Next Article in Journal
Network Pharmacological Analysis and Experimental Validation of the Effect of Smilacis Glabrae Rhixoma on Gastrointestinal Motility Disorder
Previous Article in Journal
Unleashing the Potential of Medicinal Plants in Benin: Assessing the Status of Research and the Need for Enhanced Practices
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 7
10.3390/plants12071507
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Fine Mapping of the Affecting Tillering and Plant Height Gene CHA-1 in Rice

by
Tengkui Chen
,
Wuming Xiao
,
Cuihong Huang
,
Danhua Zhou
,
Yongzhu Liu
,
Tao Guo
,
Zhiqiang Chen
and
Hui Wang
*
National Engineering Research Center of Plant Space Breeding, South China Agricultural University, Guangzhou 510642, China
*
Author to whom correspondence should be addressed.
Plants 2023, 12(7), 1507; https://doi.org/10.3390/plants12071507
Submission received: 16 February 2023 / Revised: 25 March 2023 / Accepted: 29 March 2023 / Published: 30 March 2023
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)
Browse Figures
Versions Notes

Abstract

:
The plant architecture of rice is an important factor affecting yield. Strigolactones (SLs) are newly discovered carotenoid-derived plant hormones that play an important role in rice plant architecture. In this study, a high-tillering dwarf mutant, CHA-1, was identified by spatial mutagenesis. CHA-1 was located in the region of 31.52–31.55 MB on chromosome 1 by map-based cloning. Compared with the wild-type THZ, the CHA-1 mutant showed that ACCAC replaced TGGT in the coding region of the candidate gene LOC_Os01g54810, leading to premature termination of expression. Genetic complementation experiments proved that LOC_Os01g54810 was CHA-1, which encodes a putative member of Class III lipase. Expression analysis showed that CHA-1 was constitutively expressed in various organs of rice. Compared with those in THZ, the expression levels of the D17 and D10 genes were significantly downregulated in the CHA-1 mutant. In addition, the concentrations of ent-2′-epi-5-deoxystrigol (epi-5DS) in the root exudates of the CHA-1 mutant was significantly reduced compared with that of THZ, and exogenous application of GR24 inhibited the tillering of the CHA-1 mutant. These results suggest that CHA-1 influences rice architecture by affecting SL biosynthesis.

1. Introduction

Rice (Oryza sativa L.) is one of the most important food crops in the world and plays an important role in global food production and consumption [1]. More than half of the world’s population depends on rice as a staple food [2]. Improving rice yield is still one of the main goals of rice breeding. Rice plant type is mainly determined by plant height, tillering and panicle structure, which directly affect the lodging resistance and yield potential of rice varieties [3].
The tillering development of rice is regulated by the initiation and outgrowth of axillary buds [4]. MOC1 is the first cloned key gene that positively regulates rice tillering and encodes plant-specific GRAS family proteins, which activate axillary buds and promote tiller bud outgrowth [5]. MOC3 encodes a protein with the highest homology to Arabidopsis WUS, which is a key factor in tiller bud initiation and regulates tiller bud outgrowth. FON1 positively regulates the outgrowth of tillering buds [6,7]. MOC3 binds to the promoter of FON1 and activates its expression. As a coactivator of MOC3, MOC1 enhances FON1 expression in the presence of MOC3 [8].
Plant hormones such as gibberellins (GAs), cytokinins (CKs), brassinosteroids (BRs), auxins, and strigolactones (SLs) are involved in the regulation of plant structure in rice. Among them, SLs are plant hormones, which have been discovered in recent years, that are produced by plant roots and transported upward to axillary buds, playing an important role in inhibiting the outgrowth of axillary buds [9,10].
The mutation in SL biosynthesis or signal led to plant dwarfing and increased tiller number [11]. D27, D17/HTD1 and D10 are key genes in the SL biosynthesis pathway in rice [12]. D27 encodes an iron-containing protein that converts 9-trans-β-carotenone into 9-cis-β-carotenone [13]. D17 encodes carotenoid cleavage dioxygenase 7 (CCD7), which converts 9-cis-β-carotene to 9-cis-β-apo-10′-carotenone [14]. D10, which encodes carotenoid cleavage dioxygenase 8 (CCD8), is located downstream of CCD7 and converts 9-cis-10′-deoxy-β-daucosterol into a conserved endogenous precursor of SLs—caractone (CL) [14,15].
D14, D3, and D53 play a major role in the perception and signal transduction of SLs [11]. D53 encodes a protein similar to Clp ATPase I, which is an inhibitor of the SL signaling pathway [16]. D3 encodes an F-box protein rich in leucine repeats, and D53 is the ubiquitination substrate of D3 [17]. D14 encodes a protein of the α/β-hydrolase superfamily, which can hydrolyze SLs to form covalently linked intermediate molecules (CLIMs) and combine with CLIM as a receptor [18,19]. SLs promote the interaction of D14 with D53 and the F-box protein D3, which induces ubiquitination and the degradation of D53, thereby inhibiting plant branching [17]. Ideal plant structure 1 (IPA1) encodes a member of the SQUAMOSA promoter-binding protein-like (SPL) family transcription factor SPL14 and acts as the direct downstream component targeted by D53 to regulate the SL response and SL-induced gene expression in rice [20]. Although several genes related to the SL pathway have been cloned, the upstream genes affecting the SL pathway are still limited.
Lipase has the function of degrading triacylglycerol to glycerols and free fatty acids, which are widely distributed in animals, plants, and prokaryotes [21]. According to the amino acid structure characteristics of lipases, lipases can be divided into GxSxG (Gly-x-Ser-x-Gly) motif lipases and GDSL (Gly-Asp-Ser-Leu) motif lipases. Many GDSL lipases have been characterized in plants and participate in hormone signal transduction, cuticle formation, xylan deacetylation, and secondary metabolism [22]. Class III lipase is a member of the lipase family and plays a crucial role in many biological reactions such as lipid degradation, esterification, and transesterification [21]. Class III lipase plays an important role in plant growth and development. In rice, EG1 encodes a class III lipase family protein, which is involved in the regulation of lipid metabolism in floral organs and affects the development of floral organs and spikelets [23].
The space environment has the characteristics of high vacuum, microgravity, a weak magnetic field, and complex radiation [24]. A complex space environment can lead to mutations in plant phenotypes, cell structures, genetic material, and proteins [24,25]. Space mutation technology is an effective way to develop new varieties of crops [26].
In this study, the high-tillering dwarf mutant CHA-1 was obtained by space mutagenesis. Compared with THZ, the CHA-1 mutant showed dwarfing, high tillering, small panicles, and poor pollen fertility. We used the F2 population for fine mapping to locate CHA-1 encoding lipase III, which is a new mutation site obtained by spatial mutagenesis. Our results demonstrate that CHA-1 influences rice architecture through the SL biosynthesis pathway. Identification of mutant CHA-1 and cloning of the high-tillering dwarf gene CHA-1 provide germplasm resources for rice.

2. Results

2.1. Phenotypic Analysis of the CHA-1 Mutant

In previous studies, the high-tillering dwarf mutant CHA-1 was identified from the SP2 population of indica rice variety Te-Hua-Zhan (THZ) induced by high-altitude ballooning, and the mutant gene CHA-1 was found to be linked with the marker RM302 [27,28]. Compared with THZ, CHA-1 exhibited lower plant height, increased tiller number, lower seeding rate, and shorter and thinner leaves (Figure 1A,B,F–K). The tillering dynamics of CHA-1 and THZ showed that there was no significant difference in the early tillering stage. After seedling growth for five weeks, the tiller number of THZ increased slowly and peaked at the eighth week, while the tiller number of CHA-1 increased rapidly after the fifth week and peaked at the eighth week (Supplementary Figure S1A–D). Finally, the tiller number of CHA-1 was more than twice that of THZ.
The plant height of the CHA-1 mutant was only approximately half that of THZ at the mature stage (Figure 1F). By comparing and analyzing the length of the upper five internodes of CHA-1 and THZ, it was found that the length of each internode of CHA-1 was shorter than that of THZ (Figure 1C,E). Compared with THZ, the shortening proportion of CHA-1 increased gradually from the I internode to the Ⅴ internode (Figure 1D).
In addition, the seed setting rate of CHA-1 reached only 61.95%. KI-I2 staining was used to assess the pollen viability, and the results showed that the pollen viability of CHA-1 was only 62.9%, which was much lower than the 95.1% of THZ. We also found that the anthers of CHA-1 were smaller and thinner than those of THZ (Supplementary Figure S1E–G). Therefore, the poor seed setting rate of mutant CHA-1 may be caused by low pollen fertility.

2.2. Microscopic Observation of the CHA-1 Mutant

To identify the factors responsible for the shortened internodes in CHA-1, longitudinal sections of the upper five internodes of CHA-1 and THZ were conducted to observe and compare their internode cell length under an optical microscope. Compared with THZ, the average longitudinal length of cells in internode I, internode II, and internode IV of CHA-1 was greater (Figure 2A,B), which indicated that the difference in internode length between THZ and mutant CHA-1 was not due to cell size. These results suggest that the shortening of internodes was due to the reduction in the number of longitudinal cells.

2.3. Fine-Mapping of CHA-1

The F2 population derived from the cross between the CHA-1 mutant and japonica rice cultivar 02428 was used for fine mapping of the CHA-1 gene. The plant height in the F2 population showed obvious high-dwarf separation and a continuous bimodal distribution, which indicated that there was a major gene in the CHA-1 mutant leading to dwarfing. The separation ratio of high-dwarf plants was 3.04:1, which showed that CHA-1 was a recessive gene (Table 1). According to the previously identified marker RM302 on the long arm of chromosome 1 [27], which was linked to CHA-1, we carried out further fine mapping of CHA-1 using dwarf plants with a homozygous genotype in the F2 population by SSR markers and InDel markers. As a result, CHA-1 was flanked by markers DL1 and DL2, spanning the region from 31.51 Mb to 31.59 Mb of chromosome 1 (Figure 3A). To further narrow the interval of CHA-1, 2393 recessive homozygous genotype plants were developed by expanding the F2 population to perform fine mapping. Finally, CHA-1 was located in a region of 29.52 kb flanked by markers DL5 and DL8 (Figure 3A), which covered three candidate genes (Table 2).

2.4. Analysis of Candidate Genes of CHA-1

Sequencing analysis of three candidate genes within a 29.52 kb region on chromosome 1 showed that ACCAC replaced TGGT in 2382–2386 bp after the initial codon of LOC_Os01g54810, and the mutation site was Chr1.31524649-31524653 (-) (Figure 3B). This mutation causes code shift mutation, termination codons appear in advance, and translation terminates in advance. There was no sequence difference among other candidate genes between the CHA-1 mutant and THZ. Therefore, LOC_Os01g54810 was the likely candidate gene of CHA-1. To confirm that LOC_Os01g54810 is CHA-1, we introduced a DNA fragment containing the entire genome sequence of LOC_Os01g54810 including its upstream 2 kb sequence into the CHA-1 background. The height, tillering, and pollen fertility of the T1 transgenic plants were fully restored to those of the wild type (Figure 3C,D). These results fully demonstrate that the mutation of LOC_Os01g54810 was responsible for the phenotypic variation of mutant CHA-1.

2.5. Expression and Evolutionary Analysis of CHA-1

LOC_Os01g54810 encodes a putative member of Class III lipase, which hydrolyzes the ester bond of triglycerides. Using the RiceXPro database [29] (http://ricexpro.dna.affrc.go.jp/, accessed on 20 February, 2022) to analyze its expression profile, it was revealed that LOC_Os01g54810 was expressed in multiple tissues of rice (Figure 4A). qRT–PCR was performed in several rice tissues, and the results were consistent with those in the database. LOC_Os01g54810 was expressed in multiple tissues including the leaf lamina, leaf sheath, root, flower, culm, and seed (Figure 4B).
Phylogenetic tree analysis and amino acid sequence alignment revealed that CHA-1 homologs were conserved in several monocots and dicots, respectively (Supplementary Figure S3). Furthermore, the CHA-1 homology showed obvious separation between the dicot and monocot species groups in the phylogenetic tree analysis (Supplementary Figure S2), indicating that it underwent a different evolution after the differentiation of the dicot and monocot species groups.
Six CHA-1 homologs were identified in rice. Sequence alignment showed that the N-terminal amino acid sequence of CHA-1 was quite different from that of other homologs and that the amino acid sequence of CHA-1 was longer (Supplementary Figure S5). This implied that CHA-1 may have a unique biological function. LOC_Os01g14080 and LOC_Os01g47610 were similar to CHA-1 in gene structure, but the CDD-Blast results showed that only CHA-1 had the III lipase domain (Supplementary Figure S4).
In order to detect whether CHA-1 has lipase activity, the lipase activity of the fusion protein GST-CHA-1 was determined using p-nitrophenyl butyrate as a substrate. Compared with the control and GST alone, GST-CHA-1 hydrolyzed the lipid substrate effectively (Figure 4C), indicating that CHA-1 has lipase activity and is a functional lipase.

2.6. CHA-1 Affects the SL Biosynthesis

In rice, mutation of the biosynthetic and signaling pathways of SLs leads to dwarfing and high-tillering phenotypes [30]. The phenotype of the CHA-1 mutant was similar to the phenotype of mutants related to the biosynthetic and signaling pathways of SLs. Therefore, we speculated that CHA-1 may influence the rice architecture by affecting the SL pathway. To determine whether CHA-1 affected the SL pathway, we measured the epi-5DS content in the root exudates of THZ and CHA-1 by HPLC-MS/MS. Compared with THZ, CHA-1 had significantly lower amounts of epi-5DS (Figure 5C). The results of qRT–PCR analysis showed that the expression levels of the D17, D10, D14, and D3 in the CHA-1 mutant were significantly downregulated (Figure 5B). After 1 μmol synthetic strigolactone (GR24) treatment, the CHA-1 and THZ tillers were inhibited; that is, the CHA-1 phenotype with multiple tillers was rescued (Figure 5A). These results demonstrate that the mutation of CHA-1 led to the downregulation of SL biosynthesis genes D17 and D10, which resulted in the decrease in endogenous SL content.

3. Materials and Methods

3.1. Plant Materials and Phenotypic Characterization

An F2 population was constructed using 02428 (Oryza sativa L. ssp. japonica) and the CHA-1 mutant (Oryza sativa L. ssp. indica) as the male and female parents, respectively. All rice populations were planted in the experimental field of the South China Agricultural University Campus Teaching & Research Base (Guangzhou, 23.16° N, 113.36° E), where there was no disease stress. There were six rows per plot, six plants per row, and a planting interval of 20 × 20 cm. Mature pollen grains were stained with 1% I2-KI solution and photographed with an Olympus CX31 light microscope (Olympus Corporation, Tokyo, Japan). Mature anthers were photographed with an Optec DV500 Digital Camera system (Optec, Chongqing, China).

3.2. Histological Analysis

At the mature stage of rice, five internode tissues (approximately 2–3 mm) from the stems of the main panicle were fixed with FAA (5% formaldehyde, 5% acetic acid, and 90% ethanol), dehydrated with a gradient alcohol, and then embedded into paraffin. The sections were stained with toluidine blue and observed under an Olympus IX70 light microscope (Olympus, Tokyo, Japan).

3.3. Fine Mapping of CHA-1

DNA samples of the F2 population were extracted from leaves by the cetyltrimethylammonium bromide (CTAB) method [31]. SSR marker primer sequences were obtained by using the Grame database (https://www.gramene.org, accessed on 20 February 2022) and developing new Indel marker sequences for the fine-scale localization of CHA-1 (Table 3). Linkage analysis was performed on 3205 F2 plants with recessive homozygous genotypes using polymorphic markers.

3.4. Phylogenetic Tree Construction and Analysis

CHA-1 and homologous sequences were downloaded from the NCBI database. Phylogenetic trees were constructed using MEGA7.0 [32]. Sequence relationships were inferred using the maximum likelihood (ML) method. The conserved motifs were predicted using the online multiple expectation maximization for motif elicitation (MEME) program [33]. Images were generated using TBtools software [34].

3.5. Lipase Activity Assay

The CDS sequence of CHA-1 was amplified by Phanta Max Super-Fidelity DNA Polymerase (Vazyme, Nanjing, Jiangsu, China) and cloned into the pGEX-4T-1 vector. The recombinant vector was transformed into Escherichia coli strain BL21 (DE3) and the expression of the recombinant protein was induced by isopropylthio-β-galactoside. Purification of CHA-1 and the lipase assay were performed as described previously [35]. The recombinant protein was incubated with 1 mM p-nitrophenyl butyrate substrate in enzyme reaction buffer (0.5 M HEPES, pH 6.5) at 30 °C for 1 h. The absorbance was measured every 10 min at 405 nm for 120 min.

3.6. RNA Extraction and Quantitative Real-Time PCR (qPCR)

Total RNA was extracted from various organs using a TRIzol Kit (Invitrogen) following the manufacturer’s method. cDNA was reverse transcribed using 5× HiScript III qRT SuperMix (Vazyme). qPCR experiments were performed using AceQ qPCR SYBR Green Master Mix (Vazyme) and the ABI Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The relative expression was estimated by the 2−ΔΔCT method [36].

3.7. Vector Construction and Transformation

The full-length DNA and upstream promoter (approximately 2 kb from the start codon) of CHA-1 were cloned into the pCAMBIA1300 vector, which was introduced into Agrobacterium tumefaciens strain EHA105 and then transformed into rice callus, as previously reported [37].

3.8. GR24 Treatment

SL analysis in the rice root exudates was quantified by Webiolotech (Nanjing, China) as previously reported [16] with minor modifications. One-week-old seedlings were grown on hydroponic culture medium without phosphate for 14 days. The hydroponic culture medium was collected, and the fresh root weight was recorded. A total of 50 mL hydroponic culture medium was loaded into a pre-balanced Oasis HLB 3cc cartridge (Waters, Milford, MA, USA) and the column was washed with deionized water. Fractions containing SLs were eluted with acetone, collected and dried under nitrogen, then reconstituted in acetonitrile and subjected to HPLC-tandem mass spectrometry (HPLC-MS/MS) analysis. SLs analysis was performed on a quadruple linear ion trap hybrid MS (QTRAP 6500, AB SCIEX) equipped with an electrospray ionization source coupled with a HPLC (Aglient1290, Aglient, Santa Clara, CA, USA).
Hydroponic culture medium preparation and GR24 (Coolaber, Beijing, China) treatment were performed as previously described [9]. The 1-week-old seedlings were grown in a climatic cabinet under 16 h light at 28 °C and 8 h dark at 25 °C for another 28 days, and the hydroponic culture medium with or without 1 μmol GR24 was renewed every week.

4. Discussion

Compared with other physical mutations, space mutation has the characteristics of non-replication. Each space mutation is subject to different spatial radiation, and the obtained mutants showed various types with different frequencies [25]. Space mutation breeding has a unique advantage and role in creating excellent new germplasms, inducing new gene resource mutations and cultivating new varieties of crops, which is an effective method for crop genetic improvement [24,26,38,39].
In a previous study, the this1 mutant showed a phenotype with dwarfing, high-tillering, and poor pollen fertility, which was similar to that of the CHA-1 mutant, and THIS1 was found to be LOC_Os01g54810 [40]. In this study, the CHA-1 mutation site was not consistent with the this1 mutation site. LOC_Os01g54810 in the this1 mutant had a 356-bp deletion covering the intron and the second exon, while LOC_Os01g54810 in the CHA-1 mutant had a mutation of ACCAC replaced TGGT on the second exon. There was no genotype similar to the CHA-1 mutant in the locus of LOC_Os01g54810 in approximately 3000 natural varieties of rice using the Rice Functional Genomics and Breeding (RFGB) database [41] (http://www.rmbreeding.cn/, accessed on 20 February 2022). Therefore, CHA-1 was identified as a new allele of THI1S1 obtained by space mutation in this study.
At present, several genes related to the SL pathway have been identified, mainly including the SL signaling genes D53, D14, and D3 and SL biosynthesis genes D27, D17, and D10 [11]. In the mutant of SL signaling genes, SL biosynthesis genes are upregulated by negative feedback regulation [17,42]. In d53, d14, and d27 mutants, the expression of the D10 gene was significantly upregulated by feedback regulation [42]. In contrast, the expression of D10 was significantly downregulated in the d17 mutant [30]. The CHA-1 mutant showed the phenotype of dwarfing and high tillering (Figure 1A,B), which was similar to the phenotype of the mutant associated with the SL pathway. Histological analysis of the d53 mutant showed that the shortening and thinning of the stem of the d53 mutant were mainly caused by the decrease in cell number [17]. Histological analysis of the CHA-1 mutant and THZ also proved that the difference in stem node length was associated with the number of cells (Figure 2A,B). The expression of SL biosynthesis genes was downregulated in the CHA-1 mutant (Figure 5B). The CHA-1 mutant had significantly lower concentrations of epi-5DS in the root exudates, and the tillering of the CHA-1 mutant was inhibited after GR24 treatment (Figure 5A,C). Therefore, CHA-1 influences rice architecture by affecting SL biosynthesis.
Lipase regulates plant disease resistance and floral organ development by affecting the auxin pathway [35,43,44]. Auxin positively regulates the expression of SL biosynthesis genes D17 and D10 in Arabidopsis and rice [45]. The mutation of CHA-1 led to the downregulation of D17 and D10 expression without affecting D27 expression (Figure 5B). The CHA-1 mutant has some mutant phenotypes that SL pathway mutants do not have. The expression pattern of CHA-1 regulated SL biosynthesis genes is similar to that of auxin regulated SL biosynthesis genes. Therefore, we speculated that CHA-1 indirectly regulates SL biosynthesis by affecting the auxin pathway, and its molecular mechanism remains to be further studied.
Several lipase genes have been identified to affect pollen fertility in rice [35,43,46]. The anthers of the rms2 mutant with abnormal pollen atrophy resulted in complete male sterility. Cytological and genetic analysis showed that RMS2 had lipase activity and was necessary for anther development and pollen fertility [35]. OsGELP34 encodes a putative GDSL lipase/esterase. The osgelp34 mutant exhibits an abnormal outer wall, leading to pollen sterility [46]. EG1 encodes a class III lipase family protein involved in the regulation of lipid metabolism in floral organs [23]. CHA-1 encodes a III lipase protein and has lipase activity (Figure 4C). The CHA-1 mutant showed anther atrophy, poor pollen fertility, and a decreased seed setting rate. Accordingly, CHA-1, as a lipase, affects anther development and pollen fertility.

5. Conclusions

The CHA-1 mutant showed dwarfing, multi-tillering, and poor pollen fertility. Based on map-based cloning and candidate gene sequencing, LOC_Os01g54810 was proven to be CHA-1, which regulated rice architecture and pollen fertility. CHA-1 regulates the rice architecture by affecting strigolactone biosynthesis. The study on CHA-1 will contribute to further research of the strigolactone pathway in rice.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12071507/s1, Supplementary Figure S1: Morphology comparison between THZ and CHA-1 in the tiller and pollen fertility; Supplementary Figure S2: Evolutionary relationships, conserved protein motifs, and gene structure in the CHA-1 homologs from various species; Supplementary Figure S3: The CHA-1 homologous protein amino acid sequence alignment in various species; Supplementary Figure S4: Evolutionary relationships, conserved protein motifs, and gene structure in the CHA-1 homologs from rice; Supplementary Figure S5: The CHA-1 homologous protein amino acid sequence alignment in rice.

Author Contributions

Conceptualization, W.X., Y.L., T.G. and Z.C.; Data curation, D.Z.; Formal analysis, T.C.; Funding acquisition, H.W.; Investigation, T.C., C.H. and D.Z.; Methodology, H.W.; Project administration, H.W.; Software, T.C.; Supervision, W.X., Z.C. and H.W.; Validation, Y.L. and T.G.; Visualization, T.C. and C.H.; Writing—original draft, T.C.; Writing—review & editing, W.X. All authors have read and agreed to the published version of the manuscript.

Funding

Supported by a grant (2022B0202060006) from Guangdong Key Areas R&D Program Project, a grant (CARS-01) from the National Rice Industry Technology System of China, and the Guangdong Basic and Applied Basic Research Foundation (2021A1515010410), China.

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Khush, G.S. What it will take to feed 5.0 billion Rice consumers in 2030. Plant Mol. Biol. 2005, 59, 1–6. [Google Scholar] [CrossRef] [PubMed]
  2. Godfray, H.; Beddington, J.R.; Crute, I.R.; Haddad, L.; Lawrence, D.; Muir, J.F.; Pretty, J.; Robinson, S.; Thomas, S.M.; Toulmin, C. Food Security: The challenge of feeding 9 billion people. Science 2010, 327, 812–818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Bai, S.; Smith, S.M.; Li, J. Rice Plant Architecture: Molecular Basis and Application in Breeding. In Rice Genomics, Genetics and Breeding; Bai, S., Smith, S.M., Li, J., Sasaki, T., Ashikari, M., Eds.; Springer: Cham, Switzerland, 2018; pp. 129–154. [Google Scholar]
  4. Domagalska, M.A.; Leyser, O. Signal integration in the control of shoot branching. Nat. Rev. Mol. Cell Biol. 2011, 12, 211–221. [Google Scholar] [CrossRef] [PubMed]
  5. Li, X.Y.; Qian, Q.; Fu, Z.M.; Wang, Y.H.; Xiong, G.S.; Zeng, D.L.; Wang, X.Q.; Liu, X.F.; Teng, S.; Hiroshi, F.; et al. Control of tillering in rice. Nature 2003, 422, 618–621. [Google Scholar] [CrossRef] [PubMed]
  6. Tanaka, W.; Ohmori, Y.; Ushijima, T.; Matsusaka, H.; Matsushita, T.; Kumamaru, T.; Kawano, S.; Hirano, H.Y. Axillary meristem formation in rice requires the WUSCHEL ortholog TILLERS ABSENT1. Plant Cell 2015, 27, 1173–1184. [Google Scholar] [CrossRef] [Green Version]
  7. Lu, Z.; Shao, G.N.; Xiong, J.S.; Jiao, Y.Q.; Wang, J.; Liu, G.F.; Meng, X.B.; Liang, Y.; Xiong, G.S.; Wang, Y.H.; et al. MONOCULM 3, an ortholog of WUSCHEL in rice, is required for tiller bud formation. J. Genet. Genom. 2015, 42, 71–78. [Google Scholar] [CrossRef]
  8. Shao, G.N.; Lu, Z.F.; Xiong, J.S.; Wang, B.; Jing, Y.H.; Meng, X.B.; Liu, G.F.; Ma, H.Y.; Liang, Y.; Chen, F.; et al. Tiller bud formation regulators MOC1 and MOC3 cooperatively promote tiller bud outgrowth by activating FON1 expression in rice. Mol. Plant 2019, 12, 1090–1102. [Google Scholar] [CrossRef] [Green Version]
  9. Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K.; et al. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef]
  10. Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pages, V.; Dun, E.A.; Pillot, J.P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.C.; et al. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef]
  11. Mashiguchi, K.; Seto, Y.; Yamaguchi, S. Strigolactone biosynthesis, transport and perception. Plant J. 2021, 105, 335–350. [Google Scholar] [CrossRef]
  12. Jia, K.P.; Baz, L.; Al-Babili, S. From carotenoids to strigolactones. J. Exp. Bot. 2018, 69, 2189–2204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Lin, H.; Wang, R.X.; Qian, Q.; Yan, M.X.; Meng, X.B.; Fu, Z.M.; Yan, C.Y.; Jiang, B.; Su, Z.; Li, J.Y.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Zou, J.H.; Zhang, S.Y.; Zhang, W.P.; Li, G.; Chen, Z.X.; Zhai, W.X.; Zhao, X.F.; Pan, X.B.; Xie, Q.; Zhu, L.H. The rice HIGH-TILLERING DWARF1 encoding an ortholog of arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J. 2006, 48, 687–696. [Google Scholar] [CrossRef] [PubMed]
  15. Alder, A.; Jamil, M.; Marzorati, M.; Bruno, M.; Vermathen, M.; Bigler, P.; Ghisla, S.; Bouwmeester, H.; Beyer, P.; Al-Babili, S. The path from beta-carotene to carlactone, a strigolactone-like plant hormone. Science 2012, 335, 1348–1351. [Google Scholar] [CrossRef] [Green Version]
  16. Jiang, L.; Liu, X.; Xiong, G.S.; Liu, H.H.; Chen, F.L.; Wang, L.; Meng, X.B.; Liu, G.F.; Yu, H.; Yuan, Y.D.; et al. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef] [Green Version]
  17. Zhou, F.; Lin, Q.B.; Zhu, L.H.; Ren, Y.L.; Zhou, K.N.; Shabek, N.; Wu, F.Q.; Mao, H.B.; Dong, W.; Gan, L.; et al. D14-SCFD3-dependent degradation of D53 regulates strigolactone signalling. Nature 2013, 504, 406–410. [Google Scholar] [CrossRef] [Green Version]
  18. Arite, T.; Umehara, M.; Ishikawa, S.; Hanada, A.; Maekawa, M.; Yamaguchi, S.; Kyozuka, J. d14, a strigolactone-insensitive mutant of rice, shows an accelerated outgrowth of tillers. Plant Cell Physiol. 2009, 50, 1416–1424. [Google Scholar] [CrossRef] [Green Version]
  19. Yao, R.F.; Ming, Z.H.; Yan, L.M.; Li, S.H.; Wang, F.; Ma, S.; Yu, C.T.; Yang, M.; Chen, L.; Chen, L.H.; et al. DWARF14 is a non-canonical hormone receptor for strigolactone. Nature 2016, 536, 469–473. [Google Scholar] [CrossRef]
  20. Song, X.G.; Lu, Z.F.; Yu, H.; Shao, G.N.; Xiong, J.S.; Meng, X.B.; Jing, Y.H.; Liu, G.F.; Xiong, G.S.; Duan, J.B.; et al. IPA1 functions as a downstream transcription factor repressed by D53 in strigolactone signaling in rice. Cell Res. 2017, 27, 1128–1141. [Google Scholar] [CrossRef] [Green Version]
  21. Li, W.; Ling, H.; Zhang, F.; Yao, H.Y.; Sun, X.F.; Tang, K.X. Analysis of Arabidopsis genes encoding putative class III lipases. J. Plant Biochem. Biot. 2012, 21, 261–267. [Google Scholar] [CrossRef]
  22. Zhao, H.; Ma, B.; Duan, K.X.; Li, X.K.; Lu, X.; Yin, C.C.; Tao, J.J.; Wei, W.; Zhang, W.K.; Xin, P.Y.; et al. The GDSL lipase MHZ11 modulates ethylene signaling in rice roots. Plant Cell 2020, 32, 1626–1643. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Li, H.G.; Xue, D.W.; Gao, Z.Y.; Yan, M.X.; Xu, W.Y.; Xing, Z.; Huang, D.N.; Qian, Q.; Xue, Y.B. A putative lipase gene EXTRA GLUME1 regulates both empty-glume fate and spikelet development in rice. Plant J. 2009, 57, 593–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Zeng, D.Y.; Cui, J.; Yin, Y.S.; Zhang, M.; Shan, S.; Liu, M.Y.; Cheng, D.Y.; Lu, W.H.; Sun, Y.Q. Proteomic analysis in different development stages on SP0 generation of rice seeds after space flight. Life Sci. Space Res. 2020, 26, 34–45. [Google Scholar] [CrossRef]
  25. Mohanta, T.K.; Mishra, A.K.; Mohanta, Y.K.; Al-Harrasi, A. Space Breeding: The Next-Generation Crops. Front. Plant Sci. 2021, 12, 771985. [Google Scholar] [CrossRef]
  26. Xiao, W.M.; Yang, Q.Y.; Wang, H.; Guo, T.; Liu, Y.Z.; Zhu, X.Y.; Chen, Z.Q. Identification and fine mapping of a resistance gene to magnaporthe oryzae in a space-induced rice mutant. Mol. Breed. 2011, 28, 303–312. [Google Scholar] [CrossRef]
  27. Li, H.Z.; Wang, H.; Guo, T.; Liu, Y.Z.; Zhang, J.G.; Chen, Z.Q. Genetic analysis and gene mapping of a new dwarf rice CHA-1 induced by space mutation. J. South China Agric. Univ. 2009, 30, 6–9. (In Chinese) [Google Scholar]
  28. Liu, Y.Z.; Wang, H.; Chen, Z.Q.; Guo, T.; Zhang, J.G. Characters variation of special dwarf mutant CHA-1 induced by space environment in rice. J. South China Agric. Univ. 2005, 26, 1–4. (In Chinese) [Google Scholar]
  29. Sato, Y.; Antonio, B.A.; Namiki, N.; Takehisa, H.; Minami, H.; Kamatsuki, K.; Sugimoto, K.; Shimizu, Y.; Hirochika, H.; Nagamura, Y. RiceXPro: A platform for monitoring gene expression in japonica rice grown under natural field conditions. Nucleic Acids Res. 2011, 39, D1141–D1148. [Google Scholar] [CrossRef]
  30. Wang, Y.X.; Shang, L.G.; Yu, H.; Zeng, L.J.; Hu, J.; Ni, S.; Rao, Y.C.; Li, S.F.; Chu, J.F.; Meng, X.B.; et al. A strigolactone biosynthesis gene contributed to the green revolution in rice. Mol. Plant 2020, 13, 923–932. [Google Scholar] [CrossRef]
  31. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [Green Version]
  32. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [Green Version]
  34. Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.H.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  35. Zhao, J.; Long, T.; Wang, Y.F.; Tong, X.H.; Tang, J.; Li, J.L.; Wang, H.M.; Tang, L.Q.; Li, Z.Y.; Shu, Y.Z.; et al. RMS2 encoding a GDSL lipase mediates lipid homeostasis in anthers to determine rice male fertility. Plant Physiol. 2020, 182, 2047–2064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  37. Hiei, Y.; Ohta, S.; Komari, T.; Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6, 271–282. [Google Scholar] [CrossRef] [Green Version]
  38. Zeng, D.Y.; Cui, J.; Yin, Y.S.; Zhang, M.; Shan, S.; Gao, X.; Zhang, Y.C.; Lu, W.H.; Sun, Y.Q. Effects of space flight on expression of key proteins in rice leaves. Rice Sci. 2020, 27, 423–433. [Google Scholar]
  39. Yu, S.; Luo, H.; Li, J.; Yu, X. Molecular variation and application from aerospace mutagenesis in upland rice huhan 3 and huhan 7. Rice Sci. 2013, 20, 249–258. [Google Scholar] [CrossRef]
  40. Liu, W.; Zhang, D.C.; Tang, M.F.; Li, D.Y.; Zhu, Y.X.; Zhu, L.H.; Chen, C.Y. THIS1 is a putative lipase that regulates tillering, plant height, and spikelet fertility in rice. J. Exp. Bot. 2013, 64, 4389–4402. [Google Scholar] [CrossRef] [Green Version]
  41. Wang, C.C.; Yu, H.; Huang, J.; Wang, W.S.; Faruquee, M.; Zhang, F.; Zhao, X.Q.; Fu, B.Y.; Chen, K.; Zhang, H.L.; et al. Towards a deeper haplotype mining of complex traits in rice with RFGB v2.0. Plant Biotechnol. J. 2020, 18, 14–16. [Google Scholar] [CrossRef] [Green Version]
  42. Arite, T.; Iwata, H.; Ohshima, K.; Maekawa, M.; Nakajima, M.; Kojima, M.; Sakakibara, H.; Kyozuka, J. DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. Plant J. 2007, 51, 1019–1029. [Google Scholar] [CrossRef] [PubMed]
  43. Akoh, C.C.; Lee, G.C.; Liaw, Y.C.; Huang, T.H.; Shaw, J.F. GDSL family of serine esterases/lipases. Prog. Lipid Res. 2004, 43, 534–552. [Google Scholar] [CrossRef] [PubMed]
  44. Lee, D.S.; Kim, B.K.; Kwon, S.J.; Jin, H.C.; Park, O.K. Arabidopsis GDSL lipase 2 plays a role in pathogen defense via negative regulation of auxin signaling. Biochem. Bioph. Res. Commun. 2009, 379, 1038–1042. [Google Scholar] [CrossRef] [PubMed]
  45. Hayward, A.; Stirnberg, P.; Beveridge, C.; Leyser, O. Interactions between Auxin and Strigolactone in Shoot Branching Control. Plant Physiol. 2009, 151, 400–412. [Google Scholar] [CrossRef] [PubMed]
  46. Zhang, H.H.; Wang, M.L.; Li, Y.Q.; Yan, W.; Chang, Z.Y.; Ni, H.L.; Chen, Z.F.; Wu, J.X.; Xu, C.J.; Deng, X.W.; et al. GDSL esterase/lipases OsGELP34 and OsGELP110/OsGELP115 are essential for rice pollen development. J. Integr. Plant Biol. 2020, 62, 1574–1593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Plants 12 01507 g001 550
Figure 1. Morphological characteristics of THZ and CHA-1. (A) Morphology of THZ and CHA-1 plants at the mature stage. Scale bar, 20 cm. (B) Leaf blade morphology of THZ and CHA-1. Scale bar, 10 cm. (C) Internode morphology of THZ and CHA-1. Scale bar, 10 cm. I, II, III, IV, and V represent internode I, internode II, internode III, internode IV, and internode V, respectively. (D) Comparison of the internode length ratio of THZ and CHA-1. (E) Comparison of the internode length of THZ and CHA-1. (F) Plant height. (G) Leaf blade length. (H) Leaf blade width. (I) Number of tillers. (J) Seeding rate. (K). Panicle weight per plant. Values are means ± SD. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Figure 1. Morphological characteristics of THZ and CHA-1. (A) Morphology of THZ and CHA-1 plants at the mature stage. Scale bar, 20 cm. (B) Leaf blade morphology of THZ and CHA-1. Scale bar, 10 cm. (C) Internode morphology of THZ and CHA-1. Scale bar, 10 cm. I, II, III, IV, and V represent internode I, internode II, internode III, internode IV, and internode V, respectively. (D) Comparison of the internode length ratio of THZ and CHA-1. (E) Comparison of the internode length of THZ and CHA-1. (F) Plant height. (G) Leaf blade length. (H) Leaf blade width. (I) Number of tillers. (J) Seeding rate. (K). Panicle weight per plant. Values are means ± SD. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Plants 12 01507 g001
Plants 12 01507 g002 550
Figure 2. Histological comparison of internodes between THZ and CHA-1. (A) Longitudinal sections of five internodes of THZ and CHA-1. Scale bar, 100 μm. (B) Comparison of the vertical length of internode cells between THZ and CHA-1. Values are means ± SD. I, II, III, IV, and V represent internode I, internode II, internode III, internode IV, and internode V, respectively. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Figure 2. Histological comparison of internodes between THZ and CHA-1. (A) Longitudinal sections of five internodes of THZ and CHA-1. Scale bar, 100 μm. (B) Comparison of the vertical length of internode cells between THZ and CHA-1. Values are means ± SD. I, II, III, IV, and V represent internode I, internode II, internode III, internode IV, and internode V, respectively. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Plants 12 01507 g002
Plants 12 01507 g003 550
Figure 3. Fine mapping of CHA-1. (A) CHA-1 was localized between markers DL10 and DL30 on chromosome 1. The name of the molecular markers are above the line, and the number below the line indicates the number of recombinants between CHA-1 and the molecular markers shown. (B) Gene structure and mutation site of the candidate gene LOC_Os01g54810. (C) Morphology of THZ, CHA-1, and CHA-1-com at the mature stage. Scale bar, 20 cm. (D) Panicle morphology of THZ, CHA-1, and CHA-1-com. Scale bar, 10 cm. CHA-1-com is a complementary plant based on CHA-1.
Figure 3. Fine mapping of CHA-1. (A) CHA-1 was localized between markers DL10 and DL30 on chromosome 1. The name of the molecular markers are above the line, and the number below the line indicates the number of recombinants between CHA-1 and the molecular markers shown. (B) Gene structure and mutation site of the candidate gene LOC_Os01g54810. (C) Morphology of THZ, CHA-1, and CHA-1-com at the mature stage. Scale bar, 20 cm. (D) Panicle morphology of THZ, CHA-1, and CHA-1-com. Scale bar, 10 cm. CHA-1-com is a complementary plant based on CHA-1.
Plants 12 01507 g003
Plants 12 01507 g004 550
Figure 4. Expression analysis of CHA-1. (A) Expression patterns of the candidate gene LOC_Os01g54810. Gene expression profile data were obtained from the Rice Expression Profile (RiceXPro) database (http://ricexpro.dna.affrc.go.jp/, accessed on 20 February 2022). (B) Expression of the candidate gene LOC_Os01g54810 in various organs of rice. (C) Lipase activities of CHA-1 was incubated with p- nitrophenyl butyrate. Absorbance readings were collected every 10 min for 120 min. The substrates were incubated with GST-tagged protein and no protein as the GST and control, respectively. GST-CHA-1 indicates that the fusion protein of the CHA-1 and GST-tagged protein were incubated in the substrates.
Figure 4. Expression analysis of CHA-1. (A) Expression patterns of the candidate gene LOC_Os01g54810. Gene expression profile data were obtained from the Rice Expression Profile (RiceXPro) database (http://ricexpro.dna.affrc.go.jp/, accessed on 20 February 2022). (B) Expression of the candidate gene LOC_Os01g54810 in various organs of rice. (C) Lipase activities of CHA-1 was incubated with p- nitrophenyl butyrate. Absorbance readings were collected every 10 min for 120 min. The substrates were incubated with GST-tagged protein and no protein as the GST and control, respectively. GST-CHA-1 indicates that the fusion protein of the CHA-1 and GST-tagged protein were incubated in the substrates.
Plants 12 01507 g004
Plants 12 01507 g005 550
Figure 5. Effect of the partial loss-of-function allele of CHA-1 on SL biosynthesis. (A) Length of the tiller buds of THZ and CHA-1 treated with 1 μmol GR24 for 4 weeks. GR24 is a synthetic strigolactone. Plants were treated without GR24 as mock-treated control. (B) Relative expression levels of SL pathway genes between THZ and CHA-1. D53, D14, and D3 were SL signaling pathway genes. D27, D17, and D10 were SL biosynthesis pathway genes. (C) Comparison of epi-5DS contents in the THZ and CHA-1 root exudates. Values are the means ± SD. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Figure 5. Effect of the partial loss-of-function allele of CHA-1 on SL biosynthesis. (A) Length of the tiller buds of THZ and CHA-1 treated with 1 μmol GR24 for 4 weeks. GR24 is a synthetic strigolactone. Plants were treated without GR24 as mock-treated control. (B) Relative expression levels of SL pathway genes between THZ and CHA-1. D53, D14, and D3 were SL signaling pathway genes. D27, D17, and D10 were SL biosynthesis pathway genes. (C) Comparison of epi-5DS contents in the THZ and CHA-1 root exudates. Values are the means ± SD. *, p < 0.05; **, p < 0.01; ns, no significance (Student’s t-test).
Plants 12 01507 g005
Table
Table 1. Segregate pattern of the F2 population from the cross of CHA-1 and 02428.
Table 1. Segregate pattern of the F2 population from the cross of CHA-1 and 02428.
TypesNumber of PlantsRatioχ2(3:1)
χ20.05 = 3.84
High plant height24713.04:10.12
Low plant height812
Table
Table 2. Annotations of candidate genes in the region covering CHA-1 based on the MSU7 database.
Table 2. Annotations of candidate genes in the region covering CHA-1 based on the MSU7 database.
Gene IDAnnotation
LOC_Os01g54810Class III lipase
LOC_Os01g54850Cyclin-like F-box domain containing protein
LOC_Os01g54860Enoyl-CoA hydratase/isomerase
Table
Table 3. Primers used for the fine mapping of CHA-1 and quantitative real-time PCR.
Table 3. Primers used for the fine mapping of CHA-1 and quantitative real-time PCR.
MarkerPrimer Sequences (5′–3′)
RM8097-FGCTGTCACTGACCGAGCGTAGG
RM8097-RTCGAGAGATCCAATCCAGTTTGC
RM11668-FAGTGTCTCTGGAGTTGGGAGTGG
RM11668-RCTGTTCTTCCAGATGGGCTTCC
RM11669-FAAACCGTTCCAGGGAGACTGACC
RM11669-RTCGTCTGATCCATCCATCCATCC
DL1-FAATGCGTGGGGTTTCATCTA
DL1-RTAGAGCATGGATAGACGGGG
DL3-FAGCTATGTGGTTAGGTCC
DL3-RTAGATGAGGAAGCCTAGT
DL4-FAGTGGCTAGTCACTTACA
DL4-RGGAAGCCTAGTATGAAGC
DL5-FATTCCGGTGGCGTTTTCA
DL5-RCCACCAAAATTGTAGGGAGT
DL6-FCTCATTGTTGCCTATGAG
DL6-RGCACGTACGTAGTGAGAT
DL7-FATCAGAAGCTCCTGACTCTT
DL7-RGCCGGAGAGGTAGTCGT
DL8-FTCTGAACTGAATGGTTCG
DL8-RTACAGTGGAGTCCTGCTA
DL9-FAGAGCACCCAAGAGTTAATC
DL9-RTGGCTGATATTGGGTATG
DL10-FGCCTTAGAGGAGGATCTTCT
DL10-RTTCCTTGCATCTCACGTAGG
DL2-FAAAAGCCCACTTTGCATGAG
DL2-RAGGTGTAACGAGAAAGCGGA
RM11677-FGTCTTGGAGCTGAGCACCTTGG
RM11677-RGGCCCTCCGTGTAATCCTATTCC
qPCR-D53-FCCAAGCAGTTTGAAGCGAC
qPCR-D53-RCCGCAAGTTTATCAAAGTCAA
qPCR-D10-FCGTGGCGATATCGATGGT
qPCR-D10-RCGACCTCCTCGAACGTCTT
qPCR-D14-FCGCCTTCGTCGGCCACTC
qPCR-D14-RTCGAACCCGCCGTGGTAGTC
qPCR-D17-FCTGTTCTTAGCGGGGTGTTC
qPCR-D17-RGGCGTCGAACTCGTAGAAAG
qPCR-D3-FTTAAGGTGGAGGGTGATTGC
qPCR-D3-RAAGATCCATCTGCCCTGTTG
qPCR-D27-FTCTGGGCTAAAGAATGAAAAG
qPCR-D27-RAGAGCTTGGGTCACAATCTCG
Com-CHA-1-FGAGCTCGGTACCCGGGGATCCTCTTGTAATTTTTGGGTATAAATAGACCC
Com-CHA-1-RACGACGGCCAGTGCCAAGCTTTGTAAATTTTTGTGGTCCAAAGTGA
GST-CHA-1-FCCGCGTGGATCCCCGGAATTCATGGCGATCGACCTGGCG
GST-CHA-1-RGTCACGATGCGGCCGCTCGAGCTACTTTGCAGGGGGTGACG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, T.; Xiao, W.; Huang, C.; Zhou, D.; Liu, Y.; Guo, T.; Chen, Z.; Wang, H. Fine Mapping of the Affecting Tillering and Plant Height Gene CHA-1 in Rice. Plants 2023, 12, 1507. https://doi.org/10.3390/plants12071507

AMA Style

Chen T, Xiao W, Huang C, Zhou D, Liu Y, Guo T, Chen Z, Wang H. Fine Mapping of the Affecting Tillering and Plant Height Gene CHA-1 in Rice. Plants. 2023; 12(7):1507. https://doi.org/10.3390/plants12071507

Chicago/Turabian Style

Chen, Tengkui, Wuming Xiao, Cuihong Huang, Danhua Zhou, Yongzhu Liu, Tao Guo, Zhiqiang Chen, and Hui Wang. 2023. "Fine Mapping of the Affecting Tillering and Plant Height Gene CHA-1 in Rice" Plants 12, no. 7: 1507. https://doi.org/10.3390/plants12071507

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop