Next Article in Journal
Joint Biofortification of Plants with Selenium and Iodine: New Field of Discoveries
Previous Article in Journal
Morphological Characteristics of Grapevine Cultivars and Closed Contour Analysis with Elliptic Fourier Descriptors
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 7
10.3390/plants10071351
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Siberian Wildrye (Elymus sibiricus L.) Abscisic Acid-Insensitive 5 Gene Is Involved in Abscisic Acid-Dependent Salt Response

by
Ying De
1,2,
Fengling Shi
1,*,
Fengqin Gao
2,
Huaibin Mu
2 and
Weihong Yan
2
1
College of Grassland, Resources and Environment, Inner Mongolia Agricultural University, Hohhot 010011, China
2
Chinese Academy of Agricultural Sciences, Grassland Research Institute, Hohhot 010010, China
*
Author to whom correspondence should be addressed.
Plants 2021, 10(7), 1351; https://doi.org/10.3390/plants10071351
Submission received: 8 May 2021 / Revised: 23 June 2021 / Accepted: 25 June 2021 / Published: 2 July 2021
(This article belongs to the Topic Physiological and Molecular Characterization of Crop Tolerance to Abiotic Stresses)
Browse Figures
Review Reports Versions Notes

Abstract

:
Siberian wildrye (Elymus sibiricus L.) is a salt-tolerant, high-quality forage grass that plays an important role in forage production and ecological restoration. Abscisic acid (ABA)-insensitive 5 (ABI5) is essential for the normal functioning of the ABA signal pathway. However, the role of ABI5 from Siberian wildrye under salt stress remains unclear. Here, we evaluated the role of Elymus sibiricus L. abscisic acid-insensitive 5 (EsABI5) in the ABA-dependent regulation of the response of Siberian wildrye to salt stress. The open reading frame length of EsABI5 isolated from Siberian wildrye was 1170 bp, and it encoded a 389 amino acid protein, which was localized to the nucleus, with obvious coiled coil areas. EsABI5 had high homology, with ABI5 proteins from Hordeum vulgare, Triticum monococcum, Triticum aestivum, and Aegilops tauschii. The conserved domains of EsABI5 belonged to the basic leucine zipper domain superfamily. EsABI5 had 10 functional interaction proteins with credibility greater than 0.7. EsABI5 expression was upregulated in roots and leaves under NaCl stress and was upregulated in leaves and downregulated in roots under ABA treatment. Notably, tobacco plants overexpressing the EsABI5 were more sensitive to salt stress, as confirmed by the determining of related physiological indicators. EsABI5 expression affected the ABA and mitogen-activated protein kinase pathways. Therefore, EsABI5 is involved in antisalt responses in these pathways and plays a negative regulatory role during salt stress.

1. Introduction

Abscisic acid (ABA) is a vital plant hormone that orchestrates plants in their adaptive response to abiotic stresses, such as salt, drought, and cold stresses, and regulates complicated metabolic and physiological mechanisms essential for survival in adverse environments [1,2,3,4]. ABA will quickly accumulate and cause stomatal closure to limit water loss through transpiration under abiotic stresses. In addition, ABA will mobilize a series of genes that can protect cells from ensuing oxidative damage due to prolonged stress, and the signaling network mediating these various responses against abiotic stresses is highly complex [5,6]. ABA is involved in complex signaling networks, including the PYR/PYL/RCAR ABA receptor, PP2C protein phosphatase, SnRK2 protein kinase, and ABI5/AREB/ABF transcription factor networks [7,8]. ABA-insensitive 5 (ABI5) is a member of the bZIP A subfamily and has been shown to regulate ABA signaling and stress-induced gene expression [9,10]. In the regulatory network of plants, ABI5 is activated by SNF1-related protein kinase 2 self-phosphorylation, binds to ABA response elements (ABREs) on the promoter of ABA-responsive genes, and regulates ABA-induced gene expression [11]. ABREs in the ABI5 promoter region (between −1376 and −455 bp) are enriched by ABRE binding factor 3 (ABF3) in Arabidopsis thaliana under normal conditions and in the context of 150 mM NaCl salt stress [12]. The expression of ABI5 is regulated by ABF3 and can contribute to the salt tolerance of Arabidopsis thaliana [13]. The ubiquitin 26S proteasome (26SP) inhibits degradation of the ABI5 binding protein to stabilize the activity of ABI5 [14], thereby resulting in the regulation of ABI5 expression in the nucleus and cytoplasm and subsequently affecting the activity of the ABA signaling pathway [15,16]. The 26SP system can effectively degrade many key regulatory factors involved in plant development, and the β5 subunits of the 26SP system are essential for promoting plant growth under salt stress. PBE1 is a β5 subunit that regulates the ABI5 protein and modulates the expression of several downstream genes under stress conditions [17]. ABI5 mediates many important physiological processes of plants, including late embryonic development, adverse stress reactions, and plant growth/tolerance in response to abiotic stress [18,19,20,21,22]. OsABI5, which has been isolated from the panicle of Oryza sativa L., is a bZIP transcription factor involved in rice fertility and stress tolerance; the expression of OsABI5 is induced by ABA and high salinity and suppressed by drought and cold (4 °C) in seedlings, while its overexpression in rice confers high sensitivity to salt stress [2]. Barley (Hordeum vulgare)-derived ABI5 is involved in the ABA-dependent drought response [22], and Chinese cabbage (Brassica rape)-derived ABI5s, i.e., BrABI5a and BrABI5b, are significantly induced by ABA, acting as positive modulators of ABA signaling [23]. The expression of ZmABI5, which has been isolated from maize (Zea mays L.), is upregulated in maize leaves and downregulated in maize roots under NaCl and ABA treatments; additionally, when transgenic tobacco plants overexpressing ZmABI5 were treated with NaCl, mannitol, or high and low temperatures, they displayed obvious stress-sensitive phenotypes, and they play important negative regulatory roles in stress responses [24].
Siberian wildrye (Elymus sibiricus L.) is a typical species of the genus Elymus, which has resistance to cold, drought, and salt, and can grow well in barren, highly saline, or high humus soils, making it one of the main planting grasses in northern China. Siberian wildrye is also widely utilized in animal feed and is important for ecological environment protection. Moreover, this plant is an important source of stress resistance genes for wheat family-related crops and is commonly used for natural grassland grazing, artificial grass planting, and degraded grassland restoration, making it an excellent grass for ecological governance and animal husbandry [25,26,27].
Siberian wildrye is a salt-tolerant and high-quality forage; it not only has large potency in saline–alkali management but is also an important resistant gene source for Triticeae crops. The ABA signaling pathway plays a very vital role for plants in response to salt stress, and ABI5 is an important transcription factor in the ABA signal transduction pathway. To date, few ABI5 have been characterized in Siberian wildrye. Herein, we focused on elucidating the role of ABI5 from Siberian wildrye (EsABI5) in ABA signaling during salt stress responses. Our findings clearly indicate that EsABI5 is involved in ABA-dependent salt responses, which can provide a theoretical basis for the study of salt-tolerant regulation, molecular mechanism, and breeding of Siberian wildrye.

2. Results

2.1. Isolation and Basic Analysis of EsABI5

In this study, EsABI5 was isolated from Siberian wildrye and had a total length of 1563 bp, including a 1170 bp open reading frame, and it encoded a protein of 389 amino acids. The molecular formula of EsABI5 is C1747H2812N528O561S34, including 5682 atoms, and its molecular mass is 41,278.79 Da. The theoretical isoelectric point was 5.74, and the EsABI5 protein showed nuclear localization. The protein residues in the 300–382 amino acid region (windows 14, 21, and 28) showed different coiled coil structures (Figure 1).
Three related domains with low E values were obtained at positions 304–364 in the coiled coil; these domains included bZIP_plant_bZIP46, basic region leucine zipper (BRLZ), and BZIP_1, indicating that the protein belongs to the bZIP transcription factor family (Figure 2, Table 1).
We screened out nine sequences that had homology with the EsABI5 protein by BLASTp and performed phylogenetic tree analysis (Figure 3). EsABI5 was most homologous with HvABI5 (Hordeum vulgare), TmABI5 (Triticum monococcum), TaABI5 (Triticum aestivum), TuABI5 (Triticum uratu), and AtaABI5 (Aegilops tauschii), showing high homology and close relationships. Lower homology and distant relationships were observed with OsABI5 (Oryza sativa), ZmABI5 (Zea mays), AtABI5 (Arabidopsis thaliana), and SvABI5 (Setariaviridis).
We found 10 proteins that interacted with EsABI5 (credibility score > 0.7; Figure 4). The B3 domain containing the protein VP1 (VP1B3) had a credibility score of 0.916, which is the best functional partner of the EsABI5 protein. Two of these proteins were uncharacterized (UP); the others were ABA-inducible protein kinase (ABAIPK), CBL-interacting protein kinase 22 (CIPK22), WD repeat-containing protein DWA1 (DWA1WD), CBL-interacting protein kinase 29 (CIPK29), E3 ubiquitin-protein ligase KEG (KEGE3), serine/threonine-protein kinase SAPK8 (SAPK8), and serine/threonine-protein kinase SAPK3 (SAPK3). All of these functional interacting proteins play regulatory roles in plant stress.

2.2. Subcellular Localization of EsABI5

We examined the subcellular location of the EsABI5 protein. GFP-fused EsABI5 was mainly localized to the nucleus of the cells (Figure 5). These data indicate that EsABI5 is a nuclear protein, and imply that EsABI5 is a transcription factor.

2.3. Expression of EsABI5 under Salt and ABA Treatment

Under salt stress, the expression of EsABI5 increased in both leaves and roots, but the degree of upregulation in leaves (approximately three times that of the control) was greater than that in roots (approximately 1.5 times that of the control). Under ABA treatment, the expression of EsABI5 in leaves first increased and then decreased. The expression of EsABI5 was significantly different under different ABA concentrations (p < 0.05). When the ABA concentration was 50 µM, the expression of EsABI5 was significantly higher than that of other treatments (p < 0.05) and approximately seven times higher than that of the control (Figure 6). The expression of EsABI5 was significantly downregulated in roots (p < 0.05), but there were no significant differences under different ABA concentrations (p > 0.05). When the ABA concentration was 50 µM, the expression of EsABI5 was 41 times lower than that of the control (Figure 7). Thus, EsABI5 is involved in salt stress and ABA hormone regulation, and the roots may be the key antisalt organ of Siberian wildrye.

2.4. Decreased Salt Tolerance of EsABI5 Transgenic Tobacco

OT became more yellow and wilted compared with WT plants under salt stress (Figure 8), demonstrating that transgenic tobacco is more sensitive to salt stress. This result was further confirmed by evaluating the related physiological indicators (Figure 9).
Under salt stress, the malondialdehyde (MDA) content of transgenic tobacco (OT) was significantly higher than that of WT tobacco (p < 0.05). Superoxide dismutase (SOD) activity in OT was significantly lower than that in WT tobacco (p < 0.05). The soluble sugar content of OT was significantly higher than that of WT tobacco (p < 0.05). Additionally, under salt stress, the soluble sugar content of OT decreased, whereas that of WT tobacco increased. The proline content of OT was significantly lower than that of WT tobacco (p < 0.05). Taken together, the results of the phenotypic and physiological indicators show that EsABI5 plays a negative regulatory role during salt stress.

2.5. Involvement of EsABI5 in ABA and MAPK Signaling Pathways in Response to Salt Stress

Under salt stress, the ABA content of cells increases rapidly, after which ABA binds to PYR/PYL/RCAR receptors and triggers a second messenger Ca2+ signaling system. These bind to PP2C to form an ABA-PYR/PYL-PP2C complex that releases the SnRK2 protein kinase, which is inhibited by PP2C. In addition, SnRK2 can activate the downstream transcription factor ABI5 and MAPKKK-MAPKK-MAPK cascade reactions. ABI5 can lead to stomatal closure and, thus, affect the salt tolerance of plants. The MAPKKK-MAPKK-MAPK cascade can directly or indirectly participate in the salt tolerance of plants (Figure 10a).
To elucidate the mechanisms through which EsABI5 overexpression decreases salt tolerance in OT, we analyzed the expression of 15 genes related to the ABA and MAPK pathways (Figure 10b). The expression levels of eight of these genes, including PYL4, PYL9, CPK17, ABI1, MEK1, MKK3, and MPK7, were significantly lower in WT tobacco than in OT (p < 0.05). Additionally, the expression levels of four genes, namely ABI2, SAPK3, MPK4, and MPK17, were lower in WT tobacco than in OT, although the differences were not significant (p > 0.05). Furthermore, the expression levels of SAPK2 and MAPKKK17 were significantly higher in WT tobacco than in OT (p < 0.05), and the expression levels of SAPK9 and SAPK10 were higher in WT tobacco than in OT, although the differences were not significant (p > 0.05). Expression of all genes except MPK17 were downregulated in WT tobacco, and expression of all genes except SAPK3, MEK1, MKK3, MPK7, and CPK17 were downregulated in OT tobacco under salt stress. There were complex regulatory relationships between EsABI5 and these genes, and overexpression of EsABI5 affected the ABA and MAPK pathways. Therefore, EsABI5 is involved in antisalt responses in the ABA signal transduction pathway and MAPK cascade pathway and plays a negative regulatory role during salt stress.

3. Discussion

In this study, we isolated and evaluated EsABI5 from Siberian wildrye for the first time, making it possible to initiate studies into the role of EsABI5 in the regulation of ABA and salt responses in Siberian wildrye. EsABI5 showed high similarity to HvABI5, TmABI5 (Triticum monococcum), TaABI5 (Triticum aestivum), and AtABI5 (Aegilops tauschii). Subcellular localization showed that the EsABI5 protein was mainly localized in the nucleus. Moreover, EsABI5 contained the structural proteins bZIP46, CBLZ, and bZIP1, which belong to the bZIP superfamily. Therefore, we conclude that EsABI5 belongs to the bZIP transcription factor family, consistent with the results for OsABI5 [2], HvABI5 [22], and ZmABI5 [24]. Members of the bZIP family are involved in the ABA signaling pathway, which can be fully activated by ABA. As a regulator of ABA signaling and stress tolerance, bZIP plays an important role in ABA responses [3,28,29,30,31,32].
EsABI5 had 10 functional interaction proteins. We found a high correlation between VP1B3 and EsABI5. The B3 domain is a highly conserved domain that is present in many higher plant genomes and can bind to DNA. The B3 domain of the VP1 protein has sequence-specific DNA binding activity that can play a regulatory role in plant growth, development, and stress by binding to specific DNA [33]. Calcium (Ca2+) is an essential nutrient in eukaryotes and signaling mediums. In plants, calcineurin B-like proteins (CBLs) are a unique set of Ca2+ sensors that unlock Ca2+ signals by activating a series of plant-specific protein kinases (CIPKs) [34]. CBLs are involved in decoding calcium signals, have no kinase activity on their own, and can only transmit signals downstream through CIPK interactions [35,36]. CBL/CIPK interactions are also involved in ABA-dependent signaling processes [37]. CIPK is a Ca-dependent, CBL-specific serine/threonine (Ser/Thr) targeting protein kinase belonging to the sucrose nonfermenting-related protein kinase (SnRK3) family, which interacts with the CBL protein and plays a key role in sensing calcium signals and transmitting stress response signals [38]. SAPK3 and SAPK8 are Ser/Thr SnRK2 protein kinases and members of the SnRK2 family closely related to plant resistance; overexpression of SnRK2 activates the expression of a downstream series of resistor-related genes, thus improving plant resistance [39,40]. KEG is an important RING-type E3 that negatively regulates ABA signal transduction by targeting ABI5 for ubiquitination and degradation. ABI5 is degraded following ubiquitination by KEG [41,42]. When plants detect ABA, they promote the self-ubiquitination and degradation of KEG, thereby reducing KEG-mediated ABI5 degradation and promoting the ABA signal response [43]. The MAPK cascade is an important signal transduction pathway in plants that respond to salt stress. Notably, KEG degrades and regulates key genes in the MAPK cascade by ubiquitinating MKK4 and MKK5 proteins [44]. ABA exposure and adverse stress can activate CIPK26, which can phosphorylate KEG and ABI5, activate the transcriptional activity of ABI5, and promote KEG self-ubiquitination and degradation, further leading to a reduction in KEG-mediated CIPK26 and ABI5 degradation and, thus, enhancing plant responses to ABA [45]. The WD protein is involved in the biological processes of various cells and organisms and plays an important role in the regulation and development of plant growth under adverse conditions, such as high salt, drought, and low temperature [46,47,48]. DWA1 is involved in regulating the level of jasmonic acid, which plays an important regulatory role in the growth and development of plants and is necessary for plants to resist stress and complete their growth/development and life cycle [49,50]. The WD40 replication protein (WD40 protein), a universal scaffold for protein interactions, is involved in various biological processes such as plant stress and hormone responses. The WD40 protein 1 (XIW1) interacts with Xpo1 following exposure to ABA in the nucleus. Moreover, XIW1 interacts with ABI5 to maintain its stability. Under salt stress, mutations in XIW1 reduce the induction of ABI5 and ABA response genes [51]. Overall, these results support the involvement of EsABI5 in the ABA signaling pathway and in plant adaptation to stress.
Salt stress can regulate ABI5 expression [52]. Under salt stress, the expression of AtABI5 in Arabidopsis leaves is upregulated, but not significantly; however, significant upregulation has been observed in roots [53,54]. Salt resistance and sensitivity in sorghum (Sorghum bicolor) are not obviously altered in the leaves following changes in SbABI5 expression; however, increases have been observed in the roots of SbABI5 salt-tolerant germplasm, consistent with observations in Arabidopsis thaliana. Thus, SbABI5 may be the key salt resistance-related gene in the SbABIs family, and root SbABI5 expression may be a critical parameter in the ABA signal transduction pathway modulating sorghum salt resistance. After 20 µM ABA treatment, SbABI5 expression was significantly upregulated in the roots of the two germplasms, whereas after 100 µM ABA treatment, SbABI5 expression was not significantly altered, indicating that a high concentration of ABA could inhibit the expression of SbABI5 [54]. In this study, the expression of EsABI5 was upregulated in both roots and leaves under NaCl stress; however, the extent of upregulation in the leaves (3-fold) was higher than that in the roots (1.5-fold). Under ABA treatment, EsABI5 was upregulated in the leaves but was downregulated in the roots. EsABI5 expression in the roots was not as sensitive to ABA concentration changes as that in the leaves, but the extent of downregulation in the roots (41-fold) was higher than the extent of upregulation in the leaves (7-fold). Therefore, these findings support that EsABI5 is related to salt stress and the ABA regulation mechanism. The results of this study also show that with an increase in ABA concentration, the expression of leaves EsABI5 increases and then decreases; this is opposite for roots EsABI5, indicating that ABA plays a positive regulatory role within a certain concentration range and may play a negative regulatory role beyond this concentration. This result is similar to Gietler’s [55].
The physiological and molecular mechanisms through which plants respond to salt stress are complex. Growth and development, hormones, metabolism, osmotic adjustment, membrane protective material and active oxygen balance, salt stress proteins, and plant salt stress information transmission mechanisms in the body can change via modulation of related gene expression; however, the specific functions of most of the genes related to these factors are unknown [56,57]. Due to tobacco’s short growth cycle, mature transgenic technology, and simple and easy operation of the transgenic process, tobacco is often used as experimental material for the identification of exogenous functional genes, which speeds up the research progress of functional genes. In this study, we evaluated the functions of EsABI5, a core transcription factor in the ABA signaling system in Siberian wildrye under salt stress. The amplified CDS fragment of EsABI5 was successfully introduced into the vector pART-CAM, and the tobacco leaf disk was infected by the Agrobacterium-mediated method. The buds were then induced to differentiate, and after about 6 months of tissue culture, positive lines were obtained. After polymerase chain reaction (PCR) and RT-qPCR detection of the tobacco plants overexpressing, the EsABI5 (OT) showed that the morphology of OT was significantly altered. For example, the plant height, roots, and leaves of transgenic plants were larger than those of WT plants, consistent with the involvement of ABI5 in plant seedling growth [29]. OT and WT tobacco were then exposed to salt stress, and the results showed that transgenic plants were more sensitive to salt stress. This result was further confirmed by evaluation of related physiological indicators.
The ABA signal transduction pathway and MAPK cascade pathway are important pathways regulating plant responses to salt stress. The MAPK cascade pathway can directly or indirectly participate in the ABA signal transduction pathway, and the ABA signal pathway can also regulate the expression of related genes in the MAPK cascade pathway [58,59]. The MEKK1/MKK1/MKK2/MPK4 axis of the MAPK signaling pathway exists in Arabidopsis thaliana, and mekk1 mutants show tolerance to salt [60]. MAPKK1 [61], MPK4, MPK6 [62], MKK9, MPK3 [63,64], and OsMAPK44 [65] in rice can all be activated by salt. Additionally, GhMPK7 in cotton [66] and ZmMPK3 in maize [67] are involved in the response to salt stress. In this study, among 15 genes related to ABA and MAPK pathways, the expression of 11 genes was lower in WT tobacco than in OT, whereas the expression of four genes was higher in WT tobacco than in OT. Under salt stress, all genes except MPK17 were downregulated in WT tobacco, whereas all genes except SAPK3, MKK3, MAPKKK17, MEK1, and CPK17 were downregulated in OT. There are complex regulatory relationships between EsABI5 and these genes, and overexpression of EsABI5 affected the expression of genes related to the ABA and MAPK pathways. Yan [24] speculated that ZmABI5 might affect the MAPK cascade, consistent with the results of this study.
Overall, these results show that EsABI5 is involved in antisalt responses in the ABA signal transduction pathway and MAPK cascade pathway and acts as a negative regulator. These findings establish a basis for further studies into the mechanism of ABA signaling in Siberian wildrye and salt-tolerant regulation in Siberian wildrye and related plants. In our subsequent studies, we will evaluate the mechanisms of EsABI5 under other abiotic stresses and hormonal treatments.

4. Materials and Methods

4.1. Materials

High-salinity Siberian wildrye (Tuzuo Banner of Hohhot City, Inner Mongolia, China, E 111°27′, N 40°47′, H 1157 m) was cultivated to obtain seedlings for antisalt experiments. Uniform, plump seeds were selected, and the lemma were removed using an ultra-clean workbench. Samples were washed with distilled water once, sterilized with NaClO for 15 min, rinsed with distilled water four times, and placed in Petri dishes (50 seeds/dish). After seeds grew to 2–3 cm, the buds were planted in double disks. When the seedlings cultured with distilled water had grown to approximately 5–6 cm, Hoagland nutrient solution was added and replaced with distilled water every 3 days. Plants were grown in a 25 °C light incubator with 37% humidity, 14-h light/10-h dark cycle, and 164 μM·m−2·s−1 light intensity. The experiments were repeated three times. When the second true leaf emerged, some of the samples were used as controls, some were placed in 250 mM NaCl solution, and some were placed in 20, 50, or 100 µM exogenous ABA (cat. no. CA1011, Coolaber, Beijing, China) solution. Assessments of biological processes were repeated three times. When the phenotype changed, the leaves and roots of 5 different treatments were single collected, quickly frozen in liquid nitrogen, and stored at −80 °C.

4.2. Primer Design

Premier 5.0 software was used to identify the homologous region of the ABI5 gene of related species, including Triticum aestivum (KX002276.1, AF519804), T. monococcum (AB286054.1), and Aegilops tauschii subsp. Tauschii (XM_020327051), and to design the primers. All primer sequences are shown in Table 2 and Table 3, and all primers were synthesized by Invitrogen (Carlsbad, CA, USA).

4.3. Reverse Transcription Quantitative PCR, PCR Product Purification, and Clone Sequencing

TRIzol Universal Total RNA Extraction Reagent (cat. no. DP405; Tiangen, Beijing, China) was used to extract RNA from samples. A PrimeScript 1st Strand cDNA Synthesis Kit, 3′-Full RACE Core Set with PrimeScriptRTase, and Smarter RACE 5′/3′ Kit were used to synthesize cDNA (TaKaRa, Dalian, China). TaKaRaTksGflex DNA Polymerase was used for PCR. A TakaRaMiniBEST Agarose Gel DNA Extraction Kit ver. 4.0 was used to recover and purify the PCR product bands. The purified products were treated with a DNA A-Tailing Kit. Ligase from TaKaRa DNA Ligation Kit ver. 2.1 was used for ligation with the T-Vector pMDTM20. The plasmid was heat transferred into Escherichia coli competent cells (JM109), and cells were cultured overnight at 37 °C. Positive single clones were selected and designated CTG0957-PCR-1 and CTG0957-PCR-2. The primers M13-47 and RV-M were used for sequencing.

4.4. Bioinformatics Analysis of EsABI5

The obtained open reading frame base sequence of EsABI5 was translated into an amino acid sequence using Bioedit V7.0. The amino acid sequence was imported into the NCBI BLAST database for BLASTp analysis against nine amino acid sequences showing homology with EsABI5 protein. Phylogenetic trees were generated using Mega 7.0 with the neighbor-joining method, and the phylogenetic relationships were analyzed. NCBI was used to predict EsABI5 domains, and PROSITE (https://prosite.expasy.org/, accessed on 10 March 2020) was used to generate images. String (https://string-db.org/, accessed on 10 March 2020) was used to analyze the protein interaction network, and Cytoscape 3.7.1 was used to plot the protein interaction network. All default settings were used.

4.5. Subcellular Localization

TreliefTMSoSoo Cloning Kit Ver. 2 (cat. no. TSV-S2, Tsingke, Beijing, China) was used to clone the CDS of EsABI5, and pCAMBIA1302 was the vector. The pCAMBIA1302-EsABI5 plasmid was introduced into the Agrobacterium tumefaciens strain GV3101; other parts of this method were similar to Bai’s [23].

4.6. Real-Time Fluorescence Quantitative PCR

The reaction mixture (total volume 20 μL) included 10 μL SYBR Premix Ex Taq (2×), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 2 µg cDNA, and ddH2O. The two-step fluorescence quantitative PCR amplification conditions were as follows: 95 °C for 5 min; 40 cycles of 95 °C for 10 s and 60 °C for 30 s; detection at 72 °C; and a dissolution curve of 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s, with continuous signal detection. Gapdh and NbUbe3 served as the internal reference genes for normalizing the expression of EsABI5 plants and WT, respectively [68,69]. The 2−△△Ct method was used to calculate relative gene expression [70].

4.7. Overexpression Vector Construction, Tobacco Transformation, and Line Propagation

The amplified CDS of EsABI5 was successfully constructed into the vector pART-CAM, which used the method of restriction enzyme double digestion. Tobacco leaf disks were infected using an Agrobacterium-mediated method, and the buds were induced to differentiate, yielding positive buds. Twelve transgenic lines were obtained by screening resistant culture mediums and by PCR detection using specific primers. Transgenic and WT tobacco seedlings with consistent growth were selected and transplanted into flowerpots (sandy soil:nutrientsoil:vermiculite = 1:1:0.5) at 25 °C with 60% humidity, 14-h/10-h light/dark cycle, and 61.64 μM·m−2·s−1 light intensity. After normal watering and culture for 2 weeks, 4 transgenic lines were detected by PT-qPCR (primers were EsABI5-F1 and EsABI5-R1). Then, transgenic and WT tobacco were irrigated with 250 mM NaCl solution, weighing water daily. Distilled water was used as the control group.

4.8. Physiological Indexes and Data Analyses

MDA content and SOD activity were determined by malondialdehyde (MDA) (cat. no. BC0025; Solarbio, Beijing, China) assay kits and superoxide dismutase (SOD) (cat. No. WFY1; Cominbio, Suzhou, China) assay kits, respectively. Soluble sugar content was determined by anthrone colorimetry. Proline content was determined by ninhydrin colorimetry.
Data were collated using Microsoft Excel 2016 software and plotted using SigmaPlot 12.5 software and Adobe Illustrator CC 2018. SPSS 20.0 software was used for variance analysis (Duncan method, p < 0.05).

Author Contributions

F.S. and Y.D. conceived and designed the experiments. Y.D., H.M., and W.Y. performed the experiments. Y.D. and F.G. analyzed the figures. Y.D. wrote the paper. F.S. and Y.D. discussed the results and commented on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (grant no. 31802121), the Science, Technology Project of Inner Mongolia, China (grant no. 2020GG0063), and the Natural Science Foundation of Inner Mongolia, China (grant no. 2014MS0367).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequence for EsABI5 was deposited in GenBank (accession number: MN607227.1).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Uno, Y.C.; Furihata, T.; Abe, H.; Yoshida, R.; Shinozaki, K.; Shinozaki, K.Y. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 11632–11637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Zou, M.J.; Guan, Y.C.; Ren, H.B.; Zhang, F.; Chen, F.A. bZIP transcription factor, OsABI5, is involved in rice fertility and stress tolerance. Plant Mol. Biol. 2008, 66, 675–683. [Google Scholar] [CrossRef] [PubMed]
  3. Yang, X.; Yang, Y.N.; Xue, L.J.; Zou, M.J.; Liu, J.Y.; Chen, F.; Xue, H.W. Rice ABI5-like1 regulates abscisic acid and auxin responses by affecting the expression of ABRE-containing genes. Plant Physiol. 2011, 156, 1397–1409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. RuizPartida, R.; Rosario Sttefany, M.; LozanoJuste, J. An update on crop ABA receptors. Plants 2021, 10, 1087. [Google Scholar] [CrossRef]
  5. Bharath, P.; Gahir, S.; Raghavendra, A.S. Abscisic acid-induced stomatal closure: An important component of plant defense against abiotic and biotic Stress. Front. Plant Sci. 2021, 12, 615114. [Google Scholar] [CrossRef]
  6. Wasilewska, A.; Vlad, F.; Sirichandra, C.; Redko, Y.; Jammes, F.; Valon, C.; Frey, N.F.D.; Leung, J. An update on abscisic acid signaling in plants and more. Mol. Plant 2008, 1, 198–217. [Google Scholar] [CrossRef] [Green Version]
  7. Chen, K.; Li, G.J.; Bressan, R.A.; Song, C.P.; Zhu, J.K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol. 2020, 62, 25–54. [Google Scholar] [CrossRef] [Green Version]
  8. Hubbard, K.E.; Nishimura, N.; Hitomi, K.; Getzoff, E.D.; Schroeder, J.I. Early abscisic acid signal transduction mechanisms: Newly discovered components and newly emerging questions. Gene Dev. 2010, 24, 1695–1708. [Google Scholar] [CrossRef] [Green Version]
  9. Finkelstein, R.R.; Lynch, T.J. The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 2000, 12, 599–609. [Google Scholar] [CrossRef] [Green Version]
  10. Lopez, M.L.; Mongrand, S.; Chua, N.H. A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proc. Natl. Acad. Sci. USA 2001, 98, 4782–4787. [Google Scholar] [CrossRef] [Green Version]
  11. Nishimura, N.; Yoshida, T.; Kitahata, N.; Asami, T.; Shinozaki, K.; Hirayama, T. ABA-hypersensitive germination 1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed. Plant J. 2007, 50, 935–949. [Google Scholar] [CrossRef]
  12. Chen, T.T.; Liu, F.F.; Xiao, D.W.; Jiang, X.Y.; Li, P.; Zhao, S.M.; Hou, B.K.; Li, Y.J. The Arabidopsis UDP-glycosyltransferase75B1, conjugates abscisic acid and affects plant response to abiotic stresses. Plant Mol. Biol. 2020, 102, 389–401. [Google Scholar] [CrossRef]
  13. Chang, H.C.; Tsai, M.C.; Wu, S.S.; Chang, I. Regulation of ABI5 expression by ABF3 during salt stress responses in Arabidopsis thaliana. Bot. Stud. 2019, 60, 16. [Google Scholar] [CrossRef] [Green Version]
  14. Xu, J.W.; Chen, Y.H.; Qian, L.F.; Mu, R.; Yuan, X.; Fang, H.M.; Huang, X.; Xu, E.S.; Zhang, H.S.; Huang, J. A novel RNA-binding protein involves ABA signaling by post-transcriptionally repressing ABI2. Front. Plant Sci. 2017, 24, 24. [Google Scholar] [CrossRef] [Green Version]
  15. Liu, H.X.; Stone, S.L. Regulation of ABI5 turnover by reversible post-translational modifications. Plant Signal. Behav. 2014, 9, e27577. [Google Scholar] [CrossRef] [Green Version]
  16. Seo, K.I.; Lee, J.H.; Nezames, C.D.; Zhong, S.W.; Song, E.Y.; Byun, M.O. ABD1 is an Arabidopsis DCAF substrate receptor for CUL4-DDB1-based E3ligases that acts as a negative regulator of abscisic acid signaling. Plant Cell 2014, 26, 695–711. [Google Scholar] [CrossRef] [Green Version]
  17. Han, J.J.; Yang, X.Y.; Wang, Q.; Tang, L.; Yu, F.F.; Huang, X.H.; Wang, Y.C.; Liu, J.X.; Xie, Q. The β5 subunit is essential for intact 26S proteasome assembly to specifically promote plant autotrophic growth under salt stress. New Phytol. 2019, 221, 1359–1368. [Google Scholar] [CrossRef] [Green Version]
  18. Skubacz, A.; Daszkowska, G.A.; Szarejko, I. The role and regulation of ABI5 (ABA-insensitive 5) in plant development, abiotic stress responses and phytohormone crosstalk. Front. Plant Sci. 2016, 7, 1884. [Google Scholar] [CrossRef] [Green Version]
  19. Kim, S.Y.; Ma, J.Z.; Perret, P.; Li, Z.S.; Thomas, T.L. Arabidopsis ABI5 subfamily members have distinct DNA-binding and transcriptional activities. Plant Physiol. 2002, 130, 688–697. [Google Scholar] [CrossRef] [Green Version]
  20. Garcia, M.E.; Lynch, T.; Peeters, J.; Finkelstein, R. A small plant-specific protein family of ABI five binding proteins (AFPs) regulates stress response in germinating Arabidopsis seeds and seedlings. Plant Mol. Biol. 2008, 67, 643–658. [Google Scholar] [CrossRef]
  21. Finkelstein, R. Abscisic acid: A seed maturation and stress response hormone. In Plant Physiology, 5th ed.; Taiz, L., Zeiger, E., Eds.; Sinauer Associates Press: Sunderland, UK, 2010; pp. 573–698. [Google Scholar]
  22. Collin, A.; Golec, A.D.; Kurowska, M.; Szarejko, I. Barley ABI5 (Abscisic acid insensitive 5) is involved in abscisic acid-dependent drought response. Front. Plant Sci. 2020, 11, 1138. [Google Scholar] [CrossRef]
  23. Bai, Y.L.; Zhu, W.B.; Hu, X.C.; Sun, C.C.; Li, Y.L.; Wang, D.D.; Wang, Q.H.; Pei, G.L.; Zhang, Y.F.; Guo, A.G.; et al. Genome-wide analysis of the bZIP gene family identifies two ABI5-like bZIP transcription factors, BrABI5a and BrABI5b, as positive modulators of ABA signaling in Chinese cabbage. PLoS ONE 2016, 11, e0158966. [Google Scholar] [CrossRef]
  24. Yan, F.; Deng, W.; Wang, X.M.; Yang, C.W.; Li, Z.G. Maize (Zea mays L.) homologue of ABA-insensitive (ABI) 5 gene plays a negative regulatory role in abiotic stresses response. Plant Growth Regul. 2012, 68, 383–393. [Google Scholar] [CrossRef]
  25. Liu, M.; Gong, J.R.; Zhang, Z.Y.; Wang, Y.H. Progress in drought resistance and cold tolerance of artificial pastures in northern arid areas. J. NW Univ. 2015, 43, 56–62. [Google Scholar]
  26. Zhang, J.C.; Xie, W.G.; Yu, X.X.; Zhang, Z.Y.; Zhao, Y.Q.; Wang, N.; Wang, Y.R. Selection of suitable reference genes for RT-qPCR gene expression analysis in Siberian wild rye (Elymus sibiricus) under different experimental conditions. Genes 2019, 10, 451. [Google Scholar] [CrossRef] [Green Version]
  27. Lei, X.; Liu, W.H.; Zhao, J.M.; You, M.H.; Xiong, C.H.; Xiong, Y.; Xiong, Y.L.; Yu, Q.Q.; Bai, S.Q.; Ma, X. Comparative physiological and proteomic analysis reveals different involvement of proteins during artificial aging of Siberian wildrye seeds. Plants 2020, 9, 1370. [Google Scholar] [CrossRef]
  28. Hossain, M.A.; Cho, J.I.; Han, M.; Ahn, C.H.; Jeon, J.S.; An, G.; Park, P.B. The ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of abiotic stress and ABA signaling in rice. J. Plant Physiol. 2010, 167, 1512–1520. [Google Scholar] [CrossRef] [PubMed]
  29. Yoshida, T.; Fujita, Y.; Sayama, H.; Kidokoro, S.; Maruyama, K.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant J. 2010, 61, 672–685. [Google Scholar] [CrossRef]
  30. Tang, N.; Zhang, H.; Li, X.H.; Xiao, J.H.; Xiong, L.Z. Constitutive activation of transcription factor OsbZIP46 improves drought tolerance in rice. Plant Physiol. 2012, 158, 1755–1768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Kim, N.; Moon, S.J.; Min, M.K.; Choi, E.H.; Kim, J.A.; Koh, E.Y.; Yoon, I.; Byun, M.O.; Yoo, S.D.; Kim, B.G. Functional characterization and reconstitution of ABA signaling components using transient gene expression in rice protoplasts. Front. Plant Sci. 2015, 6. [Google Scholar] [CrossRef] [Green Version]
  32. Tang, N.; Ma, S.; Zong, W.; Yang, N.; Lv, Y.; Yan, C.; Guo, Z.; Li, J.; Li, X.; Xiang, Y.; et al. MODD mediates deactivation and degradation of OsbZIP46 to negatively regulate ABA signaling and drought resistance in Rice. Plant Cell 2016, 28, 2161–2177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Luo, G.Y.; Ye, L.F.; Chen, X.B. Research progress of Arabidopsis B3 transcription factor gene superfamily. Chem. Life 2013, 33, 287–293. [Google Scholar]
  34. Tang, R.J.; Wang, C.; Li, K.L.; Luan, S. The CBL-CIPK calcium signaling network: Unified paradigm from 20 years of discoveries. Trends Plant Sci. 2020, 25, 604–617. [Google Scholar] [CrossRef] [PubMed]
  35. Kim, K.N.; Chong, Y.H.; Gupta, R.; Luan, S. Interaction specificity of Arabidopsis calcineur in B-like calcium sensors and their target kinases. Plant Physiol. 2000, 124, 1844–1853. [Google Scholar] [CrossRef] [Green Version]
  36. Batistic, O.; Kudla, J. Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK proteins kinase network. Planta 2004, 219, 915–924. [Google Scholar] [CrossRef]
  37. Kim, K.N.; Cheong, Y.H.; Grant, J.J.; Pandey, G.K.; Luan, S. CIPK3, a calcium sensor-associated protein kinase that regulates abscisic acid and cold signal transduction in Arabidopsis. Plant Cell 2003, 5, 411–427. [Google Scholar] [CrossRef] [Green Version]
  38. Kolukisaoglu, U.; Weinl, S.; Blazevic, D.; Batistic, O.; Kudla, J. Calcium sensors and their 32 protein kinases: Genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol. 2004, 134, 43–58. [Google Scholar] [CrossRef] [Green Version]
  39. Mao, X.; Zhang, H.; Tian, S.; Chang, X.; Jing, R. TaSnRK2.4, an SNF1-type serine/threonine protein kinase of wheat (Triticum aestivum L.), confers enhanced multistress tolerance in Arabidopsis. J. Exp. Bot. 2010, 61, 683–696. [Google Scholar] [CrossRef] [Green Version]
  40. Diédhiou, C.J.; Popova, O.V.; Dietz, K.J.; Golldack, D. The SNF1-type serine/threonine protein kinase SAPK4 regulates stress responsive gene expression in rice. BMC Plant Biol. 2008, 8, 49. [Google Scholar] [CrossRef] [Green Version]
  41. Chen, Y.T.; Liu, H.; Stone, S.; Callis, J. ABA and the ubiquitin E3 ligase KEEP ON GOING affect proteolysis of the Arabidopsis thaliana transcription factors ABF1 and ABF3. Plant J. 2013, 75, 965–976. [Google Scholar] [CrossRef] [Green Version]
  42. Lyzenga, W.J.; Liu, H.; Schofield, A.; Muise, H.A.; Muise-Hennessey, A.; Stone, S.L. Arabidopsis CIPK26 interacts with KEG, components of the ABA signaling network and is degraded by the ubiquitin-proteasome system. J. Exp. Bot. 2013, 64, 2779–2791. [Google Scholar] [CrossRef] [Green Version]
  43. Liu, H.; Stone, S.L. Abscisic acid increases Arabidopsis ABI5 transcription factor levels by promoting KEG E3 ligase self-ubiquitination and proteasomal degradation. Plant Cell 2010, 22, 2630–2641. [Google Scholar] [CrossRef] [Green Version]
  44. Gao, C.Y.; Sun, P.W.; Wang, W.; Tang, D.Z. Arabidopsis E3 ligase KEG associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. J. Integr. Plant Biol. 2020, 63, 327–339. [Google Scholar] [CrossRef]
  45. Lyzenga, W.J.; Sullivan, V.; Liu, H.X.; Stone, S.L. The kinase activity of calcineurin B-like interacting protein kinase 26 (CIPK26) influences its own stability and that of the ABA-regulated ubiquitin ligase, keep on going (KEG). Front. Plant Sci. 2017, 8, 502. [Google Scholar] [CrossRef] [Green Version]
  46. Xu, C.; Min, J.R. Structure and function of WD40 domain proteins. Protein Cell 2011, 2, 202–214. [Google Scholar] [CrossRef]
  47. Lee, S.H.; Lee, J.H.; Paek, K.H.; Kwon, S.Y.; Cho, H.S.; Kim, S.J.; Park, J.M. A novel WD40 protein, Bn SWD1, is involved in salt stress in Brassica napus. Plant Biotechnol. Rep. 2010, 4, 165–172. [Google Scholar] [CrossRef]
  48. Mishra, A.K.; Puranik, S.; Bahadur, R.P.; Prasad, M. The DNA-binding activity of an AP2 protein is involved in transcriptional regulation of a stress-responsive gene, Si WD40, in foxtail millet. Genomics 2012, 100, 252–263. [Google Scholar] [CrossRef] [Green Version]
  49. Zhu, X.Y.; Xiong, L.Z. Putative megaenzyme DWA1 plays essential roles in drought resistance by regulating stress-induced wax deposition in rice. Proc. Natl. Acad. Sci. USA 2013, 110, 17790–17795. [Google Scholar] [CrossRef] [Green Version]
  50. Wasternack, C. Jasmonates, an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann. Bot. 2007, 100, 681–697. [Google Scholar] [CrossRef] [Green Version]
  51. Xu, X.Z.; Wan, W.; Jiang, G.B.; Xi, Y.; Huang, H.J.; Cai, J.J.; Chang, Y.N.; Duan, C.G.; Mangrauthia, S.K.; Peng, X.X.; et al. Nucleocytoplasmic trafficking of the Arabidopsis WD40 repeat protein XIW1 regulates ABI5 stability and abscisic acid responses. Mol. Plant 2019, 12, 1598–1611. [Google Scholar] [CrossRef]
  52. Chen, C.T.; Wu, C.G.; Miao, J.M.; Lei, Y.X.; Zhao, D.X.; Sun, D.; Yang, G.D.; Huang, J.G.; Zheng, C.C. Arabidopsis SAG protein containing the MDN1 domain participates in seed germination and seedling development by negatively regulating ABI3 and ABI5. J. Exp. Bot. 2014, 65, 35–45. [Google Scholar] [CrossRef] [Green Version]
  53. Schmid, M.; Davison, T.S.; Henz, S.R.; Pape, U.J.; Demar, M.; Vingron, M.; Schlkopf, B.; Weigel, D.; Lohmann, J.U. A gene expression map of Arabidopsis thaliana development. Nat. Genet. 2005, 37, 501–506. [Google Scholar] [CrossRef]
  54. Sun, L.; Wang, C.; Zhou, Y.F.; Ruan, Y.Y.; Gong, X.; Zhang, J.; Huang, R.D. Inhibition of SbABI5 expression in roots by ultra-high endogenous ABA accumulation results in Sorghum sensitivity to salt Stress. Int. J. Agric. Biol. 2016, 18, 146–154. [Google Scholar] [CrossRef]
  55. Gietler, M.; Fidler, J.; Labudda, M.; Nykiel, M.; Marta, G.; Justyna, F.; Mateusz, L.; Malgorzata, N. Abscisic acid-enemy or saviour in the response of cereals to abiotic and biotic stresses? Int. J. Mol. Sci. 2020, 21, 4607. [Google Scholar] [CrossRef] [PubMed]
  56. Clement, M.; Lambert, A.; Herouart, D.; Boncompagni, E. Identification of new up-regulated genes under drought stress in soybean nodules. Gene 2008, 426, 15–22. [Google Scholar] [CrossRef]
  57. Brown, P.O.; Botstein, D. Exploring the new world of the genome with DNA microarrays. Nat. Genet. 1999, 21, 33–37. [Google Scholar] [CrossRef]
  58. Xing, Y.; Jia, W.S.; Zhang, J.H. AtMKK1 mediates ABA-induced CAT1 expression and H2O2 production via AtMPK6-coupled signaling in Arabidopsis. Plant J. 2008, 54, 440–451. [Google Scholar] [CrossRef]
  59. Zong, X.J.; Li, D.P.; Gu, L.K.; Li, D.Q.; Liu, L.X.; Hu, X.L. Abscisic acid and hydrogen peroxide induce a novel maize group C MAP kinase gene, ZmMPK7, which is responsible for the removalof reactive oxygen species. Planta 2009, 229, 485–495. [Google Scholar] [CrossRef]
  60. Su, S.H.; Suarez-Rodriguez, M.C.; Krysan, P. Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutation mekk1 and mpk4 suggests signaling pathway complexity. FEBS Lett. 2007, 581, 3171–3177. [Google Scholar] [CrossRef] [Green Version]
  61. Mizoguchi, T.; Hayashida, N.; Yamaguchi-Shinozaki, K.; Kamada, H.; Shinozaki, K. ATMPKs, a gene family of plant MAP kinases in Arabidopsis thaliana. FEBS Lett. 1993, 336, 440–444. [Google Scholar] [CrossRef] [Green Version]
  62. Ichimura, K.; Mizoguchi, T.; Yoshida, R.; Yuasa, T.; Shinozaki, K. Various abiotic stresses vapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J. 2000, 24, 655–665. [Google Scholar] [CrossRef] [PubMed]
  63. Xu, J.; Li, Y.; Wang, Y.; Liu, H.X.; Lei, L.; Yang, H.L.; Liu, G.Q.; Ren, D.T. Activation of MAPK kinase 9 induces ethylene and camalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis. J. Biol. Chem. 2008, 283, 26996–27006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Zhao, Q.; Guo, H.W. Paradigms and paradox in the ethylene signaling pathway and interaction network. Mol. Plant. 2011, 4, 626–634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Jeong, M.J.; Lee, S.K.; Kim, B.G.; Kwon, T.R.; Cho, W.S.; Park, Y.T.; Lee, J.O.; Kwon, H.B.; Byun, M.O.; Park, S.C. A rice (Oryza sativa L.) MAP kinase gene, OsMAPK44, is involved in response to abiotic stresses. Plant Cell Tissue Org. Culture 2006, 85, 151–160. [Google Scholar] [CrossRef]
  66. Shi, J.; An, H.L.; Zhang, L.A.; Gao, Z.; Guo, X.Q. GhMPK7, a novel multiple stress-responsive cotton group C MAPK gene, has a role in broad spectrum disease resistance and plant development. Plant Mol. Biol. 2010, 72, 1–17. [Google Scholar] [CrossRef]
  67. Ding, H.D.; Zhang, X.H.; Xu, S.C.; Sun, L.L.; Jiang, M.Y.; Zhang, A.Y.; Jin, Y.G. Induction of protection against paraquat-induced oxidative damage by abscisic acid in maize leaves is mediated through mitogen-activated protein kinase. J. Integr. Plant Biol. 2009, 51, 961–972. [Google Scholar] [CrossRef]
  68. Xie, W.G.; Zhang, J.C.; Zhao, X.H.; Zhang, Z.Y.; Wang, Y.R. Transcriptome profiling of Elymus sibiricus, an important forage grass in Qinghai-Tibet plateau, reveals novel insights into candidate genes that potentially connected to seed shattering. BMC Plant Biol. 2017, 17, 78. [Google Scholar] [CrossRef]
  69. Pombo, M.A.; Ramos, R.N.; Zheng, Y.; Fei, Z.J.; Martin, G.B.; Rosli, H.G. Transcriptome-based identification and validation of reference genes for plant-bacteria interaction studies using Nicotiana benthamiana. Sci. Rep. 2019, 9, 742–744. [Google Scholar] [CrossRef] [Green Version]
  70. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−△△CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Plants 10 01351 g001 550
Figure 1. Coil analysis of EsABI5 protein.
Figure 1. Coil analysis of EsABI5 protein.
Plants 10 01351 g001
Plants 10 01351 g002 550
Figure 2. Domain structure of EsABI5 protein.
Figure 2. Domain structure of EsABI5 protein.
Plants 10 01351 g002
Plants 10 01351 g003 550
Figure 3. Genetic relationship analysis based on EsABI5 protein.
Figure 3. Genetic relationship analysis based on EsABI5 protein.
Plants 10 01351 g003
Plants 10 01351 g004 550
Figure 4. Analysis of proteins interacting with EsABI5 protein.
Figure 4. Analysis of proteins interacting with EsABI5 protein.
Plants 10 01351 g004
Plants 10 01351 g005 550
Figure 5. Subcellular localization of EsABI5 protein in tobacco epidermal cells: GFP, green fluorescence protein under dark field; CHI, chloroplast autofluorescence; DIC, cell morphology of the lower epidermis of a tobacco leaf under bright field. Merged: overlay of GFP, CHI, and DIC.
Figure 5. Subcellular localization of EsABI5 protein in tobacco epidermal cells: GFP, green fluorescence protein under dark field; CHI, chloroplast autofluorescence; DIC, cell morphology of the lower epidermis of a tobacco leaf under bright field. Merged: overlay of GFP, CHI, and DIC.
Plants 10 01351 g005
Plants 10 01351 g006 550
Figure 6. EsABI5 expression under different treatments in leaves. Different letters indicate significant differences compared to the control group (p < 0.05). ABA-20 indicates that the concentration of exogenous ABA is 20 µmol/L. ABA-50 indicates that the concentration of exogenous ABA is 50 µmol/L. ABA-100 indicates that the concentration of exogenous ABA is 100 µmol/L.
Figure 6. EsABI5 expression under different treatments in leaves. Different letters indicate significant differences compared to the control group (p < 0.05). ABA-20 indicates that the concentration of exogenous ABA is 20 µmol/L. ABA-50 indicates that the concentration of exogenous ABA is 50 µmol/L. ABA-100 indicates that the concentration of exogenous ABA is 100 µmol/L.
Plants 10 01351 g006
Plants 10 01351 g007 550
Figure 7. EsABI5 expression under different treatments in roots. Different letters indicate significant differences compared to the control group (p < 0.05). ABA-20 indicates that the concentration of exogenous ABA is 20 µmol/L. ABA-50 indicates that the concentration of exogenous ABA is 50 µmol/L. ABA-100 indicates that the concentration of exogenous ABA is 100 µmol/L.
Figure 7. EsABI5 expression under different treatments in roots. Different letters indicate significant differences compared to the control group (p < 0.05). ABA-20 indicates that the concentration of exogenous ABA is 20 µmol/L. ABA-50 indicates that the concentration of exogenous ABA is 50 µmol/L. ABA-100 indicates that the concentration of exogenous ABA is 100 µmol/L.
Plants 10 01351 g007
Plants 10 01351 g008 550
Figure 8. Effects of salt stress on the phenotypes of wild-type and transgenic tobacco.
Figure 8. Effects of salt stress on the phenotypes of wild-type and transgenic tobacco.
Plants 10 01351 g008
Plants 10 01351 g009 550
Figure 9. Effect of different treatments on physiological indexes of tobacco: WT, wild-type tobacco; YWT, salt-stressed wild-type tobacco; OT, transgenic tobacco; YOT, salt-stressed transgenic tobacco. Different letters indicate significant differences compared to the control group (p < 0.05).
Figure 9. Effect of different treatments on physiological indexes of tobacco: WT, wild-type tobacco; YWT, salt-stressed wild-type tobacco; OT, transgenic tobacco; YOT, salt-stressed transgenic tobacco. Different letters indicate significant differences compared to the control group (p < 0.05).
Plants 10 01351 g009
Plants 10 01351 g010 550
Figure 10. Expression analysis of genes involved in ABA and MAPK pathways: (a) the roadmap of ABA and MAPK pathways; (b) heat map of ABA and MAPK pathways-related gene expression; WT, wild-type tobacco; YWT, salt-stressed wild-type tobacco; OT, transgenic tobacco; YOT, salt-stressed transgenic tobacco.
Figure 10. Expression analysis of genes involved in ABA and MAPK pathways: (a) the roadmap of ABA and MAPK pathways; (b) heat map of ABA and MAPK pathways-related gene expression; WT, wild-type tobacco; YWT, salt-stressed wild-type tobacco; OT, transgenic tobacco; YOT, salt-stressed transgenic tobacco.
Plants 10 01351 g010
Table
Table 1. Domain prediction of EsABI5-encoded proteins.
Table 1. Domain prediction of EsABI5-encoded proteins.
NamePosition IntervalE Value
bZIP_plant_BZIP46305–3593.67 × 10−23
BRLZ304–3483.09 × 10−14
bZIP_1305–3641.44 × 10−10
Table
Table 2. Primer sequences used for cloning.
Table 2. Primer sequences used for cloning.
NameSequence 5′→3′Application
CTG0957 F1GCGGCAGTCTTCCATCTTCGHomologous gene acquisition
CTG0957 R1TCCTCACCTTCGGCAACGHomologous gene acquisition
CTG0957-1 F3ACAGATGAACCCCGCGCAGCAGG3′ RACE
CTG0957-1 F5TGACGCAGGCTGACATGATGAACT3′ RACE
CTG0957-1 F9GATGATGGAACAGTCCAAGG3′ RACE
CTG0957-2 R4GAACATGCCGTTGGCCGGTGCCATC5′ RACE
CTG0957-2 R6CATGGACCATGCCGACCGGCACAG5′ RACE
CTG0957-2 YZF1CACAAGGCAAGCATATCGAGRACE verification
CTG0957-1 YZR1CCGCTCCGAAATGATAAGGTRACE verification
CTG0957-1 YZR2GTTATGATAGCTGAATGGCARACE verification
XhoI-EsABI5-FCCGCTCGAGATGGCGTCGGCGATGAGCAAEsABI5 CDS cloning
XbaI-EsABI5-RGCTCTAGATCACACGTGGTGGTGGTGGTEsABI5 CDS cloning
Table
Table 3. Primer sequences used for RT-qPCR.
Table 3. Primer sequences used for RT-qPCR.
Gene SymbolGenBank Accession NumberPrimer NameSequence (5′→ 3′)
NbUbe35SRP118889NbUbe35-FCTTCAGATTCGCACCGTTCT
NbUbe35-RCCAATGCTTCGCAATGTTCTC
GapdhAF251217.1Gapdh-FATGAGGACCTTGTTTCCACTGACTT
Gapdh-RGTGCTGTATCCCCACTCGTTGT
EsABI5MN607227.1EsABI5-FACGCAGGCTGACATGATGA
EsABI5-RCGGCTGACTCACGGTTCTT
EsABI5MN607227.1EsABI5-F1CGGCAGTCTTCCATCTTCG
EsABI5-R1GGAACTCCTCGGCATTCCAG
PYL4XM_019392528.1PYL4-FTCCGCGTTGTTTCTGGC
PYL4-RGTTTCTTCCTTAGTATTCCCTTGTG
PYL9XM_019409396.1PYL9-FGTTTGGTCATTAGTGAGGAGGTTT
PYL9-RTTGCTTGTGGTAGCTGGGAG
ABI1NM_001336190.1ABI1-FCGCCTCTTGTGACCTTGCT
ABI1-RCCGCTTTCGGGTTCTGTTA
ABI2XM_019393623.1ABI2-FGGTAGGAGGGCTTGGTAGTGA
ABI2-RTGGACAACGGCATGGGTA
SAPK2XM_033652288.1SNF1-FAGTGGCAAGGCTTATGAGGG
SNF1-RCTCTTTGAATCTGACTATGTTAGGGTG
SAPK3XM_019398597.1SAPK3-FCAAAGGAGCTTGTTGCTGTCA
SAPK3-RGAGCCTCATCTTCACTAAATCTACC
SAPK9EH367211.1SAPK9-FATTCTACTCGACGGAAGTGCTG
SAPK9-RGATCGCTTGAATCTTGAAATGG
SAPK10XM_019398090.1SRK2E-FAGTGGCAAGGCTTATGAGGG
SRK2E-RCTCTTTGAATCTGACTATGTTAGGGTG
MAPKKK17NM_001325618.1 NPK1-FTCCTGGTGGCTCAATCTCG
NPK1-RGTCAACAAGTATGTTTGCTCCCT
MPK4XM_019391189.1MPK4-FGTCGTAACACGGTGGTATCGG
MPK4-RCTGGCATCATCAGGTGATCCTAT
MPK7XM_019380635.1MPK7-FCGAATAGAATTGATGCGCTGAG
MPK7-RGGATAAAGGCTGCGACGACT
MPK17NM_001325663.1MPK17-FTCCCATCTGCCAGTGAGGTT
MPK17-RTTGCTGCGAGGCTTTGAGT
MKK3XM_019380228.1MKK3-FTTTCTCACCTGCCTCTACATCG
MKK3-RACACTACTTGCACCGCTACCTAT
MEK1NM_001326016.1MEK1-FCTTTCACGACGGCGATTTAC
MEK1-RGAACAACACCACCACTTCCCT
CPK17XM_019401998.1CPK17-FAGGATGGAGAAGCACCAGATACAC
CPK17-RCACCCTGCAATTACCCGAAG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

De, Y.; Shi, F.; Gao, F.; Mu, H.; Yan, W. Siberian Wildrye (Elymus sibiricus L.) Abscisic Acid-Insensitive 5 Gene Is Involved in Abscisic Acid-Dependent Salt Response. Plants 2021, 10, 1351. https://doi.org/10.3390/plants10071351

AMA Style

De Y, Shi F, Gao F, Mu H, Yan W. Siberian Wildrye (Elymus sibiricus L.) Abscisic Acid-Insensitive 5 Gene Is Involved in Abscisic Acid-Dependent Salt Response. Plants. 2021; 10(7):1351. https://doi.org/10.3390/plants10071351

Chicago/Turabian Style

De, Ying, Fengling Shi, Fengqin Gao, Huaibin Mu, and Weihong Yan. 2021. "Siberian Wildrye (Elymus sibiricus L.) Abscisic Acid-Insensitive 5 Gene Is Involved in Abscisic Acid-Dependent Salt Response" Plants 10, no. 7: 1351. https://doi.org/10.3390/plants10071351

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop