisms of DNA methylation and demethylation in plants. Chin. Bull. Life Sci. 2017, 29, 302–309. (In Chinese) [Google Scholar]
- Golicz, A.A.; Bhalla, P.L.; Singh, M.B. lncRNAs in plant and animal sexual reproduction. Trends Plant Sci. 2017, 23, 195–205. [Google Scholar] [CrossRef]
- Chu, C.; Zhang, Y.L.; Yu, L.; SHARMA, S.; Fei, Z.L.; Drevet, J.R. Epididymal small non-coding RNA studies: Progress over the past decade. Andrology 2019, 7, 681–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.Y.; Luo, S.Z.; Hameed, S.; Xiao, D.; Zhan, J.; Wang, A.Q.; He, L.F. Integrated mRNA and miRNA transcriptome analysis reveals a regulatory network for tuber expansion in Chinese yam (Dioscorea opposita). BMC Genom. 2020, 21, 117. [Google Scholar] [CrossRef] [Green Version]
- Kato, Y.; Perez, C.A.G.; Mohamad, I.N.S.; Nong, Q.D.; Sudo, Y.; Matsuura, T. A 5′UTR-overlapping LncRNA activates the male-determining gene doublesex1 in the Crustacean Daphnia magna. Curr. Biol. 2018, 28, 1811–1817. [Google Scholar] [CrossRef] [Green Version]
- Khattak, J.Z.K.; Torp, A.M.; Andersen, S.B. A genetic linkage map of Spinacia oleracea and localization of a sex determination locus. Euphytica 2006, 148, 311–318. [Google Scholar] [CrossRef]
- Pakull, B.; Groppe, K.; Mecucci, F.; Gaudet, F.; Sabatti, M.; Fladunga, M. Genetic mapping of linkage group XIX and identification of sex-linked SSR markers in a Populus tremula × Populus tremuloides cross. Can. J. For. Res. 2011, 41, 245–253. [Google Scholar] [CrossRef]
- Telgmann-Rauber, A.; Jamsari, A.; Kinney, M.S.; Pires, J.C.; Jung, C. Genetic and physical maps around the sex-determining M-locus of the dioecious plant asparagus. Mol. Genet. Genom. 2007, 278, 221–234. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Moore, P.H.; Liu, Z.; Kim, M.S.; Yu, Q.; Fitch, M.M.M.; Sekioka, T.; Paterson, A.H.; Ming, R. High-density linkage mapping revealed suppression of recombination at the sex determination locus in papaya. Genetics 2004, 166, 419–436. [Google Scholar] [CrossRef] [Green Version]
- Martin, A.; Troadec, C.; Boualem, A.; Rajab, M.; Fernandez, R.; Morin, H.; Pitrat, M.; Dogimont, C.; Bendahmane, A. A transposon-induced epigenetic change leads to sex determination in melon. Nature 2009, 461, 1135–1138. [Google Scholar] [CrossRef] [PubMed]
- Saito, S.; Fujii, N.; Miyazawa, Y.; Yamasaki, S.; Matsuura, S.; Mizusawa, H.; Fujita, Y.; Takahashi, H. Correlation between development of female flower buds and expression of the CS-ACS2 gene in cucumber plants. J. Exp. Bot. 2007, 58, 2897–2907. [Google Scholar] [CrossRef] [Green Version]
- Acosta, I.F.; Laparra, H.; Romero, S.P.; Schmelz, E.; Hamberg, M.; Mottinger, J.P.; Moreno, M.A.; Dellaporta, S.L. Tasselseed1 is a lipoxygenase affecting jasmonic acid signaling in sex determination of maize. Science 2009, 323, 262–265. [Google Scholar] [CrossRef] [Green Version]
- Hartwig, T.; Chuck, G.S.; Fujioka, S.; Klempien, A.; Weizbauer, R.; Potluri, D.P.; Choe, S.; Johal, G.S.; Schulz, B. Brassinosteroid control of sex determination in maize. Proc. Natl. Acad. Sci. USA 2011, 108, 19814–19819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Charlesworth, D. Plant contributions to our understanding of sex chromosome evolution. New Phytol. 2015, 208, 52–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
Figure 1.
Primer sets of the promoter region and the OGI gene.
Figure 2.
Expression of OGI and methylation level of Kali. (a) RT-qPCR analysis of the relative OGI mRNA expression level during different developmental stages (Table 1, sample list); (b) DNA methylation of the Kali sequence from developing bud/flower at different developmental stages in androecious D. kaki of Yunjiashan-3; (c) DNA methylation across the OGI promoter from male flowers in androecious D. kaki of Jiangxi Yeshi-1 at the stage of 3 May. M-CG, M-CHG, and M-CHH represent different sequence context of cytosine methylation. Values are means ± SE (N = 14 for monoecious biological replicates; N = 49 for androecious biological replicates).
Figure 2.
Expression of OGI and methylation level of Kali. (a) RT-qPCR analysis of the relative OGI mRNA expression level during different developmental stages (Table 1, sample list); (b) DNA methylation of the Kali sequence from developing bud/flower at different developmental stages in androecious D. kaki of Yunjiashan-3; (c) DNA methylation across the OGI promoter from male flowers in androecious D. kaki of Jiangxi Yeshi-1 at the stage of 3 May. M-CG, M-CHG, and M-CHH represent different sequence context of cytosine methylation. Values are means ± SE (N = 14 for monoecious biological replicates; N = 49 for androecious biological replicates).
Figure 3.
Expression of MeGI and methylation level of its promoter. (a) RT-qPCR analysis of the relative MeGI mRNA expression level on 17 April (Table 1, sample list); (b) cytosine methylation levels in the 250 bp immediately upstream of the MeGI promoter in male flowers on 17 April from androecious D. kaki of Mulan-7 (upper panel) and Mulan-24 (lower panel). M-CG, M-CHG, and M-CHH represent different sequence context of cytosine methylation. Values are means ± SE (N = 14 for monoecious biological replicates; N = 49 for androecious biological replicates).
Figure 3.
Expression of MeGI and methylation level of its promoter. (a) RT-qPCR analysis of the relative MeGI mRNA expression level on 17 April (Table 1, sample list); (b) cytosine methylation levels in the 250 bp immediately upstream of the MeGI promoter in male flowers on 17 April from androecious D. kaki of Mulan-7 (upper panel) and Mulan-24 (lower panel). M-CG, M-CHG, and M-CHH represent different sequence context of cytosine methylation. Values are means ± SE (N = 14 for monoecious biological replicates; N = 49 for androecious biological replicates).
Figure 4.
Alignment of the Kali sequences in Diospyros kaki genotypes bearing male flowers. Kali 1–7 represent the Kali sequences of Yunjiashan-8, Mulan-38, Luotian Yeshi-1, Jiangsu Yeshi 2, Jiangxi Yeshi-1, Hunan Yeshi-1, and Yunjiashan-3, respectively, which were all obtained from our androecious D. kaki genotypes, and the ‘Kali’ was from monoecious genotype, i.e., Taishu, from Akagi et al. [8].
Figure 4.
Alignment of the Kali sequences in Diospyros kaki genotypes bearing male flowers. Kali 1–7 represent the Kali sequences of Yunjiashan-8, Mulan-38, Luotian Yeshi-1, Jiangsu Yeshi 2, Jiangxi Yeshi-1, Hunan Yeshi-1, and Yunjiashan-3, respectively, which were all obtained from our androecious D. kaki genotypes, and the ‘Kali’ was from monoecious genotype, i.e., Taishu, from Akagi et al. [8].
Figure 5.
Alignment of the OGI sequences in D. kaki bearing male flowers. OGI 1–7 represent the OGI sequence of Yunjiashan-8, Mulan-38, Luotian Yeshi-1, Jiangsu Yeshi 2, Jiangxi Yeshi-1, Hunan Yeshi-1, and Yunjiashan-3, respectively, which were all obtained from our androecious D. kaki. Male 1–3 represent androecious D. kaki isolate plant 1–3, and Zenjimaru, Taishu, and Shougatsu were monoecious D. kaki, which were all obtained from Zhang et al. [10].
Figure 5.
Alignment of the OGI sequences in D. kaki bearing male flowers. OGI 1–7 represent the OGI sequence of Yunjiashan-8, Mulan-38, Luotian Yeshi-1, Jiangsu Yeshi 2, Jiangxi Yeshi-1, Hunan Yeshi-1, and Yunjiashan-3, respectively, which were all obtained from our androecious D. kaki. Male 1–3 represent androecious D. kaki isolate plant 1–3, and Zenjimaru, Taishu, and Shougatsu were monoecious D. kaki, which were all obtained from Zhang et al. [10].
Table 1.
Details of the 87 samples investigated in this study.
| No. | Sample Name a | Sexuality b | Genomic DNA PCR Amplification c | Origin | Collection Site d | RT-qPCR | Cloning and Sequencing | Bisulfite PCR Sequencing | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Kali | pOGI-Kali | OGI | MeGI | ||||||||
| 1 | Yunjiashan-1 | A | + | + | + | + | Hubei Province | I | X | ||
| 2 | Yunjiashan-3 | A | + | + | + | + | Hubei Province | I | X | X | X (for Figure 2b) |
| 3 | Yunjiashan-5 | A | + | + | + | + | Hubei Province | I | X | ||
| 4 | Yunjiashan-6 | A | + | + | + | + | Hubei Province | I | X | ||
| 5 | Yunjiashan-7 | A | + | + | + | + | Hubei Province | I | X | ||
| 6 | Yunjiashan-8 | A | + | + | + | + | Hubei Province | I | X | X | |
| 7 | Yunjiashan-14 | A | + | + | + | + | Hubei Province | I | X | ||
| 8 | Yunjiashan-16 | A | + | + | + | + | Hubei Province | I | X | ||
| 9 | Mulan-2 | A | + | + | + | + | Hubei Province | II | X | ||
| 10 | Mulan-3 | A | + | + | + | + | Hubei Province | II | X | ||
| 11 | Mulan-5 | A | + | + | + | + | Hubei Province | II | X | ||
| 12 | Mulan-7 | A | + | + | + | + | Hubei Province | II | X | X (for Figure 3b) | |
| 13 | Mulan-10 | A | + | + | + | + | Hubei Province | II | X | ||
| 14 | Mulan-14 | A | + | + | + | + | Hubei Province | II | X | ||
| 15 | Mulan-15 | A | + | + | + | + | Hubei Province | II | X | ||
| 16 | Mulan-16 | A | + | + | + | + | Hubei Province | II | X | ||
| 17 | Mulan-17 | A | + | + | + | + | Hubei Province | II | X | ||
| 18 | Mulan-21 | A | + | + | + | + | Hubei Province | II | X | ||
| 19 | Mulan-24 | A | + | + | + | + | Hubei Province | II | X | X (for Figure 3b) | |
| 20 | Mulan-30 | A | + | + | + | + | Hubei Province | II | X | ||
| 21 | Mulan-34 | A | + | + | + | + | Hubei Province | II | X | ||
| 22 | Mulan-38 | A | + | + | + | + | Hubei Province | II | X | X | |
| 23 | Mulan-39 | A | NT | NT | NT | NT | Hubei Province | II | X | ||
| 24 | Mulan-40 | A | + | + | + | + | Hubei Province | II | |||
| 25 | Mulan-43 | A | + | + | + | + | Hubei Province | II | X | ||
| 26 | Mulan-44 | A | + | + | + | + | Hubei Province | II | X | ||
| 27 | Luotian Yeshi-1 | A | + | + | + | + | Hubei Province | II | X | X | |
| 28 | Luotian Yeshi-2 | A | + | + | + | + | Hubei Province | II | |||
| 29 | Luotian Yeshi-17 | A | + | + | + | + | Hubei Province | II | |||
| 30 | Jiangsu Yeshi 1 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 31 | Jiangsu Yeshi 1-2 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 32 | Jiangsu Yeshi 1-3 | A | + | + | + | + | Jiangsu Province | III | |||
| 33 | Jiangsu Yeshi 1-7 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 34 | Jiangsu Yeshi 1-10 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 35 | Jiangsu Yeshi 2 | A | + | + | + | + | Jiangsu Province | III | X | X | |
| 36 | Jiangsu Yeshi 2-1 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 37 | Jiangsu Yeshi 2-2 | A | + | + | + | + | Jiangsu Province | III | |||
| 38 | Jiangsu Yeshi 2-4 | A | + | + | + | + | Jiangsu Province | III | X | ||
| 39 | Jiangsu Yeshi 2-20 | A | + | + | + | + | Jiangsu Province | III | |||
| 40 | Jiangsu Yeshi 2-48 | A | NT | NT | NT | NT | Jiangsu Province | III | X | ||
| 41 | Hunan Yeshi-1 | A | + | + | + | + | Hunan Province | III | X | X | |
| 42 | Hunan Yeshi-2 | A | + | + | + | + | Hunan Province | III | X | ||
| 43 | Hunan Yeshi-3 | A | + | + | + | + | Hunan Province | III | X | ||
| 44 | Pingshanse-male | A | + | + | + | + | Hebei Province | III | X | ||
| 45 | Jiangxi Yeshi-1 | A | + | + | + | + | Jiangxi Province | III | X | X (for Figure 2c) | |
| 46 | Jiangxi Yeshi-2 | A | + | + | + | + | Jiangxi Province | III | X | ||
| 47 | Jiangxi Yeshi-3 | A | + | + | + | + | Jiangxi Province | III | X | ||
| 48 | Jiangxi Yeshi-4 | A | + | + | + | + | Jiangxi Province | III | X | ||
| 49 | Jiangxi Yeshi-5 | A | NT | NT | NT | NT | Jiangxi Province | III | X | ||
| 50 | Qinghua-male | A | + | + | + | + | Shaanxi Province | IV | X | ||
| 51 | Zhanfanghou-male | A | + | + | + | + | Shaanxi Province | IV | X | ||
| 52 | Guangxi Yeshi-24 | A | NT | NT | NT | NT | Guangxi Zhuang Autonomous Region | V | X | ||
| 53 | Guangxi Yeshi-27 | A | + | + | + | + | Guangxi Zhuang Autonomous Region | V | X | ||
| 54 | Guangxi Yeshi-28 | A | + | + | + | + | Guangxi Zhuang Autonomous Region | V | X | ||
| 55 | Guangxi Yeshi-41 | A | NT | NT | NT | NT | Guangxi Zhuang Autonomous Region | V | X | ||
| 56 | Guangxi Yeshi-42 | A | NT | NT | NT | NT | Guangxi Zhuang Autonomous Region | V | X | ||
| 57 | Yaoxian Wuhuashi | M | + | + | + | + | Shaanxi Province | IV | X | ||
| 58 | Heixinshi | M | + | + | + | + | Shaanxi Province | IV | X | ||
| 59 | Xingyi Shuishi | M | + | + | + | + | Guizhou Province | IV | X | ||
| 60 | Panxian Shuishi | M | + | + | + | + | Guizhou province | IV | |||
| 61 | Shutouhong | M | + | + | + | + | Jiangsu Province | IV | X | ||
| 62 | Xiangyang Niuxinshi | M | + | + | + | + | Hubei Province | IV | X | ||
| 63 | Taiwan Zhengshi | M | + | + | + | + | Taiwan | IV | X | ||
| 64 | Xiaobahu | M | NT | NT | NT | NT | Henan Province | III | X | ||
| 65 | Laojianshan-5 | M | + | + | + | + | Yunnan Province | VI | X | ||
| 66 | Shougatsu | M | + | + | + | + | Japan | IV | X | ||
| 67 | Zenjimaru | M | NT | NT | NT | NT | Japan | IV | X | ||
| 68 | Okugosho | M | NT | NT | NT | NT | Japan | IV | X | ||
| 69 | Hanagosho | M | NT | NT | NT | NT | Japan | IV | X | ||
| 70 | Taishu | M | + | + | + | + | Japan | IV | X | ||
| 71 | Nishimurawase | M | NT | NT | NT | NT | Japan | IV | X | ||
| 72 | Jiangxi Yeshi-11 | G | + | - | - | NT | Jiangxi Province | III | |||
| 73 | Jiangsu Yeshi 1-1 | G | + | - | - | NT | Jiangsu Province | III | |||
| 74 | Xinan Niuxinshi | G | + | - | - | NT | Henan Province | III | |||
| 75 | Luotian Yeshi-38 | G | + | - | - | NT | Hubei Province | III | |||
| 76 | Tianbaogai | G | + | - | - | NT | Hubei Province | VII | |||
| 77 | Guangxi Yeshi-24 | G | + | - | - | NT | Guangxi Zhuang Autonomous Region | V | |||
| 78 | Luoanchuan Niuxin | G | + | - | - | NT | Henan Province | III | |||
| 79 | Yangshuo Niuxin | G | + | - | - | NT | Yunan Province | III | |||
| 80 | Huaxian Qingxuan | G | + | - | - | NT | Shaanxi Province | IV | |||
| 81 | Boai Bayuehuang | G | + | - | - | NT | Henan Province | III | |||
| 82 | Mopanshi | G | + | - | - | NT | Henan Province | III | |||
| 83 | Sanyuan Jixinhusng | G | + | - | - | NT | Shaanxi Province | IV | |||
| 84 | Huojing | G | + | - | - | NT | Shaanxi Province | IV | |||
| 85 | Haian Xiaofangshi | G | + | - | - | NT | Shaanxi Province | IV | |||
| 86 | Fuping Jianshi | G | + | - | - | NT | Shaanxi Province | IV | |||
| 87 | Niutoushi | G | + | - | - | NT | Zhejiang Province | III | |||
a All samples are Diospyros kaki Thunb. b Sexuality are represented by A: androecious sample; M: monoecious sample; G: gynoecious sample. c The electrophoresis bands of PCR product were indicated by + (positive) or - (negative); NT: not tested. d Samples were collected from I: Yunjia Mountain; II: Mulan Mountain; III: Yuanyang County, Henan Province; IV: Yangling District, Shaanxi Province, Yuanyang County, Henan Province; V: Guilin City, Guangxi Zhuang Autonomous Region; VI: Yuxi City, Yunnan Province; VII: Luotian County, Hubei Province.
Table 2.
Types of termination codons and compositions of bases in OGI sequences derived from androecious D. kaki.
Table 2.
Types of termination codons and compositions of bases in OGI sequences derived from androecious D. kaki.
| Name | Length (bp) | Termination Codon | Base Composition | ||||||
|---|---|---|---|---|---|---|---|---|---|
| TAG | TAA | TGA | Total (%) | A (%) | T (%) | G (%) | C (%) | ||
| OGI 1 | 918 | 21 | 21 | 12 | 54 (17.65) | 298 (32.46) | 234 (25.49) | 205 (22.33) | 181 (19.72) |
| OGI 2 | 947 | 23 | 20 | 13 | 56 (17.74) | 305 (32.21) | 238 (25.13) | 213 (22.49) | 191 (20.17) |
| OGI 3 | 913 | 22 | 21 | 13 | 56 (18.40) | 296 (32.42) | 230 (25.19) | 203 (22.23) | 184 (20.15) |
| OGI 4 | 913 | 22 | 21 | 13 | 56 (18.40) | 298 (32.64) | 232 (25.41) | 203 (22.23) | 180 (19.72) |
| OGI 5 | 909 | 22 | 21 | 13 | 56 (18.48) | 298 (32.78) | 232 (25.52) | 203 (22.33) | 176 (19.36) |
| OGI 6 | 928 | 21 | 20 | 14 | 55 (18.78) | 302 (32.54) | 242 (26.08) | 204 (21.98) | 180 (19.40) |
| OGI 7 | 910 | 23 | 21 | 13 | 57 (18.79) | 293 (32.20) | 231 (25.38) | 204 (22.42) | 181 (20.00) |
OGI 1–7 represent the OGI sequence of Yunjiashan-8, Mulan-38, Luotian Yeshi-1, Jiangsu Yeshi 2, Jiangxi Yeshi-1, Hunan Yeshi-1, and Yunjiashan-3, respectively.
Table 3.
Sequences of primers used in this study.
| Purpose | Primer | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
|---|---|---|---|
| RT-qPCR | GAPDH | AGCTCTTCCACCTCTCCAGT | TGCTAGCTGCACAACCAACT |
| MeGI | GGAGTTGAACTTTGGGAACG | AAGGCGACACTTGTGGACGA | |
| OGIa | AACCCCATCGCATTTGATAA | CCGTCAATTTTGAGGGAGAG | |
| PCR | Kal ib | AACTGCCCAGGGGTACAACTAAG | TATTATTATGCTCCAACACTCGCAC |
| OGIb | CACAGTAGTCATATATTTTTAGC | CTGGCACACAAAATATTTTCAACCCT | |
| pOGI-Kali b | CACCAAGTATTGATTTTTATTGTACCATTGCTTAT | TATTATTATGCTCCAACACTCGCAC | |
| MeGI | GGAGTTGAACTTTGGGAACG | AAGGCGACACTTGTGGACGA | |
| Clone sequencing | Kalib | AACTGCCCAGGGGTACAACTAAG | TATTATTATGCTCCAACACTCGCAC |
| OGIb | CACAGTAGTCATATATTTTTAGC | CTGGCACACAAAATATTTTCAACCCT | |
| pOGI-Kali b | CACCAAGTATTGATTTTTATTGTACCATTGCTTAT | TATTATTATGCTCCAACACTCGCAC | |
| OGI-prom-gene | AGTGGATCCATCAAGGGTGC | GTGTCGTCCAGTTCCGCTTA | |
| Bisulfite PCR sequencing | Kali | AATTGTTTAGGGGTGTAATTAAGTG | TTTTTTTTATTATTATACTCCAACACTC |
| OGI-prom-F1 | GAGAAATTTAATGTAATTTGTGAGG | CATAACAAATCTCTTCCATAACTAAAC | |
| OGI-prom-F2 | GTTATGGAAGAGATTTGTTATGTTG | TCCACTAACACTTACTAAAAACCAC | |
| OGI-prom-F3 | GTGGTTTTTAGTAAGTGTTAGTGGA | ATTAAATAAACAACTATCTAACTTATCTTTAC | |
| MeGI-SenseProm-bis | GTGTTTTGGTTAAATTAAGTTAATTTAATG | CTTTAATCAAAAAATTAAAATTAACTATCATTTT | |
| MeGI-ASProm-bis | TGATGATTTTTAATTGGAGGATTAAAGTTGGTTG | TCCCTCCATCCTCCCCAACAACACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Wang, L.; Han, W.; Diao, S.; Suo, Y.; Li, H.; Mai, Y.; Wang, Y.; Sun, P.; Fu, J. Study of Sexual-Linked Genes (OGI and MeGI) on the Performance of Androecious Persimmons (Diospyros kaki Thunb.). Plants 2021, 10, 390. https://doi.org/10.3390/plants10020390
AMA Style
Wang L, Han W, Diao S, Suo Y, Li H, Mai Y, Wang Y, Sun P, Fu J. Study of Sexual-Linked Genes (OGI and MeGI) on the Performance of Androecious Persimmons (Diospyros kaki Thunb.). Plants. 2021; 10(2):390. https://doi.org/10.3390/plants10020390
Chicago/Turabian StyleWang, Liyuan, Weijuan Han, Songfeng Diao, Yujing Suo, Huawei Li, Yini Mai, Yiru Wang, Peng Sun, and Jianmin Fu. 2021. "Study of Sexual-Linked Genes (OGI and MeGI) on the Performance of Androecious Persimmons (Diospyros kaki Thunb.)" Plants 10, no. 2: 390. https://doi.org/10.3390/plants10020390
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
