Next Article in Journal
Comprehensive Characterization of B-Box Zinc Finger Genes in Citrullus lanatus and Their Response to Hormone and Abiotic Stresses
Previous Article in Journal
Signal Mediators in the Implementation of Jasmonic Acid’s Protective Effect on Plants under Abiotic Stresses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 14
10.3390/plants12142632
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato

by
Lifang Zhang
1,†,
Tao Yang
2,†,
Zepeng Wang
1,2,
Fulin Zhang
1,2,
Ning Li
2,* and
Weijie Jiang
1,3,*
1
College of Horticulture, Xinjiang Agricultural University, Urumqi 830052, China
2
Key Laboratory of Genome Research and Genetic Improvement of Xinjiang Characteristic Fruits and Vegetables, Institute of Horticultural Crops, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China
3
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2023, 12(14), 2632; https://doi.org/10.3390/plants12142632
Submission received: 11 May 2023 / Revised: 7 July 2023 / Accepted: 11 July 2023 / Published: 13 July 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
The PLATZ (plant AT protein and zinc-binding protein) transcription factor family is involved in the regulation of plant growth and development and plant stress response. In this study, 24 SlPLATZs were identified from the cultivated tomato genome and classified into four groups based on the similarity of conserved patterns among members of the same subfamily. Fragment duplication was an important way to expand the SlPLATZ gene family in tomatoes, and the sequential order of tomato PLATZ genes in the evolution of monocotyledonous and dicotyledonous plants and the roles they played were hypothesized. Expression profiles based on quantitative real-time reverse transcription PCR showed that SlPLATZ was involved in the growth of different tissues in tomatoes. SlPLATZ21 acts mainly in the leaves. SlPLATZ9, SlPLATZ21, and SlPLATZ23 were primarily involved in the red ripening, expanding, and mature green periods of fruit, respectively. In addition, SlPLATZ1 was found to play an important role in salt stress. This study will lay the foundation for the analysis of the biological functions of SlPLATZ genes and will also provide a theoretical basis for the selection and breeding of new tomato varieties and germplasm innovation.

1. Introduction

An important class of transcriptional regulatory molecules known as transcription factors (TFs) play a role in the control of numerous biological processes, including development, signaling, and stress response. For instance, NF-Y, MYB, and WRKY TFs play significant roles in various stress tolerances, while NAC and GRF govern the creation of roots, flowers, and seeds. SPL TFs are also engaged in the transformation of young plants into adult plants [1]. Gene transcription can be triggered or suppressed by TF binding to cis-acting regions of target genes. The expression of numerous genes can be regulated by transcription factors, which typically have only one or more regions that bind to DNA. However, a small number of transcription factors have been shown to control the expression of a single gene [2]. Therefore, a thorough study of transcription factors will enable us to comprehend their evolutionary background, biological activities, and regulatory mechanisms [3].
The plant AT-rich sequence and zinc-binding (PLATZ) TF family is a novel class of plant-based zinc ion and DNA-binding proteins [4]. By attaching to cis-acting components in the upstream promoter region, DNA-binding proteins participate in a variety of biological processes, including DNA replication, the control of gene expression, etc. [5]. It has been established that the pea protein PLATZ1 binds to the upstream DE1 element at the A/T-enriched DNA sequence, which is required for transcriptional repression [4]. Several plant species have been shown to include members of the PLATZ family, including 13 genes in the Arabidopsis genome, 8 genes in Glycine max (soybean), 9 genes in Gossypium hirsutum (cotton), 15 genes in Oryza sativa (rice), and 17 genes in Zea mays (maize). PLATZ proteins play an important role in plant growth and development and abiotic stress responses.
PLATZ proteins play a role in plant growth, development, and senescence. In cotton, PLATZ1 mediates the signaling pathways for ABA, GA, and ethylene and is involved in seed germination and seedling establishment [6]. The PLATZ family of transcription factors is also crucial for the growth and development of leaves. ORESARA15 is a transcription factor of the PLATZ TF family, and this gene not only enhances leaf growth by promoting the rate and duration of cell proliferation at an early stage but also regulates the GROWTH-REGULATING FACTOR (GRF)/GRF-INTERACTING FACTOR signaling pathway, thereby inhibiting leaf senescence at a later stage [7]. The formation and growth of seeds are also significantly influenced by the PLATZ transcription factor family. In rice, GL6 is a plant-specific PLATZ TF that interacts with C53 to influence rice grain development and negatively control grain number [8]. Instead of being expressed in the endosperm, the SG6 gene encodes a PLATZ protein that is extensively distributed in cells and is primarily expressed in the early stages of embryonic development. The division of rice spikelet hull cells, which determine grain size, is controlled by the rice (Oryza sativa) mutant shortgrain6 (sg6). Overexpression of SG6 results in larger and heavier grains, as well as increased plant height [9]. Additionally, AtPLATZ7 is essential for RGF1 signaling, which controls the growth of root meri-stem tissue through ROS signaling [10]. The maize genome contains 15 PLATZ genes (ZmPLATZ), which are crucial for RNAP III-mediated transcriptional control [11,12]. RPC53 and TFC1 of the RNAP III transcriptional complex interact with FL3 (ZmPLATZ12) to control the expression of tRNA and 5 S rRNA, which control the growth and development of the kernel in maize seeds [11]. When developing poplar stems, a PLATZ protein is crucial for the change from primary to secondary growth [13]. In a comparative transcriptome study of normal lint (FL) and congenic non-lint (Fl) diploid cotton fibers, the results showed that a PLATZ transcription factor of Fl was down-regulated after 10 d of flowering compared to FL, indicating that PLATZ is crucial for the formation and extension of cotton fibers [14]. There is speculation that the PLATZ gene, which has variable expression in mature and immature sugarcane tissues with high fiber genotypes, may be involved in the transcriptional regulation of secondary cell wall formation [15]. Mutants of ZmPLATZ12 caused the endosperm to appear flocculent, indicating that ZmPLATZ12 plays a significant role in the development of the endosperm and the filling of storage material [11]. In the endosperm, ZmPLATZ2 is highly expressed and can bind to the promoters of ZmSSI, ZmISA1, and ZmISA2 to boost the expression of those genes. Four starch synthesis-related genes, including OsSSI, were significantly upregulated in transgenic plants by ZmPLATZ2 overexpression in rice. The PLATZ gene GRMZM2G31165 (ZmPLATZ2) can bind to the promoter region of key genes for starch synthesis under glucose induction and can promote starch synthesis by positively regulating the Glu pathway [16].
PLATZ transcription factors have a role in the adversity-stress response in addition to being crucial for plant growth and development. In Arabidopsis, AtPLATZ1 and AtPLATZ2 were reported to be positive regulators of seed desiccation tolerance. Asexual tissues become partially seed dehydration-tolerant when AtPLATZ1 is overexpressed in wild-type Arabidopsis, which enhances their capacity to consume water and endure drought [17]. AtPLATZ2 is a transcription factor that negatively regulates salt tolerance in Arabidopsis thaliana by repressing the expression of genes such as CBL4/SOS3 and CBL10/SCaBP8 [18]. Due to the transfer of the cotton gene GhPLATZ1, the seed germination rate and seedling survival of GhPLATZ1 transgenic Arabidopsis thaliana were significantly higher under salt and mannitol stress compared with the wild type, demonstrating increased resistance to osmotic stress [6]. GmPLATZ1 is involved in the germination of soybean under osmotic stress [19]. In maize, the expression of PLATZ1 homologs was significantly up-regulated by drought stress, indicating that PLATZ genes play an important role in drought resistance in maize [20].
The tomato (Solanum lycopersicum L.) is one of the most widely cultivated and economically valuable vegetable crops in the world and has great potential for application. Long-term exposure of tomatoes to adversities such as drought, high salt, low temperature, and high temperature has a significant impact on their quality and productivity. Salinity is one of the main causes of crop yield reduction, which also affects plant physiology and results in vinylation, wilting, and biochemical alterations [21]. Therefore, molecular and cellular, physiological, and biochemical perspectives are needed to cope with and adapt to environmental stresses [22]. The availability of the whole tomato genome sequence, along with the genome sequences of other species including Arabidopsis, potato, and tobacco, has made it possible to uncover tomato PLATZ family genes thanks to the advancement of tomato genomics. Consequently, the identification of superior tomato genes should advance tomato research and, as a result, help to better direct tomato production.
In this study, we performed a systematic and comprehensive genome-wide analysis of the PLATZ TF protein of tomatoes. After extensive research on tomato PLATZ gene family members, 24 and 13 PLATZ genes, respectively, were found in cultivated tomatoes and wild tomato pennellii. 24 SlPLATZs and 13 spPLATZs were thoroughly studied in terms of chromosomal localization, gene structure, conserved patterns, phylogenetic analysis, and tandem and selective pressures. The evolutionary relationships of tomato PLATZs with Arabidopsis thaliana, pepper, tobacco, rice, maize, Solanum melongena, and pennellii were also examined. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to determine the different tissue expression profiles of SlPLATZs in tomatoes. Additionally, it was investigated how SlPLATZs were expressed relative to each other in the roots, stems, and leaves. And the relative expression of 3 SlPLATZ gene family representative genes at the expanding, mature green, breaker, and red ripening periods under the application of various amounts of NAA, EBR, and MT treatments. This study will provide a useful resource for further studies to understand the regulation of PLATZ proteins on development and stress resistance in tomatoes.

2. Results

2.1. Identification and Chromosomal Localization of PLATZ Gene Family Members in Tomato

Following genome-wide searches to identify possible sequences in pennellii and cultivated tomatoes, the structural domain integrity was manually confirmed in the database, which yielded 24 PLATZ genes in cultivated tomatoes and 13 PLATZ genes in pennellii tomatoes. All pennellii tomato PLATZ genes were named SpPLATZ1 to SpPLATZ13, and the cultivated tomato PLATZ genes were named SlPLATZ1 to SlPLATZ24 based on their physical location and chromosome order (Table S1). The 24 SlPLATZ proteins had a wide range of lengths, MWs, and pIs, with an average amino acid number of 181 encoded by the SlPLATZ gene sequences. These amino acid counts ranged from 90 (SlPLATZ12) to 255 (SlPLATZ18). A molecular weight range of 10.38 kDa (SlPLATZ12) to 29.16 kDa was observed (SlPLATZ18). The isoelectric point was between 6.19 (SlPLATZ19) and 9.54 (SlPLATZ17). Twenty-three of these SlPLATZ proteins had isoelectric points greater than 7, which indicated that these proteins were primarily basic. All SlPLATZ proteins, except SlPLATZ12, had GRAVY values less than 0, which indicated that they were hydrophilic proteins. One of the 24 PLATZ transcription factor families was distributed throughout the mitochondrial matrix; one member was located in the Golgi apparatus, nine members were located in the cytoplasm; and the remaining 13 members were located in the nucleus.
The 24 SlPLATZ genes were irregularly distributed on 9 chromosomes. Thirteen SlPLATZ genes were located on chromosome 2, followed by 3 genes on chromosome 7, 2 genes on chromosome 8, and 1 gene on chromosomes 1, 3, 4, 6, 10, and 12. SlPLATZ15, SlPLATZ16, SlPLATZ18, SlPLATZ22, and SlPLATZ24 were scattered near the heads of their respective chromosomes, and SlPLATZ1, SlPLATZ17, SlPLATZ19, SlPLATZ20, SlPLATZ21, and SlPLATZ23 were distributed near the ends of their respective chromosomes (Figure 1).

2.2. Analysis of the Structure, Conserved Domain, and Motif of the SlPLATZ Gene

The structural diversity of the family members is reflected in the variation in the number of introns and exons in genes belonging to the same family. The exon and intron architectures of the SlPLATZ genes were distinct in different subfamilies and conserved within the same subfamily, according to statistics on the tomato PLATZ gene family. The number and length of introns fluctuated significantly between various subfamilies, as depicted in the figure. The number of exons ranged from 1–4, and the number of introns ranged from 0–4. SlPLATZ1, which had 4 exons and 4 introns, had the most introns and exons. SlPLATZ17, SlPLATZ21, and SlPLATZ22 are architecturally extremely similar and have three exons and three introns (Figure 2B). SpPLATZ3 and SpPLATZ4 on chromosome 2 have three exons and are structurally very similar; the same applies to SpPLATZ7, SpPLATZ10, and SpPLATZ11 (Figure S1B). The intron position and length varied between members.
Highly conserved DNA sequences may have the same utility as molecular sequences that are extremely similar, homogeneous, or conserved. The conserved motifs of members of the same subfamily were similar, according to an examination of the conserved motifs of tomato PLATZ gene family members. The MEME online program identified 10 motifs, designated motif 1 to motif 10, and analyses showed a high degree of similarity in the conserved motifs of the SlPLATZ gene family. Every SlPLATZ, except for SlPLATZ12, has motif 1, and the majority of SlPLATZs also have motif 2. According to the investigation, the SlPLATZ family belonged to a group whose amino acid motif composition was roughly similar. We observe that the conserved motifs in SlPLATZ17, SlPLATZ21, and SlPLATZ22 are comparable, and the number of exons and introns is likewise consistent. The same pattern is also present in SlPLATZ18 and SlPLATZ24 (Figure 2A). All SpPLATZ have motif1, motif2, and motif5, with motif5 dispersed across the protein’s C-terminus. SpPLATZ7, SpPLATZ10, and SpPLATZ11 in Pennellii shared conserved motifs, while SpPLATZ8 and SpPLATZ13 also displayed this pattern (Figure S1A).

2.3. Phylogenetic Analysis of the PLATZ Family

Varying PLATZ gene counts have been found in domesticated and wild Solanaceae species, including cultivated tomatoes, wild tomatoes, and potatoes (24, 13, and 18, respectively). The PLATZ gene sequences from Arabidopsis (12), potato (18), rice (13), maize (14), soybeans (31), cotton (41), wheat (46), sorghum (23), and the 24 SlPLATZ genes and 13 SpPLATZ genes were studied phylogenetically to further understand the genetic evolutionary relationship of PLATZ. Based on the position of Arabidopsis in the phylogenetic tree, PLATZ was divided into six groups, named I-VI. Groups I, II, III, IV, and VI contained monocotyledons and dicotyledons, which indicated that the PLATZ members of these subfamilies were more conserved family members. Group V exclusively contains monocotyledons, and Group VI only contains dicotyledons, which indicated that PLATZ family members expanded with the differentiation of monocotyledons and dicotyledons but are related to dicotyledons in the completion of their complex life activities. Different branches existed within each subgroup, and potatoes, pennellii tomatoes, and cultivated tomatoes were grouped in Groups I, II, IV, and VI but not with Arabidopsis, which indicated divergence of the Solanaceae. Group I contained five SpPLATZ and fifteen SlPLATZ genes; Group II contained four SpPLATZ and four SlPLATZ genes; Group IV contained one SpPLATZ and one SlPLATZ gene; and Group VI contained three SpPLATZ and three SlPLATZ genes. Both cultivated and wild tomatoes have extremely homologous PLATZ genes in all subfamilies. The fact that there were three times as many cultivated tomato SlPLATZ genes in Group I as the pennellii tomato SpPLATZ genes suggests that cultivated tomatoes descended from pennellii tomatoes (Figure 3).

2.4. Analysis of Collinearity and Selection Pressure on the Tomato PLATZ Gene Family

MCScanX was used to analyze the synteny of the SlPLATZ genome. The SlPLATZ gene family in tomatoes appears to have grown via fragment duplication, as evidenced by the presence of the paralogous gene pairs SlPLATZ21 and SlPLATZ22, SlPLATZ18 and SlPLATZ24, and SlPLATZ17 and SlPLATZ21 (Figure 4). There are four gene pairs found in wild tomato pennellii: SpPLATZ7 and SpPLATZ10, SpPLATZ7 and SpPLATZ11, SpPLATZ8 and SpPLATZ13, and SpPLATZ10 and SpPLATZ11. Except for the tandem duplication of SpPLATZ10 and SpPLATZ11, the remaining gene pairs are segmental (Figure S2). All collinear gene pairings had nonsynonymous (Ka) to synonymous (Ks) substitution ratios (Ka/Ks) that were less than 1, which showed that purifying selection mostly affected SlPLATZ genes, and these genes had slow evolutionary rates and stable gene functions. The divergence times of the three gene pairs were inferred based on Solanaceae’s differentiation rate R (1.5 × 10−8), and the results revealed that the newest (SlPLATZ17/SlPLATZ21) and oldest (SlPLATZ21/SlPLATZ22) pairs diverged at 26.600 and 31.767 Mya, respectively (Table S2). The replication times of SpPLATZ homologous gene pairs in pennellii ranged from 20.813 to 29.376 Mya (Table S3). These divergence times also matched the findings of their evolutionary rates.
An analysis of the collinearity diagram revealed that seven SlPLATZ genes on tomato chromosomes 1, 2, 4, 6, and 8 were collinear with seven corresponding genes in Arabidopsis (Figure 5). Only two rice homolog genes and two tomato-specific genes, SlPLATZ2 on chromosome 2 and SlPLATZ18 on chromosome 7, were co-linear, which suggests that SlPLATZ2 and SlPLATZ18 are conserved PLATZ genes that are shared by monocots and dicots and descended from a common ancestor. We also discovered that SlPLATZ2 and SlPLATZ18 were distributed in Group II but not on the same branch in the phylogenetic tree, which indicated that the genes in Group II served the original purpose (Figure 3). However, the gene groups in Group VI had new functions that developed from PLATZ genes throughout evolution. SlPLATZ17 on chromosome 6, SlPLATZ21, and SlPLATZ22 on chromosome 8, and their homologs in Arabidopsis thaliana, were mutually multicollinear genes with similar functions. This result is consistent with the collinearity between SlPLATZ species. SlPLATZ17, SlPLATZ21, and SlPLATZ22, which are directly homologous in tomatoes, are likely genes that develop during dicotyledonous plant differentiation and play a significant role in PLATZ gene evolution. SlPLATZ17, SlPLATZ21, and SlPLATZ22 from cultivated tomatoes and AT4G17900, AT5G46710, and AT1G32700 from Arabidopsis are located on the same branch in Group IV of the phylogenetic tree. Therefore, it is hypothesized that AT4G17900, AT5G46710, and AT1G32700 are orthologous genes in Arabidopsis with similar functions.
Many monocotyledonous and dicotyledonous PLATZ genes are found in Group I (Figure 3). SlPLATZ17, SlPLATZ21, and SlPLATZ22 underwent quantitative amplification rather than functional differentiation to support the complex life activities of dicotyledonous plants. 8 SlPLATZ genes and 6 tobacco homologs were collinear, and 10 SlPLATZ genes and 10 potato homologs were collinear. SlPLATZ2 and 1 potato homolog were collinear, and SlPLATZ18 and 2 potato homologs were collinear. These results indicated that SlPLATZ2 evolved conservatively during Solanaceae history and that SlPLATZ18 underwent expansion, which further demonstrated that SlPLATZ2 and SlPLATZ18 were conserved genes. The physical locations of the collinear genes for cultivated tomato and potato on their respective chromosomes were identical, but the physical locations of the collinear genes for cultivated tomato and tobacco were different. Collinearity was similar between pennellii and other species, except for variations in rice and maize, according to the collinearity diagram of cultivated tomatoes and other species (Figure S3). This result means that the whole tomato gene family in Solanaceae did not constrict or expand from its current condition, and the evolution of the PLATZ family genes was unaffected by the separation of the cultivated tomato from the potato and the cultivated tomato from pennellii.

2.5. Analysis of Cis-Acting Regulatory Elements of SlPLATZ Genes

Cis-regulated elements (CREs) are segments of DNA sequences in gene promoters that affect gene expression. The promoter sequences of 24 SlPLATZ family members contain cis-acting elements that are associated with various types of stress responses, hormone responses, development, cell cycle, and transcription, including CCAAT-boxes, TC-rich repeats, AREs, G-boxes, Box 4, and other elements associated with stress responses (Figure 6). GCN4_motifs, CAT-boxes, and other growth and developmental response elements were found. ABREs, CGTCA-motifs, TGACG-motifs, TGA-elements, and other hormone response elements were found. Circadian, MSA-like, and other cell cycle response elements were identified. A-box, AT-rich element, and other transcriptional response elements were identified. The light response element Box 4 and the anaerobic induction element ARE were present in 24 SlPLATZ genes under adverse stress. The two stress-related cis-acting elements, G-Box and Box 4, were distributed in all upstream sequences of SlPLATZ genes, with up to 109 and 171, respectively, and Box 4 in SlPLATZ17 was the most abundant element, with 14. SlPLATZ14 and SlPLATZ15 had the most G-Boxes, with 9. With 25 occurrences in 24 SlPLATZ genes and accounting for 45% of the growth response cis-acting elements, seed-specific control of the O2-site was the most prevalent cis-acting element in growth development. Abscisic acid-responsive elements (ABREs), which made up 30% of the hormone response cis-acting elements and appeared 90 times in 24 SlPLATZ genes, were the most prevalent cis-acting elements among the hormone response categories. MSA-like was present in the SlPLATZ22 and SlPLATZ24 genes. The promoter of SlPLATZ8 has an RY element, which may control how the gene is expressed throughout the late stages of embryogenesis and seed formation. These findings suggest that PLATZ genes play a significant role in many aspects of life, including stress response and plant growth and development.

2.6. Interaction between PLATZ Proteins in Tomato

We mapped the interaction network and eliminated certain proteins with low values and missing annotations (Figure 7). The findings demonstrated that none of the proteins had any expected interactions with SlPLATZ17, SlPLATZ21, or SlPLATZ22. SlPLATZ1, SlPLATZ2, SlPLATZ18, SlPLATZ23, and SlPLATZ24 do not directly interact, but they work in concert with other related proteins to form 105 edges that control physiological processes. SlPLATZ23 interacted with the most proteins (12), followed by SlPLATZ1 and SlPLATZ2, which were each associated with 6 and 7 proteins, respectively, and SlPLATZ18 and SlPLATZ24, which each interacted with just one protein. These findings showed that ADH proteins were crucial for abiotic stress resistance, including resistance to waterlogging, low temperatures, drought, and salt damage [23]. HSP90 is crucial for the stage change from feeding to reproduction and floral development [24]. HSC80 is the principal heat shock protein generated by heat shock in yeast, mammals, and plants and is involved in particular developmental processes that are primarily linked to growth and development [25]. Temperature-sensitive circadian rhythms are linked to JA1, and the cell cycle, proliferation, apoptosis, and differentiation are connected to SGT1-1. The roles of other proteins in the interaction network diagram that appeared to have direct or indirect synergy with SlPLATZ proteins but lacked annotation are not known.

2.7. Tissue-Specific Expression Patterns of PLATZ Genes

Heat maps of tomato SlPLATZ gene-specific expression revealed that the levels of expression of various members of this gene family varied greatly in various tissues (Figure 8). Both SlPLATZ17 and SlPLATZ21 were significantly expressed in roots and to a lesser extent in cotyledons, demonstrating that these two genes are core members of the PLATZ family and are essential for tomato growth and development. SpPLATZ7 and SpPLATZ11 are highly expressed in roots and mature leaves at 6 weeks, showing that they are the core members of the PLATZ family and are essential for the growth and development of tomatoes (Figure S4). We discovered that SlPLATZ21 and SpPLATZ11, SlPLATZ17, and SpPLATZ7 are on the same branch of the phylogenetic tree and that all four genes are in group VI. This further emphasizes the significance of the tomato PLATZ family genes SlPLATZ17 and SlPLATZ21. SlPLATZ21 and SlPLATZ22 are predicted to be a pair of fragment replicates, but their expression patterns are not identical. SlPLATZ21 was primarily expressed in roots, but SlPLATZ22 was highly expressed at 0 DPA. Although it is projected that SpPLATZ8 and SpPLATZ13 are a pair of fragment clones, their expression profiles differ from one another. SpPLATZ13 is expressed at a lower level in all tissues than SpPLATZ8, which is mostly expressed in roots. SpPLATZ12 expression was lower than SpPLATZ9 expression in each tissue, while SpPLATZ9 expression in the bud was higher and SpPLATZ12 expression in the mature fruit and 6-week small leaves was higher. (Figure S4). This result suggests that some SlPLATZ genes with close phylogenetic relationships may also exhibit different expression patterns. It was hypothesized that SlPLATZ22 in Group VI and SlPLATZ23 in Group IV, which were largely expressed at 0 DPA, would be involved in fruit growth and development. The importance of this gene was demonstrated by the fact that SlPLATZ2 in Group II was primarily expressed in plant meristematic tissues, which further confirmed that this gene was common to monocotyledonous and dicotyledonous plants and that it was conserved.

2.8. Expression Profiles of SlPLATZ Genes

The relative expression of non-stressed tomato plants in roots, stems, and leaves was assessed using qRT-PCR with the primers shown in Table 1. As shown in Figure 9, SlPLATZ2, SlPLATZ23, and SlPLATZ24 all showed the highest levels of expression in the root, demonstrating the significance of these three genes for root growth and development. The stem showed the highest expression of SlPLATZ21 (1.120-fold, p = 0.125), followed by SlPLATZ23 (0.585-fold, p < 0.0001), SlPLATZ2 (0.278-fold, p < 0.0001), and SlPLATZ24 (0.003-fold, p < 0.0001). The highest expression of SlPLATZ21 (2.164-fold, p < 0.0001) was found in the leaves, suggesting that this gene primarily functions in leaves. SlPLATZ23 (0.452-fold, p < 0.0001), SlPLATZ2 (0.097-fold, p < 0.0001), and SlPLATZ24 (0.004-fold, p < 0.0001) were the next most expressed genes. Most tissues showed high levels of SlPLATZ21 expression, whereas stems and leaves showed relatively low levels of SlPLATZ24 expression. The SlPLATZ gene may be implicated in the development of various tomato tissues, according to these crucial cues about expression variations and similarities in various tissues.
At the expanding period, mature green period, breaker period, and red ripening period under treatments of 10, 20, and 30 mg·L−1 NAA, 0.05, 0.1, and 0.2 mg·L−1 EBR, and 50, 100, and 150 µmol·L−1 MT, the relative expression of 11 representative genes in the tomato PLATZ gene family was examined using qRT-PCR (Figure 10). SlPLATZ9 (314.929-fold) was highly expressed in red-ripening fruits sprayed with 20 mg·L−1 NAA, and the expression of NAA sprayed at ripening was much higher than in other periods. SlPLATZ9 expression was higher in red-ripening fruits sprayed with BR, and the expression of BR sprayed at red ripening was much higher than in other periods. A change occurred until MT spraying, and SlPLATZ9 expression was highest at 45.15-fold at the red ripening stage of fruits sprayed with 150 µmol·L−1 MT. Therefore, it is hypothesized that SlPLATZ9 acts primarily at the red ripening stage of the fruit, which is consistent with the results obtained in tissue-specific expression. Except for SlPLATZ21 (6.169-fold), which was more highly expressed in green ripening fruits sprayed with 0.1 mg·L−1 EBR and expanding fruits treated with 0.2 mg·L−1 EBR, SlPLATZ21 (3.124-fold) was more highly expressed in expanding fruits sprayed with 20 mg·L−1 NAA. Compared to NAA spraying, SlPLATZ21 expression was higher at the fruit expansion period with 50 µmol·L−1 MT (3.142-fold) and 100 µmol·L−1 MT (3.099-fold) spraying. Therefore, it is speculated that SlPLATZ21 acted primarily during fruit expansion. SlPLATZ23 (6.472-fold) was substantially expressed in mature green fruits sprayed with 30 mg·L−1 NAA, and the expression of NAA sprayed at mature green was significantly higher than at other times. SlPLATZ23 expression was also higher than at other times in red-ripening fruits sprayed with EBR and significantly higher in mature green fruits sprayed with EBR and MT. Therefore, it is hypothesized that SlPLATZ23 mostly affects fruits while they are in the green ripening stage. Consistent with our findings, we also observed increased SlPLATZ23 expression at 0 DPA in tissue-specific expression.
To measure the transcript expression levels in the salt-stressed leaf tissues of cultivated tomatoes at 0, 0.5, 2, 4, 6, 8, and 12 h, qRT-PCR was used. The salt treatment results showed that all SlPLATZ genes were up-expressed in the leaf tissue of cultivated tomatoes (Figure 11). At 2 and 8 h, SlPLATZ1 expression in leaf tissue was significantly elevated (13.699- and 16.135-fold), and the lowest expression occurred at 4 h (3.533-fold). The expression of SlPLATZ21 in leaf tissue was significantly increased by 3.434- and 3.056-fold at 2 and 12 h, respectively, with the lowest expression of 1.377-fold observed at 8 h. SlPLATZ1 expression was higher than SlPLATZ21 expression for all salt stress treatment durations.

3. Discussion

Favorable conditions have been developed for the in-depth research of plant growth and development as well as resistance genes in recent years thanks to the expansion of genome sequencing. A useful research technique now is the analysis of gene families to investigate the structure, function, and evolution of genes. Studies related to PLATZ genes have been reported in higher model plant species such as Arabidopsis [17], maize [11], soybean [19], and rice [6]. Despite reports that the tomato PLATZ gene family has been identified. The distinction is that we discovered 24 SlPLATZ genes and examined them in terms of evolution. The expression of SlPLATZ was measured at different time points after salt stress, and the expression of fruits at four ripening stages was measured under NAA, BR, and MT conditions, respectively. Future research on tomato PLATZ will benefit from some of these consequences.
Cultivated tomato members of the PLATZ family were carefully identified in the present study, and their physicochemical characteristics, structural characteristics, evolutionary categorization, and functional expression were examined. Cultivated tomatoes, in contrast to most higher plants, have 24 members of the PLATZ family. This number is comparable to cabbage and higher than the numbers for Arabidopsis [17] and Ginkgo [26]. Compared to Wai’s [27] findings, which discovered 20 SlPLATZ genes, this is different. We found that Wai used a tomato assembly version other than Sl5.0 L., which may be the main reason for the disparity in the number of PLATZ genes. PLATZ members in wild tomatoes were primarily found on chromosomes 1, 2, 4, 6, 7, 8, and 10, but the PLATZ family was heterogeneously dispersed on chromosomes 1, 2, 3, 4, 6, 7, 8, and 12 in cultivated tomatoes. However, tomatoes from farmed and wild populations had the highest distribution of PLATZ genes on chromosome 2. Due to their locations on the chromosome, the PLATZ genes in tomatoes exhibit a mix of conservation and segregation. We note that SlPLATZ11 is predicted to locate in mitochondria and that localization of transcription factors in mitochondria is uncommon. However, transcription factors have been found to have a dual location in the nucleus and other organelles, such as the mitochondria. Whirly1 provided the first instance of a protein that was simultaneously localized to the nucleus and an organelle within the same cell [28]. RNA and/or DNA-binding proteins (such as transcription factors and telomere binding proteins) make up the majority of the dual-targeting proteins (nuclear-organelle proteins) that are currently known. Such dual-targeted factors play a key role in nuclear versus cytosolic gene expression [29]. The 24 SlPLATZ genes identified in wild tomatoes and the 13 SpPLATZ genes identified in cultivated tomatoes were classified into four subfamilies. The exon-intron counts and conserved motifs of members of the same subfamily were similar, and members of various subfamilies had very different gene structures and conserved motifs. Even though we did not analyze the motifs of Arabidopsis and rice but rather those of tomato and the wild tomato Pennellii, Wai [27] discovered that motif1 is shared by the majority of PLATZ genes, which is similar to our findings. Intron loss controls intron evolution, and genetic mutations and selection affect intron evolution. Introns are lost after differentiation, and intron content is elevated during the early stages of gene amplification [30]. Generally, the number of introns within a subfamily is particular, and variations in the number of introns between various genes may result from insertion and deletion events, which may act as a driving force in the course of evolution. This force may also play a significant role in the diversity of gene structure and the complexity of gene function. Introns regulate the expression of genes either positively or negatively. Therefore, the functionality of SlPLATZ genes and their functional diversity may be impacted by conserved and variable gene architectures [31].
The growing complexity and refinement of morphological structures at various levels may be observed in the evolution of the biological world. Therefore, physiological functions have gradually expanded in specialization and efficacy. Because phylogeny is closely related to individual development, organisms always embody their ancestral characteristics early in their individual development before they embody their own more progressive characteristics. Phylogeny is the study of the origin and evolutionary history of biological groups, each of which has its own origins and developmental history, regardless of its size. Along with the organisms we included together, I left out Amborella (Amborella trichopoda), moss (Physcomitrella patens), and green algae (Chlamydomonas reinhardtii) concerning Wai’s [27], but with Pennellii included. The PLATZ genes differed significantly depending on where the plant was in its evolutionary history. According to the evolutionary tree, the evolution of the PLATZ family genome occurred concurrently with the diversification of its species. Monocotyledons and true dicotyledons are distributed in different branches. With a strong bias toward characteristics that are appropriate for human cultivation, such as high yield and large fruits, domestication is a process of human selection. Some PLATZ gene functions may be consistent with our domestication targets because domestication increased the number of PLATZ gene families in Solanaceae species. The monocotyledonous and dicotyledonous members of the phylogenetic tree were found in three subclades other than Group III, which indicated that PLATZ genes varied before monocotyledon-dicotyledonous divergence. The PLATZ genes were amplified during the differentiation of monocotyledons and dicotyledons because more genes were needed to perform more complex life activities. Duplicate genes in a phylogenetic tree belong to the same group, which provides the building blocks for the evolution of mechanistic novelty and makes it easier for new functions to evolve. While we discovered three gene pairs in cultivated tomatoes and four duplicated pairs in pennellii, Wai [27] discovered a total of seven duplicated gene pairs in the tomato PLATZ gene family. A ratio of non-synonymous substitutions (Ka) to synonymous substitutions (Ks) greater than 1 is widely thought to signal positive selection for faster evolution, and Ka/Ks < 1 shows that gene duplication suffers from purifying selection [32]. The three homologous gene pairs in the cultivated tomato similarly had Ka/Ks ratios that were <1, and all 20 BrPLATZ paralogous gene pairs were <1 [33]. In Wai’s study, These duplicated gene pairs may have diverged in the last 1–31 million years (Mya) [27], while our study found that cultivated tomato SlPLATZ gene pairs and spPLATZ homologous gene pairs in pennellii diverged at 26.600 and 31.767 Mya and 20.813 to 29.376 Mya, respectively. This may be related to the fact that we are using a different calculation method. Because there is more selection pressure on these duplicated gene pairs, evolution does not result in any appreciable functional changes between these pairs.
Cis-acting regulatory elements also regulate tissue-specific or stress-responsive expression patterns of genes. These elements are significant molecular switches that govern vast networks of genes involved in a variety of biological activities, including stress responses and developmental processes [34]. The promoter regions of most SlPLATZ genes contained several stress response cis-elements, which suggests that these genes play a role in abiotic stress and environmental adaptation. Plant hormones function as intracellular messengers in reaction to stress and combine several signal transduction pathways. Growth hormone, methyl jasmonate, gibberellin, and other phytohormone-responsive cis-elements are only a few of the phytohormone response elements found in the promoter regions of all SlPLATZ genes, which support the tolerance-related activities of SlPLATZ genes.
Protein interactions may connect PLATZ proteins to other known-function proteins, which advances our understanding of the biological roles of these proteins. Most PLATZ proteins may be involved in the cell cycle, proliferation, apoptosis, differentiation, and other processes, and the responses to abiotic stress, according to protein interactions. ADH [35] is produced under hypoxic conditions in maize and rice [23], and it is directly related to the organism’s degree of hypoxia. ADH encodes alcohol dehydrogenase, which is a key enzyme in anaerobic metabolism. Some of the key biological activities regulated by SGT1 include kinetochore assembly, ubiquitination, the activation of the cyclic AMP pathway, and the stability of Polo kinase [36]. SGT1 controls the growth hormone response, and it is an HSP90 co-chaperone. The growth hormone-responsive phenotype is buffered by the ability of HSP90 to hide point mutations in the growth hormone receptor TIR1 [37]. During normal tomato growth, HSC80 is preferentially expressed in the tips of the branches and roots [25].
The varying levels of gene expression in various tissues may be used to predict the diversity of function. The varying levels of SlPLATZ gene expression in diverse tissues suggest that functional diversity occurred during evolution, and these genes may serve a variety of regulatory functions during tomato growth and development. Most SlPLATZ17/18/21/24 expression was found in roots, which indicated that these genes may be involved in root development or nutrient and water uptake. Because SlPLATZ22/23 were expressed primarily at 0 DPA, these genes most likely collaborated with other fruit-specific genes to influence fruit development. Additional evidence that SlPLATZ2 encouraged differentiation in tomatoes was based on its higher expression in meristematic tissues compared to other tissues. While we downloaded the SlPLATZ gene expression levels of various tomato tissues from the Tomato Functional Genomics Database (http://ted.bti.cornell.edu) (accessed on 18 September 2022), Wai [27] used RT-qPCR to investigate the gene expression patterns of several tomato tissues of the cultivar Ailsa Craig. PLATZ genes play a role in the growth and development of other plant species. For example, PLATZ1 gene expression is more prevalent in the apical shoots and root tips of pea plants than in the mature leaf, stem, and root tissues [4]. AtPLATZ7 regulates the size of the root meristem via ROS signaling [10]. Amyloplasts of maize endosperm selectively express ZmPLATZ12 (Fl3) [11]. GbPLATZ9 is strongly expressed in roots and seeds during late seed development. AtORE15 is implicated in the control of leaf growth and the prevention of senescence, and it is expressed in young leaves [7]. PLATZ18 and PLATZ24 are two paralogous homologous gene pairs that have been duplicated, which suggests that these genes play a role even after replication and are involved in the control of tissue formation. The other two duplicated paralogous homologous gene pairs appear to have distinct functions in tomato development based on their varied expression patterns. In summary, we suggest that the SlPLATZ gene family, specifically the involvement of its members in abiotic stressors and fruit development, plays a major role in tomato development.
The expression levels of many genes varied as a result of tissue specificity. Under salt stress or after receiving various hormone treatments, this variation was expressed. For the demonstration, we chose a few genes that had high levels of gene expression. Roots are the main organ responsible for the absorption of water and minerals. In this study, SlPLATZ23 was found to be highly expressed in the root system, indicating that it plays a significant role in root development and nutrient and water uptake. SlPLATZ21 is abundantly expressed in plant leaves, indicating that it plays an important role in plant growth and development. The role of PLATZ genes in plant growth and development has been demonstrated in other species. In peas, for instance, the PLATZ1 gene was expressed at higher levels in the root tips and apical shoots compared to mature leaf, stem, and root tissues [4]. The PLATZ transcription factor AtORE15 gene is expressed in young leaves, and the gene is involved in regulating leaf growth and suppressing leaf senescence [7].
In resisting external stresses, plants often regulate their growth and resilience through hormone secretion, distribution, or signaling. About 15% of all plant transcription factors are zinc finger transcription factors, which are relatively large transcription factors that control the expression of many genes in response to abiotic conditions such as low temperature, salt, drought, osmotic stress, and oxidative stress [38,39]. AtPLATZ1 and AtPLATZ12 are the main nodes that positively regulate drought tolerance in Arabidopsis seeds and clonal tissues [17]. GhPLATZ1 gene expression was induced by adversity and exogenous hormone stress. Ectopic expression of GhPLATZ1 in Arabidopsis enhances plant resistance to osmotic stress, ABA, and PAC [6]. Similarly, the RNA expression of GmPLATZ1 (Glycine max PLATZ1) was significantly increased when exogenous ABA was applied in soybean, and the leaf mRNA level of GmPLATZ1 was steadily increased after 24 h of drought stress [19]. SlPLATZ1 and SlPLATZ21 expression considerably increased after 12 h of salt stress treatment in the current study; as a result, these genes may be crucial candidates for tomato’s salt stress response.
Transcription factors are involved in hormone signaling pathways [40]. Different endosperm treatments revealed that ZmPLATZ2 was negatively controlled by ABA and sucrose and positively regulated by glucose. In soybean, GmPLATZ1 is a stress-inducible PLATZ family protein that is overexpressed in Arabidopsis and responds strongly to both mannitol and abscisic acid [19]. In the present study, we found that SlPLATZ21 and SlPLATZ23 were significantly upregulated in tomato fruits at the MG stage after NAA and BR treatment and at the EP stage after MT treatment. However, further studies are needed to determine the mechanisms of NAA, BR, and MT induction of SlPLATZ21 and SlPLATZ23 and their roles in NAA, BR, and MT. Wai [27] investigated the effects of drought, salt stress, low temperatures, heat stress, and ABA on tomato Ailsa Craig. Our study, however, investigated the gene expression profiles of “M82” under various salt treatments and the expression patterns of cherry tomatoes “Jingfan Pink Star No. 1” at various stages of ripeness after spraying with various concentrations of EBR, NAA, and MT. This study laid the foundation for the establishment of the SlPLATZ gene family, but its role in different adversities still needs to be further validated by further experiments.

4. Materials and Methods

4.1. Plant Materials, Growth Conditions, and Treatment

The tomato cultivar “M82” was provided by the Institute of Horticultural Crops, Xinjiang Academy of Agriculture Sciences. The plants were grown in the Key Laboratory of Genome Research and Genetic Improvement of Xinjiang Specialty Fruits and Vegetables under conditions that included 16 h of light and 8 h of darkness, a temperature of 22 °C, 100 µmol·m−2·s−1 light intensity, and 60% relative humidity. Three tissue-specific samples were taken from tomato tissues, each consisting of material from three untreated 8-week-old plants. These three sample pools included leaves, stems, and roots. During the four-leaf stage, uniformly growing tomato seedlings were chosen, treated with 200 mmol·L−1 NaCl for stress, and sampled at 0, 0.5, 2, 4, 6, 8, and 12 h. Three biological replicas of each treatment were established, snap-frozen in liquid nitrogen for storage, and then stored at −80 °C.
The same supplier provided the “Jingfan Pink Star No.1” cherry tomato, which was grown in our facilities. The cherry tomato fruit was exposed to different concentrations of 2,4 epibrassinolide (EBR, concentration gradient of 0.05, 0.1, and 0.2 mg·L−1), naphthenic acid, NAA (concentration gradient of 10, 20, and 30 mg·L−1), melatonin (MT, concentration gradient of 50, 100, and 150 µmol·L−1), and control (CK) at the expanding period, mature green period, breaker period, and red ripening period. A total of 10 treatments were performed. The unfolding agent was Tween-80, and the solvent was 98% ethanol, which was dissolved and diluted to 0.1% (v/v). The experimental fruit was chosen at the mature green, breaker, and red ripening stages, and by the time it reached red ripening, its fruit had also been sprayed with comparable concentrations of exogenous NAA, EBR, and MT in the first three phases (cumulatively). Three biological duplicates were established for each treatment, and the sprayed fruits were sampled sequentially by zone at the expanding, mature green, breaker, and red ripening periods. The samples were flash-frozen in liquid nitrogen and stored at −80 °C.

4.2. Identification of PLATZ Gene Families

The Solanaceae genome database (http://solomics.agis.org.cn/tomato/ (accessed on 18 September 2022)) was used to gather reference genomes of tobacco (Nicotiana tabacum L., v4.5), eggplant (Solanum melongena L., v4.1), pennellii tomatoes (Solanum pennellii, v2.0), and cultivated tomatoes (Solanum lycopersicum L., Sl5.0). The Arabidopsis (Arabidopsis thaliana, TAIR10.) reference genome was gathered from the Arabidopsis Information Resource website (http://www.arabidopsis.org/ (accessed on 18 September 2022)). The Ensembl Plants database, located at http://plants.ensembl.org/index.html (accessed on 4 October 2022)), was used to compile reference genomes for the following plants: pepper (Capsicum L., v2.0), potato (Solanum tuberosum, v3.0), rice (Oryza sativa, IRGSP-1.0), maize (Zea mays, Zm5.0), wheat (Triticum aestivum L., IWGSC), sorghum (Sorghum bicolor,v3.56), soybean (Glycine max, v2.1), and cotton (Gossypium_raimondii,v6). A Markov model of the PLATZ protein’s conserved structural domain (PF04640) was acquired from Pfam (https://pfam.xfam.org/ (accessed on 18 September 2022)). The complete genome sequences of tomato M82 and Pennellii were searched using the hmmsearch (E-value: 1 × 10−5) algorithm to identify putative PLATZ genes [41]. The SMART (https://smart.embl.de/ (accessed on 19 October 2022)), NCBI-CDD (https://www.ncbi.nlm.nih.gov/cdd (accessed on 19 October 2022)), and Pfam databases (https://pfam.xfam.org/ (accessed on 18 September 2022)) all manually validate the structural domains of candidate genes. To have a more comprehensive understanding of the PLATZ gene family in Solanaceae, we analyzed Sl and Sp.
The Extasy online database ProtParam program (http://www.expasy.org/protparam/ (accessed on 19 October 2022)) was used to predict and examine the physicochemical properties of PLATZ proteins, including amino acid number [42], isoelectric point, lipid index, and hydrophilicity. WoLF PSORT (https://wolfpsort.hgc.jp/ (accessed on 19 October 2022)) was used to predict protein subcellular localization [43].

4.3. Conserved Structural Domains and Cis-Regulatory Elements of the PLATZ Gene

The MEME program [44] was used to find the conserved motifs in PLATZ proteins, with the number of motifs set to 10, the lowest motif length set to 6, and the largest motif length set to 100. Tbtools was used to visualize gene structure and motifs. The visualization of the gene structure and motif was completed using Tbtools [45]. Using the tomato genome annotation file, the entire 2000 bp upstream and downstream sequences of the tomato PLATZ gene were extracted and used as candidate promoter sequences using PlantCare (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 19 October 2022)) website [46], which was analyzed for cis-acting elements and mapped using Tbtools software [45].

4.4. Selection Pressure Analysis, Interspecies Collinearity, and Phylogenetic Analysis of the PLATZ Gene

The Ka/Ks Calculator was used to determine the ratio of the PLATZ gene synonymous with the nonsynonymous substitution rate (Ka/Ks) [47]. The PLATZ gene covariance between and within species was calculated using McscanX [48]. Circos was used to demonstrate covariance between genes. The combined dataset was analyzed with maximum likelihood inference using Iqtree [49]. The ModelFinder model with a bootstrap value of 1000 was used to further visualize and embellish the phylogenetic tree with the help of the iTOL online tool [50].

4.5. Interaction Network and Expression Analysis

The protein-protein interaction relationship was predicted by the STRING online website (https://string-db.org/ (accessed on 3 November 2022)), using the Cytoscape program to display an interaction network [51]. Expression profiles of S. lycopersicum at various tissues and developmental stages were downloaded from the RNA-seq database of the Tomato Functional Genome Database (TFGD, http://ted.bti.cornell.edu/ (accessed on 2 November 2022)) [52], including expression data for anthesis flowers (0DPA), 10 days post-anthesis fruit (10 DPA1), 10 days post anthesis fruit 2 (10 DPA2), 20 days post-anthesis fruit (20DPA), ripening fruit (33DPA), cotyledons (COTYL), hypocotyl (HYPO), vegitative meristems (MERI), mature leaves (ML), whole root (ROOT), young flower buds (YFB), and young leaves (YL). The expression profiles for the different tissues and developmental stages of S. pennellii were extracted from supplementary material attached to the article by Bolger et al. [53]. including the FPKM values of bud, flower, immature (IF), mature fruit (MF), 6-week, small leaves (6 wk, SL), 6-week, mature leaves (6 wk, ML), 6-week, Meristem (6 wk, M), 6-week, stem (6 wk, S), pollen, and root (SR). TBtools was used to perform a heat map analysis on their expression profiles.

4.6. Expression Profile of SlPLATZ

The Tiangen Biochemical Technology (Beijing) Co.’s RNA-prep Pure Plant Kit (DP441) was used to extract total RNA. The abm All-In-One 5× RT Master Mix Reverse Transcription Kit was used to reverse transcribe the cDNA to produce cDNA. The qRT-PCR primers for SlPLATZ family members were created using DNAMAN6 software. Table 1 lists the specific primers for the SlPLATZ genes. The following ingredients were included in the 20 μL qRT-PCR reaction system: 10 μL of the 2× ChamQ Universal SYBR qPCR Master Mix (Novozymes), 8.2 μL of ddH2O, 0.4 μL of upstream and downstream specific primers, and 1 μL of cDNA template. The reaction program was 120 s of pre-denaturation at 94 °C, 5 s of denaturation at 94 °C, 15 s of annealing time, and 10 s of extension at 72 °C for 45 cycles using a Roche Light Cycler 96 real-time quantitative fluorescence PCR apparatus. The internal reference gene was tomato actin. Three biological replicates and the 2-ΔΔCT method were used to calculate the relative expression, which was the difference between the relative values of the treatment and control groups. The CT of each treatment was subtracted from the CT of actin to obtain the ΔCT of each treatment. The mean of the control ΔCT was then computed, and the ΔCT for each treatment was subtracted from the ΔCT! to obtain the ΔΔCT for each treatment. The relative expression is then calculated using Equation 2−ΔΔCT. To examine if the data were normally distributed, we utilized the GraphPad Prism 9.0 program [54]. To ascertain whether variations in expression were significant, a paired one-way ANOVA was carried out.

5. Conclusions

The 24 SLPLATZ genes that were found in this investigation were grouped into four subfamilies. From an evolutionary perspective, the entire tomato gene family of Solanaceae has not contracted or expanded from its current status, and the evolution of PLATZ family genes has not been affected by the separation of cultivated tomato from potato and cultivated tomato from pennellii. Among them, SlPLATZ17, SlPLATZ21, and SlPLATZ22 underwent quantitative amplification rather than functional differentiation. SlPLATZ21 acts mainly in the leaves. The expression of SlPLATZ21 in leaf tissue was significantly increased after 2 and 12 h of salt stress. It is hypothesized that SlPLATZ21 plays an important role in the growth and development of tomatoes under salt stress. SlPLATZ23 was highly expressed in mature green fruits sprayed with NAA, as well as being much higher in mature green fruits sprayed with MT and mature green fruits sprayed with EBR than at other times. Thus, we proposed that SlPLATZ23 mostly affects fruits at the stage of green ripening. This study will lay the foundation for a deeper understanding of the evolutionary mechanisms and functional properties of the PLATZ family in tomatoes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12142632/s1, Table S1: PLATZ genes Identified from Whole Genomes of Heinz and Pennellii Tomatoes. Figure S1: Analysis of motif structure, gene structure, and phylogenetic analysis of SpPLATZ. Figure S2: Gene duplication events in the genome. Table S2: The Ka/Ks ratios and date of duplication for duplicate SlPLATZ genes. Table S3: The Ka/Ks ratios and date of duplication for duplicate SpPLATZ genes. Figure S3: The collinearity diagram of PLATZ genes. Figure S4: Heat map of tissue-specific expression of PLATZ genes in pennellii.

Author Contributions

N.L. and W.J. conceived and designed the project; L.Z. and Z.W. performed the experiments; T.Y. and F.Z. analyzed the data; L.Z. and T.Y. wrote the manuscript; N.L. and W.J. supervised and revised the manuscript. Thank all the above staff for the help in this study. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (32260763); Key Projects for Crop Traits Formation and Cutting-Edge Technologies in Biological Breeding (xjnkywdzc-2022001); Special Incubation Project of Science and Technology Renovation of Xinjiang Academy of Agricultural Sciences (xjkcpy-2021001).

Data Availability Statement

Data will be made available upon request.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Samad, A.F.A.; Sajad, M.; Nazaruddin, N.; Fauzi, I.A.; Murad, A.M.A.; Zamri, Z.; Ismanizan, I. MicroRNA and transcription factor: Key players in plant regulatory network. Front. Plant Sci. 2017, 8, 565. [Google Scholar] [CrossRef] [Green Version]
  2. Liu, Y.; Li, P.; Fan, L.; Wu, M. The nuclear transportation routes of membrane-bound transcription factors. Cell Commun. Signal. 2018, 16, 12. [Google Scholar] [CrossRef] [PubMed]
  3. Nath, V.S.; Mishra, A.K.; Kumar, A.; Matoušek, J.; Jakše, J. Revisiting the role of transcription factors in coordinating the defense response against citrus bark cracking viroid infection in commercial hop (Humulus lupulus L.). Viruses 2019, 11, 5. [Google Scholar]
  4. Nagano, Y.; Furuhashi, H.; Inaba, T.; Sasaki, Y. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences. Nucleic Acids Res. 2001, 29, 4097–4105. [Google Scholar] [CrossRef] [Green Version]
  5. Fu, Y.; Cheng, M.; Li, M.; Guo, X.; Wu, Y.; Wang, J. Identification and characterization of PLATZ transcription factors in wheat. Int. J. Mol. Sci. 2020, 21, 8934. [Google Scholar] [CrossRef]
  6. Zhang, S.-C.; Yang, R.; Huo, Y.-Q.; Liu, S.-S.; Yang, G.-D.; Huang, J.-G.; Zheng, C.-C.; Wu, C.-G. Expression of cotton PLATZ1 in transgenic Arabidopsis reduces sensitivity to osmotic and salt stress for germination and seedling establishment associated with modification of the abscisic acid, gibberellin, and ethylene signalling pathways. BMC Plant Biol. 2018, 18, 1–11. [Google Scholar] [CrossRef] [Green Version]
  7. Kim, J.H.; Kim, J.; Jun, S.E.; Park, S.; Timilsina, R.; Kwon, D.S.; Kim, Y.; Park, S.J.; Hwang, J.Y.; Nam, H.G.; et al. ORESARA15, a PLATZ transcription factor, mediates leaf growth and senescence in Arabidopsis. New Phytol. 2018, 220, 609–623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Wang, A.; Hou, Q.-Q.; Si, L.; Huang, X.-H.; Luo, J.-H.; Lu, D.-F.; Zhu, J.-J.; Shangguan, Y.-Y.; Miao, J.-S.; Xie, Y.-F. The PLATZ transcription factor GL6 affects grain length and number in rice. Plant Physiol. 2019, 180, 2077–2090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Zhou, S.R.; Xue, H.W. The rice PLATZ protein SHORT GRAIN6 determines grain size by regulating spikelet hull cell division. J. Integr. Plant Biol. 2019, 62, 847–864. [Google Scholar] [CrossRef]
  10. Yamada, M.; Han, X.; Benfey, P.N. RGF1 controls root meristem size through ROS signalling. Nature 2020, 577, 85–88. [Google Scholar] [CrossRef]
  11. Li, Q.; Wang, J.-C.; Ye, J.-W.; Zheng, X.-X.; Xiang, X.-L.; Li, C.-S.; Fu, M.-M.; Wang, Q.; Zhang, Z.-Y.; Wu, Y.-R. The maize imprinted gene Floury3 encodes a PLATZ protein required for tRNA and 5S rRNA transcription through interaction with RNA polymerase III. Plant Cell 2017, 29, 2661–2675. [Google Scholar] [CrossRef] [Green Version]
  12. Wang, J.-C.; Ji, C.; Li, Q.; Zhou, Y.; Wu, Y.-R. Genome-wide analysis of the plant-specific PLATZ proteins in maize and identification of their general role in interaction with RNA polymerase III complex. BMC Plant Biol. 2018, 18, 1–12. [Google Scholar] [CrossRef]
  13. Chao, Q.; Gao, Z.F.; Zhang, D.; Zhao, B.G.; Dong, F.Q.; Fu, C.X.; Liu, L.J.; Wang, B.C. The developmental dynamics of the Populus stem transcriptome. Plant Biotechnol. J. 2019, 17, 206–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Hande, A.S.; Katageri, I.S.; Jadhav, M.P.; Adiger, S.; Gamanagatti, S.; Padmalatha, K.V.; Dhandapani, G.; Kanakachari, M.; Kumar, P.A.; Reddy, V.S. Transcript profiling of genes expressed during fibre development in diploid cotton (Gossypium arboreum L.). BMC Genom. 2017, 18, 675. [Google Scholar] [CrossRef] [Green Version]
  15. Kasirajan, L.; Hoang, N.V.; Furtado, A.; Botha, F.C.; Henry, R.J. Transcriptome analysis highlights key differentially expressed genes involved in cellulose and lignin biosynthesis of sugarcane genotypes varying in fiber content. Sci. Rep. 2018, 8, 11612. [Google Scholar] [CrossRef] [Green Version]
  16. Li, H.; Wang, Y.; Xiao, Q.; Luo, L.; Zhang, C.; Mao, C. Transcription factor ZmPLATZ2 positively regulate the starch synthesis in maize. Plant Growth Regul. 2021, 93, 291–302. [Google Scholar] [CrossRef]
  17. González-Morales, S.I.; Chávez-Montes, R.A.; Hayano-Kanashiro, C.; Alejo-Jacuinde, G.; Rico-Cambron, T.Y.; de Folter, S.; Herrera-Estrella, L. Regulatory network analysis reveals novel regulators of seed desiccation tolerance in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2016, 113, E5232–E5241. [Google Scholar] [CrossRef]
  18. Liu, S.-S.; Yang, R.; Liu, M.; Zhang, S.-Z.; Yan, K.; Yang, G.-D.; Huang, J.-G.; Zheng, C.-C.; Wu, C.-G. PLATZ2 negatively regulates salt tolerance in Arabidopsis seedlings by directly suppressing the expression of the CBL4/SOS3 and CBL10/SCaBP8 genes. J. Exp. Bot. 2020, 71, 5589–5602. [Google Scholar] [CrossRef] [PubMed]
  19. So, H.A.; Choi, S.J.; Chung, E.; Lee, J.H. Molecular characterization of stress-inducible PLATZ gene from soybean (Glycine max L.). Plant Omics. 2015, 8, 479. [Google Scholar]
  20. Zenda, T.; Liu, S.; Wang, X.; Liu, G.; Jin, H.; Dong, A.; Yang, Y.; Duan, H. Key maize drought-responsive genes and pathways revealed by comparative transcriptome and physiological analyses of contrasting inbred lines. Int. J. Mol. Sci. 2019, 20, 1268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Hou, D.; Zhao, Z.; Hu, Q.; Li, L.; Vasupalli, N.; Zhuo, J.; Zeng, W.; Wu, A.; Lin, X. PeSNAC-1 a NAC transcription factor from moso bamboo (Phyllostachys edulis) confers tolerance to salinity and drought stress in transgenic rice. Tree Physiol. 2020, 40, 1792–1806. [Google Scholar] [CrossRef]
  22. Yamaguchi-Shinozaki, K.; Shinozaki, K. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci. 2005, 10, 88–94. [Google Scholar] [CrossRef] [PubMed]
  23. Ventura, I.; Brunello, L.; Iacopino, S.; Valeri, M.C.; Novi, G.; Dornbusch, T.; Perata, P.; Loreti, E. Arabidopsis phenotyping reveals the importance of alcohol dehydrogenase and pyruvate decarboxylase for aerobic plant growth. Sci. Rep. 2020, 10, 16669. [Google Scholar] [CrossRef]
  24. Margaritopoulou, T.; Kryovrysanaki, N.; Megkoula, P.; Prassinos, C.; Samakovli, D.; Milioni, D.; Hatzopoulos, P. HSP90 canonical content organizes a molecular scaffold mechanism to progress flowering. Plant J. 2016, 87, 174–187. [Google Scholar] [CrossRef] [PubMed]
  25. Koning, A.J.; Rose, R.; Comai, L. Developmental expression of tomato heat-shock cognate protein 80. Plant Physiol. 1992, 100, 801–811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Han, X.; Rong, H.; Tian, Y.; Qu, Y.; Xu, M.; Xu, L.-A. Genome-Wide Identification of PLATZ Transcription Factors in Ginkgo biloba L. and Their Expression Characteristics During Seed Development. Front. Plant Sci. 2022, 13. [Google Scholar] [CrossRef] [PubMed]
  27. Wai, A.H.; Rahman, M.M.; Waseem, M.; Cho, L.-H.; Naing, A.H.; Jeon, J.-S.; Lee, D.-j.; Kim, C.-K.; Chung, M.-Y. Comprehensive Genome-Wide Analysis and Expression Pattern Profiling of PLATZ Gene Family Members in Solanum lycopersicum L. under Multiple Abiotic Stresses. Plants 2022, 11, 3112. [Google Scholar] [CrossRef]
  28. Grabowski, E.; Miao, Y.; Mulisch, M.; Krupinska, K. Single-stranded DNA-binding protein Whirly1 in barley leaves is located in plastids and the nucleus of the same cell. Plant Physiol. 2008, 147, 1800–1804. [Google Scholar] [CrossRef] [Green Version]
  29. Krause, K.; Krupinska, K. Nuclear regulators with a second home in organelles. Trends Plant Sci. 2009, 14, 194–199. [Google Scholar] [CrossRef]
  30. Knowles, D.G.; Mclysaght, A. High rate of recent intron gain and loss in simultaneously duplicated Arabidopsis genes. Mol. Biol. Evol. 2006, 23, 1548–1557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Cao, J.; Shi, F. Dynamics of arginase gene evolution in metazoans. J. Biomol. Struct. Dyn. 2012, 30, 407–418. [Google Scholar] [CrossRef] [PubMed]
  32. Nekrutenko, A.; Makova, K.D.; Li, W.-H. The KA/KS ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 2002, 12, 198–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Azim, J.B.; Khan, M.F.H.; Hassan, L.; Robin, A.H.K. Genome-wide characterization and expression profiling of plant-specific PLATZ transcription factor family genes in Brassica rapa L. Plant Breed. Biotechnol. 2020, 8, 28–45. [Google Scholar] [CrossRef]
  34. Biłas, R.; Szafran, K.; Hnatuszko-Konka, K.; Kononowicz, A.K. Cis-regulatory elements used to control gene expression in plants. Plant Cell Tiss. Org. 2016, 127, 269–287. [Google Scholar] [CrossRef] [Green Version]
  35. León, J.; Castillo, M.C.; Gayubas, B. The hypoxia–reoxygenation stress in plants. J. Exp. Bot. 2020, 72, 5841–5856. [Google Scholar] [CrossRef]
  36. Azevedo, C.; Sadanandom, A.; Kitagawa, K.; Freialdenhoven, A.; Shirasu, K.; Schulze-Lefert, P. The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 2002, 295, 2073–2076. [Google Scholar] [CrossRef]
  37. Watanabe, E.; Mano, S.; Nomoto, M.; Tada, Y.; Hara-Nishimura, I.; Nishimura, M.; Yamada, K.J. HSP90 stabilizes auxin-responsive phenotypes by masking a mutation in the auxin receptor TIR1. Plant Cell Physiol. 2016, 57, 2245–2254. [Google Scholar] [CrossRef] [Green Version]
  38. Riechmann, J.L.; Heard, J.; Martin, G.; Reuber, L.; Jiang, C.-Z.; Keddie, J.; Adam, L.; Pineda, O.; Ratcliffe, O.J.; Samaha, R.R. Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 2000, 290, 2105–2110. [Google Scholar] [CrossRef]
  39. Kiełbowicz-Matuk, A. Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Sci. Int. J. Exp. Plant Biol. 2012, 185–186, 78–85. [Google Scholar] [CrossRef]
  40. Lian, L.; Xu, H.; Zhang, H.; He, W.; Zhang, J.F. Overexpression of OsSPL14 results in transcriptome and physiology changes in indica rice ‘MH86. ’ Plant Growth Regul. 2020, 90, 265–278. [Google Scholar] [CrossRef] [Green Version]
  41. Finn, R.D.; Clements, J.; Eddy, S.R. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, W29–W37. [Google Scholar] [CrossRef] [Green Version]
  42. Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; De Castro, E.; Duvaud, S.; Flegel, V.; Fortier, A.; Gasteiger, E. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012, 40, W597–W603. [Google Scholar] [CrossRef] [PubMed]
  43. Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.-W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant. 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  46. Rombauts, S.; Déhais, P.; Van Montagu, M.; Rouzé, P. PlantCARE, a plant cis-acting regulatory element database. Nucleic Acids Res. 1999, 27, 295–296. [Google Scholar] [CrossRef] [Green Version]
  47. Wang, D.-P.; Zhang, Y.-B.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A toolkit incorporating gamma-series methods and sliding window strategies. Genom. Proteom. Bioinf. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
  48. Wang, Y.-P.; Tang, H.-B.; Debarry, J.-D.; Tan, X.; Li, J.-P.; Wang, X.-Y.; Lee, T.-H.; Jin, H.-Z.; Marler, B.; Guo, H. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Green Version]
  49. Li, Y.-Y.; Zhu, J.-Q.; Ge, C.; Wang, Y.; Zhao, Z.-M.; Ma, S.-J.; Hoffmann, A.A.; Endersby, N.M.; Liu, Q.-X.; Yu, W.-D. Molecular phylogeny and historical biogeography of the butterfly tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Cells 2019, 8, 294. [Google Scholar] [CrossRef]
  50. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
  51. Su, G.; Morris, J.H.; Demchak, B.; Bader, G.D. Biological Network Exploration with Cytoscape 3. Curr. Protoc. Bioinf. 2014, 47, 8.13.1–8.13.24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Fei, Z.; Joung, J.-G.; Tang, X.; Zheng, Y.; Huang, M.; Lee, J.M. Tomato Functional Genomics Database: A Comprehensive Resource and Analysis Package for Tomato Functional Genomics. Nucleic Acids Res. 2011, 39, D1156–D1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Bolger, A.; Scossa, F.; Bolger, M.; Lanz, C.; Maumus, F.; Tohge, T. The genome of the stress-tolerant wild tomato species Solanum pennellii. Nat. Genet. 2014, 46, 1034–1038. [Google Scholar] [CrossRef]
  54. Swift, M.L. GraphPad prism, data analysis, and scientific graphing. J. Chem. Inform. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef]
Plants 12 02632 g001 550
Figure 1. Location of the SlPLATZ genes on the chromosomes of Heinz tomatoes.
Figure 1. Location of the SlPLATZ genes on the chromosomes of Heinz tomatoes.
Plants 12 02632 g001
Plants 12 02632 g002 550
Figure 2. Analysis of motif structure, gene structure, and phylogenetic analysis of SlPLATZ. (A) Ten amino acid motifs in the SlPLATZ protein are indicated by a colored box. (B) The blue box indicates exons, the purple box indicates UTRs, and the gray line indicates introns.
Figure 2. Analysis of motif structure, gene structure, and phylogenetic analysis of SlPLATZ. (A) Ten amino acid motifs in the SlPLATZ protein are indicated by a colored box. (B) The blue box indicates exons, the purple box indicates UTRs, and the gray line indicates introns.
Plants 12 02632 g002
Plants 12 02632 g003 550
Figure 3. Phylogenetic tree of PLATZ family members. The red rhombus indicates the cultivated tomato, whereas the green rhombus identifies the pennellii tomato. The blue line connects monocotyledons, while the purple line connects dicotyledons.
Figure 3. Phylogenetic tree of PLATZ family members. The red rhombus indicates the cultivated tomato, whereas the green rhombus identifies the pennellii tomato. The blue line connects monocotyledons, while the purple line connects dicotyledons.
Plants 12 02632 g003
Plants 12 02632 g004 550
Figure 4. Gene duplication events in the genome, with the circles from outer to inner representing the chromosomes of cultivated tomatoes, the gene density, and the N ratio presented in red dots, and the ends of the red lines representing direct homologous SlPLATZ genes. The legend represents the values of the gene density, With red representing high levels and yellow representing low levels.
Figure 4. Gene duplication events in the genome, with the circles from outer to inner representing the chromosomes of cultivated tomatoes, the gene density, and the N ratio presented in red dots, and the ends of the red lines representing direct homologous SlPLATZ genes. The legend represents the values of the gene density, With red representing high levels and yellow representing low levels.
Plants 12 02632 g004
Plants 12 02632 g005 550
Figure 5. The collinearity diagram of PLATZ genes. Red lines highlight the homologous gene pairs of SlPLATZ genes, and gray lines represent genome-wide collinear gene pairs.
Figure 5. The collinearity diagram of PLATZ genes. Red lines highlight the homologous gene pairs of SlPLATZ genes, and gray lines represent genome-wide collinear gene pairs.
Plants 12 02632 g005
Plants 12 02632 g006 550
Figure 6. The number of cis-acting elements contained in the promoter of the SlPLATZ genes. The number of cis-acting elements involved in different regulatory pathways varies. Darker red colors indicate higher numbers of cis-acting elements. Darker blue colors indicate lower numbers of cis-acting elements.
Figure 6. The number of cis-acting elements contained in the promoter of the SlPLATZ genes. The number of cis-acting elements involved in different regulatory pathways varies. Darker red colors indicate higher numbers of cis-acting elements. Darker blue colors indicate lower numbers of cis-acting elements.
Plants 12 02632 g006
Plants 12 02632 g007 550
Figure 7. An interaction network of PLATZ genes in tomato. Each node is a protein, and each edge represents the presence of interactions. The size of the node represents the number of interactions. The thickness of the edge represents the value of the combined score. Red nodes represent PLATZ proteins, blue nodes represent stress-related proteins, and gray nodes represent proteins lacking annotation.
Figure 7. An interaction network of PLATZ genes in tomato. Each node is a protein, and each edge represents the presence of interactions. The size of the node represents the number of interactions. The thickness of the edge represents the value of the combined score. Red nodes represent PLATZ proteins, blue nodes represent stress-related proteins, and gray nodes represent proteins lacking annotation.
Plants 12 02632 g007
Plants 12 02632 g008 550
Figure 8. Heat map of tissue-specific expression of PLATZ genes in tomato. The color bar represents the log2 expression values, with red representing high expression levels and blue representing low expression levels. The gene name is shown on the right side. LA1589 20-day post-anthesis fruit (20 DPA), LA1589 10-day post-anthesis fruit (10 DPA1), LA1589 10-day post-anthesis fruit 2 (10 DPA2), LA1589 root (ROOT), LA1589 anthesis flowers (0 DPA), LA1589 vegetative meristems (MERI), LA1589 young flower buds (YFB), LA1589 young leaves (YL), LA1589 hypocotyl (HYPO), LA1589 cotyledons (COTYL), LA1589 ripening fruit (33 DPA), and LA1589 mature leaves (ML).
Figure 8. Heat map of tissue-specific expression of PLATZ genes in tomato. The color bar represents the log2 expression values, with red representing high expression levels and blue representing low expression levels. The gene name is shown on the right side. LA1589 20-day post-anthesis fruit (20 DPA), LA1589 10-day post-anthesis fruit (10 DPA1), LA1589 10-day post-anthesis fruit 2 (10 DPA2), LA1589 root (ROOT), LA1589 anthesis flowers (0 DPA), LA1589 vegetative meristems (MERI), LA1589 young flower buds (YFB), LA1589 young leaves (YL), LA1589 hypocotyl (HYPO), LA1589 cotyledons (COTYL), LA1589 ripening fruit (33 DPA), and LA1589 mature leaves (ML).
Plants 12 02632 g008
Plants 12 02632 g009 550
Figure 9. Relative expression of SlPLATZ2, SlPLATZ21, SlPLATZ23, and SlPLATZ24 in roots, stems, and leaves. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c.
Figure 9. Relative expression of SlPLATZ2, SlPLATZ21, SlPLATZ23, and SlPLATZ24 in roots, stems, and leaves. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c.
Plants 12 02632 g009
Plants 12 02632 g010 550
Figure 10. Expression analysis of the SlPLATZ genes under hormone stress during fruit development. The error bar shows the standard deviation of three biological repeats. EP—Expending period; MG—Mature green period; BP—breaker period; RRP—Red ripening period; CK—control; NAA—naphthenic acid; EBR—2,4 epibrassinolide; MT—melatonin. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c. The largest average that begins with the letter c should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter c to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter d.
Figure 10. Expression analysis of the SlPLATZ genes under hormone stress during fruit development. The error bar shows the standard deviation of three biological repeats. EP—Expending period; MG—Mature green period; BP—breaker period; RRP—Red ripening period; CK—control; NAA—naphthenic acid; EBR—2,4 epibrassinolide; MT—melatonin. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c. The largest average that begins with the letter c should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter c to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter d.
Plants 12 02632 g010
Plants 12 02632 g011 550
Figure 11. Analysis of salt stress expression in SlPLATZ1 and SlPLATZ21 leaves. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c.
Figure 11. Analysis of salt stress expression in SlPLATZ1 and SlPLATZ21 leaves. p < 0.0001. The standard is the largest average marked with a, and the following unmarked averages are marked with the letter a where it is not significant until a certain average that differs significantly from it is marked with the letter b. The largest average that begins with the letter b should then be used as a benchmark for comparison with the remaining averages. Continue to append the letter b to any non-significant variances. Until they differ sufficiently, at which point they are designated with the letter c.
Plants 12 02632 g011
Table
Table 1. Primer sequences for qRT-PCR experiments.
Table 1. Primer sequences for qRT-PCR experiments.
Gene NameForward Primer (5′→3′)Reverse Primer (5′→3′)
SIPLATZ1CGGGTTTAGACGATGGTCAAGTTTCTTCCTTACCACCTCTGTTG
SIPLATZ2TGGAAGAGATGATGAAACCTGCGAGGATGTGAGTGATGTTGTGG
SIPLATZ4GCCACATTCTGGGTCTGTCTCCACATTCTGGGTCTGTCTCAT
SIPLATZ5ATTGCTTTGAATCCTCTGCCACTGAAACGGAGGGAGAGAAATG
SIPLATZ12GCTTTGAATCCTCTGCCACACATCGCCAAACAACCACT
SIPLATZ14CTTTGAATCCTCTGCCACATTGCTTCGTCTCAACAATCTTTCCC
SIPLATZ19TTGCGTTGCTACAGACGAACTTATGTGGCAGCGGATTCA
SIPLATZ20ACAGACAAACACAATGGGCAGCAGCGGATTCAAAGCAAC
SIPLATZ21GGTTGAAGCCATTGTTGAAGGCGATGACCTCCGAATCTGAAT
SIPLATZ23TGCCGCTCATCTAAACACAATGCCACTGCTCTTTGGTTG
SIPLATZ24GCTAAAGCACCACAAGGACCTATGGCTCGTCATTGTCCACG
ActinCAGGGTGTTCTTCAGGAGCAAGGTGTTATGGTCGGAATGGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, L.; Yang, T.; Wang, Z.; Zhang, F.; Li, N.; Jiang, W. Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato. Plants 2023, 12, 2632. https://doi.org/10.3390/plants12142632

AMA Style

Zhang L, Yang T, Wang Z, Zhang F, Li N, Jiang W. Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato. Plants. 2023; 12(14):2632. https://doi.org/10.3390/plants12142632

Chicago/Turabian Style

Zhang, Lifang, Tao Yang, Zepeng Wang, Fulin Zhang, Ning Li, and Weijie Jiang. 2023. "Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato" Plants 12, no. 14: 2632. https://doi.org/10.3390/plants12142632

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop