Next Article in Journal
Tolerance Mitigates Gall Effects When Susceptible Plants Fail to Elicit Induced Defense
Previous Article in Journal
Investigation of a Perspective Urban Tree Species, Ginkgo biloba L., by Scientific Analysis of Historical Old Specimens
Previous Article in Special Issue
Effect of Growth Stage on Nutrition, Fermentation Quality, and Microbial Community of Semidry Silage from Forage Soybean
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 11
10.3390/plants13111471
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Regulation of Whole-Plant Corn Silage Inoculated with Lactobacillus buchneri or Bacillus licheniformis Regarding the Dynamics of Bacterial and Fungal Communities on Aerobic Stability

by
Hang Yin
1,
Meirong Zhao
1,
Rui Yang
1,
Juanjuan Sun
2,
Zhu Yu
3,
Chunsheng Bai
1,* and
Yanlin Xue
4,*
1
College of Horticulture, Shenyang Agricultural University, Shenyang 110866, China
2
Institute of Grassland Research, Chinese Academy of Agricultural Sciences, Hohhot 010010, China
3
College of Grassland Science and Technology, China Agricultural University, Beijing 100193, China
4
Inner Mongolia Engineering Research Center of Development and Utilization of Microbial Resources in Silage, Inner Mongolia Academy of Agriculture and Animal Husbandry Science, Hohhot 010031, China
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(11), 1471; https://doi.org/10.3390/plants13111471
Submission received: 13 March 2024 / Revised: 23 May 2024 / Accepted: 23 May 2024 / Published: 26 May 2024
(This article belongs to the Special Issue Sustainability in Silage Production)
Browse Figures
Versions Notes

Abstract

:
Enhancing the aerobic stability of whole-plant corn silage is essential for producing high-quality silage. Our research assessed the effect of inoculation with Lactobacillus buchneri or Bacillus licheniformis and its modulation of the bacterial and fungal microbial community structure in an aerobic stage of whole-plant corn silage. Following treatment with a distilled sterile water control, Lactobacillus buchneri, and Bacillus licheniformis (2 × 105 cfu/g), whole-plant corn was ensiled for 60 days. Samples were taken on days 0, 3, and 7 of aerobic exposure, and the results showed that inoculation with Lactobacillus buchneri or Bacillus licheniformis improved the aerobic stability of silage when compared to the effect of the control (p < 0.05). Inoculation with Bacillus licheniformis attenuated the increase in pH value and the decrease in lactic acid in the aerobic stage (p < 0.05), reducing the filamentous fungal counts. On the other hand, inoculation with Lactobacillus buchneri or Bacillus licheniformis increased the diversity of the fungal communities (p < 0.05), complicating the correlation between bacteria or fungi, reducing the relative abundance of Acetobacter and Paenibacillus in bacterial communities, and inhibiting the tendency of Monascus to replace Issatchenkia in fungal communities, thus delaying the aerobic spoilage process. Due to the prevention of the development of aerobic spoilage microorganisms, the silage injected with Lactobacillus buchneri or Bacillus licheniformis exhibited improved aerobic stability.

Graphical Abstract

1. Introduction

Silage is now widely used worldwide as a ruminant feed; fermentation under anaerobic conditions allows it to reduce the total loss of nutrients from harvest to storage [1,2]. However, when the stored silage is opened for feeding, aerobic microorganisms proliferate rapidly, and acids and water-soluble carbohydrates are oxidized to carbon dioxide and water [3,4,5,6], leading to increased temperature and silage deterioration. The aerobic deterioration of silage can produce toxic substances that are harmful to both animals and humans [7]; feeding ruminants with aerobically spoiled silage can lead to a reduced nutritional intake [8]. Therefore, slowing down aerobic spoilage is a key issue in silage preparation.
Whole-plant corn silage plays a major role as a feed for dairy cattle around the world as a valuable source of energy and nutrients [9,10]. However, with its high residual soluble carbohydrate content and the lactic acid it produces during fermentation, it provides ideal conditions for yeasts and filamentous fungi to multiply, causing aerobic deterioration when whole-plant corn silage is exposed to oxygen [11]. Compared to lactic acid, acetic acid is more resistant to fungal fermentation [4]. Additionally, inoculants of heterofermentative lactic acid bacteria, such as Lactobacillus buchneri, can convert soluble carbohydrates into acetic acid during fermentation and inhibit the activity of filamentous fungi and yeasts, improving the aerobic stability of whole-plant corn silage [12,13]. However, this method is less efficient at preserving nutrients than is non-inoculation [14]. Recently, it was found that Bacillus subtilis inoculation can produce antifungal and antibacterial substances in silage that can inhibit fungal growth, thereby enhancing its aerobic stability [15,16], which provides new possibilities for maintaining fermentation quality while improving the aerobic stability. It has been shown that the environment, consumers of products from animals that have been fed with treated silage, and the target species are all thought to be safe around Bacillus licheniformis DSM 32457 [17], but its effectiveness in silage has yet to be verified. Research by Afordoanyi et al. [18] has shown that combining corn silage with homogeneous fermenting lactic acid bacteria and Bacillus licheniformis strain WJ53A reduces the risk of Clostridium perfringens infection in animal husbandry. Similarly, the study by Zhu et al. [19] showed that inoculation with Bacillus licheniformis could improve silage quality. As B. licheniformis and B. subtilis belong to the same genus Bacillus, it was speculated that inoculation with B. licheniformis could also improve the aerobic stability of silage. However, these results in regards to whole-plant corn silage need to be verified.
Using next-generation sequencing methods, it has been discovered that microbial inoculants increase the aerobic stability of silage by altering the structure of the microbial community [20]. According to Wang et al. [21], treatment with Lactobacillus hilgardii and mixed inoculation with Lactobacillus plantarum in sugarcane top silage inhibited the growth of spoilage microbes that are linked to aerobic deterioration, such as Acetobacter pasteurianus and Paenibacillus amylolyticus. A study by Liu et al. [22] used Lactobacillus buchneri to inhibit the growth of Penicillium and Monascus in Leymus chinensis silage, improving aerobic stability, while Yin et al. [23] observed that B. subtilis inoculation suppressed the relative abundance of bacteria and fungi such as Bacillus and Kazachastania during aerobic exposure in whole-plant corn silage. The effect of B. licheniformis inoculation on the bacterial community structure of hybrid Pennisetum silage was investigated by Zhu et al. [19], who revealed that inoculation improved the silage quality by increasing the relative abundance of Lactobacillus. However, less information is available regarding the L. buchneri or B. licheniformis microbial communities on whole-plant corn silage. Therefore, the objective of this study was to examine the impact of B. licheniformis or L. buchneri on the aerobic stability, fermentation quality, and bacterial and fungal communities of whole-plant corn silage under aerobic exposure conditions.

2. Results

2.1. Chemical Composition of Fresh Material and Nutrient Composition of Whole-Plant Corn Silage

Prior to ensiling, the counts of lactic acid bacteria, coliform bacteria, and yeasts were 5.64, 5.90, and 6.39 lg CFU/g, respectively; counts of filamentous fungi were below the detection threshold. The concentrations of DM, CP, aNDF, ADF, and WSC were 372.54 g/kg FW, 79.84, 375.72, 173.84, and 113.70 g/kg DM, respectively (Table 1).
The BL group had a lower ash content than the CK group (p < 0.05); there was no significant difference found in the contents of DM, CP, aNDF, ADF, and WSC between the groups (p > 0.05; Table 2).

2.2. Aerobic Stability

The LB and BL treatment groups exhibited a higher aerobic stability than did the CK group (Figure 1).
The inoculants had an influence on pH and propionic acid contents (p < 0.05); the duration of aerobic exposure had an effect on pH, as well as the lactic acid, acetic acid, and propionic acid contents (p < 0.05; Figure 2); the interaction of the two had an effect on pH, as well as the lactic acid and propionic acid contents (p < 0.05). When the aerobic exposure duration was extended, the pH values and lactic acid contents of each group progressively increased and decreased, respectively. However, on day 7 of the aerobic exposure, the pH value of the LB and BL groups was lower than that of the CK group (p < 0.05), the propionic acid content was higher than that of the CK group (p < 0.05), and the lactic acid content of the BL group was higher than that of the CK group (p < 0.05). In addition, the acetic acid concentration of the LB group was greater than that of the CK group on day 3 of aerobic exposure (p < 0.05).
The number of lactic acid bacteria, coliform bacteria, and filamentous fungi was influenced by both the aerobic exposure time and the inoculant treatment (p < 0.05; Figure 3); yeast was also influenced by aerobic exposure time (p < 0.05), while the numbers of lactic acid bacteria and filamentous fungi were influenced by their interactions (p < 0.05). In all groups, with the duration of aerobic exposure, the quantity of filamentous fungus, yeasts, and coliform bacteria steadily rose, while the number of lactic acid bacteria gradually declined. On days 0 and 7 of aerobic exposure, there were more lactic acid bacteria in the LB and BL groups than in the CK group (p < 0.05), while, on day 7 of aerobic exposure, there were fewer filamentous fungi in the BL group than in the CK group (p < 0.05).

2.3. Microbial Community

For both bacteria and fungi, all the treatment groups exhibited coverage values higher than 0.99. With an increase in the aerobic exposure period, the bacteria in each group exhibited a drop in the Shannon and Chao indices (p < 0.05) and an increase in the Simpson index (p < 0.05) (Table 3). On day 7 of aerobic exposure, the Shannon index was lower in the BL group than in the CK and LB groups, the Chao index was lower in the LB and BL groups than in the CK group (p < 0.05), and the Simpson index showed no significant difference.
With the prolongation of aerobic exposure, the Shannon and Chao indices of the fungal community groups gradually decreased, while the Simpson index increased (p < 0.05; Table 4). After 7 days of aerobic exposure, the BL group showed a higher Shannon index than the CK group, the LB group had a lower Chao index than the CK and BL groups (p < 0.05), and the LB and BL groups had a lower Simpson index than the CK group (p < 0.05).
OTU clustering of the sequences, based on a 97% similarity threshold (Figure 4), showed that the treated bacterial samples shared 139 OTUs overall, whereas CK0 expressed more OTUs during aerobic exposure, with 134 (Figure 4A). All treated fungi samples shared 5 OTUs, while BL0 exhibited more OTUs overall (Figure 4B).
There was a clear separation of the bacterial community on day 7 versus days 0 and 3 of aerobic exposure (Figure 5A). In contrast, for the fungal community, there was a noticeable separation between days 0 and 7 of aerobic exposure (Figure 5B), where CK7 was separated from LB7 and BL7, respectively.
At the phylum level, Firmicutes and Proteobacteria dominated the bacterial community in the aerobically exposed whole-plant corn silage. The relative abundance of Proteobacteria increased over the 7 days of aerobic exposure, although it did so more slowly in the BL group than in the CK group (Figure 6A). As the aerobic exposure duration increased, the relative abundance of Lactobacillus decreased gradually (Figure 6B). On day 3 of aerobic exposure, the CK group had a higher relative abundance of Stenotrophomonas than the LB and BL groups (p < 0.05; Figure 6C), while on day 7, the BL group had a lower relative abundance of Acetobacter than the CK and LB groups (p < 0.05). However, the relative abundances of Paenibacillus and Bacillus were higher than those of both the CK and LB groups (p < 0.05).
Ascomycota and Basidiomycota mostly regulated whole-plant corn silage during aerobic exposure, with Ascomycota increasing as the duration of aerobic exposure increased (Figure 7A). The dominant genera in each group on day 0 of aerobic exposure were Monascus, unclassified_p_Ascomycota, Hannaella, Papilotrema, and Candida (Figure 7B). Monascus and Issatchenkia showed a gradual increase in relative abundance during aerobic exposure, with the LB7 and BL7 groups having a lower relative abundance of Monascus than the CK7 group (p < 0.05; Figure 7C), whereas the BL3 group had a greater relative abundance of Monascus than the CK3 and LB3 groups (p < 0.05). The relative abundance of Tetrapisispora was higher in the BL7 group than in the CK7 and LB7 groups (p < 0.05).
The pH value is positively correlated with the abundance of Acetobacter (p < 0.001), while it is negatively correlated with the abundances of Lactobacillus, Enterobacter, Stenotrophomonas, etc. in the bacterial community (p < 0.05; Figure 8A). The acetic acid content of the silage is positively correlated with the abundance of Lactobacillus, Enterobacter, etc. (p < 0.001), but negatively correlated with the abundance of Acetobacter, Paenibacillus, etc. (p < 0.01), while propionic acid demonstrates the opposite phenomenon. In the fungal community, the pH value of the silage is significantly positively correlated with the abundance of Monascus and Tetreapisispora (p < 0.01), whereas it is negatively correlated with the abundance of Hannaella, Candida, etc. (p < 0.001; Figure 8B). The contents of lactic acid are positively correlated with the abundance of Kazachstania (p < 0.001), while the contents of acetic acid are positively correlated with the abundance of Hannaella, Candida, etc. (p < 0.001). The Mantel test revealed that the primary variables influencing the alteration of the fungal community after the aerobic exposure of whole-plant corn silage were the concentrations of ethanol and acetic acid (p < 0.05; Figure 8C).
Regarding the interspecies correlation of bacterial and fungal communities, the numbers of nodes and edges in the LB and BL groups in bacteria and fungi were higher than those of the CK group (Figure 9).

3. Discussion

3.1. Characteristics of Fresh Material and Nutrient Composition of Silage

The DM content in this experiment is within the recommended range (32–38%) [24], and the contents of DM, CP, aNDF, ADF, and WSC did not significantly differ across the groups, indicating that inoculation with Lactobacillus buchneri or Bacillus licheniformis does not reduce the nutrient content of whole-plant corn silage.

3.2. Aerobic Stability

Compared to those in the CK group, it was found that the aerobic stabilization times of the LB and BL groups were longer, suggesting that LB or BL inoculation might enhance aerobic stability. An essential metric for assessing the fermentation impact of silage is the pH value [25]; LB0 and BL0 had pH values that were lower than those of CK0 (p < 0.05), and in many studies, inoculation with LB increases the pH value [26,27]. However, the results of some studies demonstrate that inoculation with LB resulted in a decrease in pH value [28,29,30]. In contrast to CK7, the pH value of the BL7 group was lower (p < 0.05), probably due to the fact that, at this time, the lactic acid bacteria number of BL7 was higher than that of the CK group (p < 0.05), and the number of filamentous fungi was lower than in the CK group (p < 0.05). Aerobic microorganisms use lactic acid as a substrate for their growth after aerobic exposure in silage, causing the pH of the silage to rise [31]; a high pH circumstance is favorable for the growth of filamentous fungi, while the proliferation of filamentous fungi also causes an increase in silage temperature [4]. This explains why the aerobic stability of the BL group was superior to that of the CK group.
According to the study of Ferrero et al. [32], aerobic stability is closely related to yeast counts, and it decreases exponentially with increasing yeast population [33]. Furthermore, inoculation with LB has been shown to inhibit the proliferation of undesirable microorganisms by increasing the acetic acid content, thus improving the aerobic stability of silage [34,35]. In this experiment, the Mantel analysis showed that fungal communities were mainly correlated with acetic acid content, and that the counts of yeast in LB7 were lower than those in CK7 (p < 0.05), which might account for the better aerobic stability of the LB group.
The activity of aerobic microorganisms, including filamentous fungus and yeasts, is inhibited by propionic acid [36] and in whole-plant corn silage, it has been shown to improve aerobic stability as an additive in experiments such as those conducted by Chen et al. [5]. In this experiment, BL7 and LB7 exhibited a higher propionic acid content than CK7 (p < 0.05). In addition, the counts of yeasts in LB7 and filamentous fungi in BL7 were significantly lower than in the CK7 group (p < 0.05), which contributed to the delay in the onset of aerobic decay in the LB and BL groups.

3.3. Microbial Community

The coverage values of all treatment groups in regards to bacteria and fungi were greater than 0.99, indicating that sequencing has adequately captured most bacterial and fungal communities. With prolonged exposure to oxygen, the Shannon and Chao indices of the bacterial and fungal communities in each treatment decreased, while the Simpson index increased (p < 0.05), indicating a decline in both the diversity and abundance of the bacterial and fungal communities [21]; this result is consistent with what has been found in previous research [20], which implies that aerobic microorganisms that are tolerant to low amounts of acid proliferate in whole-plant corn silage [30] and become relatively simple during aerobic exposure. In comparison with CK7, in the fungal community, the Chao and Shannon indexes of the BL7 group were higher, while the Simpson index was lower (p < 0.05), which suggests that inoculation with BL maintains the diversity of fungal communities during aerobic exposure. We speculate that this may explain the improved aerobic stability in the BL group, consistent with our previous results of higher fungal community diversity and better aerobic stability in whole-plant corn silage that is inoculated with LB or BS [23]. In contrast, in the bacterial community, BL7 had lower Chao and Shannon indices compared to CK7, suggesting that inoculation with BL reduced the diversity of this community, which could be attributed to the fact that BL7 has a lower pH [20,37]. BL7 has a higher number of unique OTUs than CK7, which may also explain its improved aerobic stability. Separation of the bacterial and fungal populations in the latter phases of aerobic exposure between the inoculation treatment group (LB or BL) and the non-inoculated group (CK) in principal coordinate analysis suggests that by changing the structure of the bacterial and fungal communities, the two microbial inoculants increase aerobic stability.
Bacterial communities in aerobically exposed whole-plant corn silage were dominated by Firmicutes and Proteobacteria, with Proteobacteria gradually becoming the more dominant bacterial community, which is in line with the results of previous experiments [38]. In a study by Sun et al. [39], at the genus level, the dominance of lactic acid bacteria was gradually replaced by other aerobic microorganisms with increasing aerobic exposure time; this result is similar to that obtained by our study. Stenotrophomonas was one of the aerobic bacteria used in corn stover silage in the study by Liu et al. [40], whereby the results of the experiment found clear support for the relative abundance of Stenotrophomonas at CK3 than at LB3 and BL3 (p < 0.05), which suggested that the bacterial community in the CK group evolved towards aerobic bacteria. We observed an increase in the relative abundance of Paenibacillus at 3 d and 7 d of aerobic exposure; a similar pattern of results was obtained in a study by Wang et al. [21]. They determined that in sugarcane top silage, an increase in Paenibacillus was observed for a period of time after the onset of aerobic spoilage. It was found that Acetobacter can induce the aerobic spoilage of silage, gradually dominating the bacterial community [21]; in this study, the relative abundance of Acetobacter on day 7 of aerobic exposure was increased in all groups compared to days 0 and 3, but the relative abundance of BL7 was smaller than that of CK7 (p < 0.05). In the correlation analysis, Acetobacter was negatively correlated with pH value, which may be the reason for the delay in its aerobic spoilage. Bacillus is one of the aerobic bacteria that cause the aerobic spoilage of silage [39] and its relative abundance was higher in BL7 and LB7 than in CK7 (p < 0.05). However, it did not result in aerobic spoilage, probably due to the fact that Bacillus is involved in the successional process and competitively slows down the relative abundance of Acetobacter and Paenibacillus.
Ascomycota and Basidiomycota mostly controlled whole-plant corn silage in the aerobic stage, this result ties in well with those of previous studies by Liu et al. [41]. Issatchenkia is an important microbiota that is associated with silage spoilage [42]; in this trial, Issatchenkia dominates when exposed to oxygen on days 5 to 7. During the later stages of aerobic exposure in the fungal community tested in the present study, a process of succession from yeasts, represented by Issatchenkia, to filamentous fungi, represented by Monascus, occurred, which could be slowed down via the inoculation of LB or BS. A period of Issatchenkia dominance was not observed in CK, and we speculate that this might be due to the fact that it is possible that in CK, this period occurs between 3 and 7 d, without setting up a sampling site. Monascus, which may use a variety of carbohydrates and acids as carbon sources and may generate a wide range of enzymes to break down organic materials [22], is associated with aerobic spoilage, and it is the dominant filamentous fungus genus in aerobically exposed silage [43]. In this experiment, the relative abundance of Monascus was higher in CK7 than in LB7 and BL7 (p < 0.05), and it is positively correlated with pH value (p < 0.05), which may explain the faster aerobic decay in CK. BL3 had a higher relative abundance of Monascus than CK3 and LB3 (p < 0.05), but is lowered for BL7, which also did not result in decay on day 3 of aerobic exposure, possibly due to the filamentous fungi count of BL3 being 1.31 lg CFU/g, which was significantly lower than that of CK3 and LB3. At this time, the yeast population is overwhelmingly dominant, and the succession of dominant fungi from yeast to filamentous fungi has not yet occurred. In BL7, Monascus was replaced by Tetrapisispora, which has been shown in several studies to secrete a killer toxin (Kpkt) for application in the winemaking process [44]. Kitamoto et al. [45] screened for killer yeast strains in yeast genera such as Kluyveromyces and Saccharomyces to inhibit the growth of wild yeasts and thus, to inhibit the aerobic spoilage of silage. Therefore, we speculated that it would produce Kpkt in silage in a similar manner, inhibiting the activity of other undesirable fungi, and thus delaying the onset of aerobic spoilage even more so in BL compared to LB treatments.
The higher the number of nodes and edges, the lower the level of intermediary and categorical variables, and the higher the network complexity [46]. The correlation between species was constructed using the top 25 most abundant genus level bacterial and fungal networks in the aerobic exposure phase, and the results showed that different inoculants alter the correlation in fungal, LB, and BL inoculations, making the correlation more complicated. This is consistent with the observation that both treatments had a lower Simpson’s index than CK in the fungal alpha diversity analysis. Additionally, the study of Liu et al. [42] has confirmed that silage exposed to oxygen still maintains a high microbial complexity, favoring the retardation of aerobic spoilage.

4. Materials and Methods

4.1. Materials and Silage Preparation

The Baicaoyuan Scientific Research Base of Shenyang Agricultural University in Liaoning, China (41°50′ N, 123°34′ E) provided the whole-plant corn (Liaodan 5802) raw materials for this experiment. When the corn reached the wax maturity stage, it was harvested, leaving a 15 cm stubble height, chopped to 1–2 cm by a grass shredding machine (Donghong No. 1, Donghong Mechanical Equipment Co., Ltd., Zhengzhou, China). Bacillus licheniformis groups (BL, 2 × 105 cfu/g), Lactobacillus buchneri (LB, 2 × 105 cfu/g), and a distilled sterile water control (CK) were the methods used to treat silage. After melting the inoculant in sterile water and evenly spraying it, the ingredients were completely mixed with additives. Then, about 600 g were placed within vacuum-sealed silage bags (35 cm by 24 cm) and were sealed using a vacuum packaging machine. For the purpose of fermentation, all samples were kept protected from light for 60 days at room temperature (23–28 °C) and underwent three repetitions for every group.

4.2. Aerobic Stability

Once the bag was opened, a 180 g sample of each treatment was moved into a Styrofoam block-encased 250 mL beaker. According to the methods of Tao et al. [47], to verify aerobic stability, a 64-well thermograph probe was inserted into the opened silage core. Data were obtained every 10 min. After being exposed to oxygen for 0, 3, and 7 days, the silage was sampled in order to examine the microbial communities, aerobic stability, and quality of fermentation. The aerobic spoilage of silage is measured by a rise in silage temperature of more than 2 °C above ambient temperature [32].

4.3. Fermentation Quality and Nutrient Composition Analyses

The 100 g silage samples were acquired after 60 days, and after 48 h of drying at 65 °C, the dry matter (DM) content was determined. Using an Ankom 2000 fiber analyzer (Ankom, Macedon, NY, USA), the neutral detergent fiber content (assayed with a heat stable amylase, or aNDF) and acid detergent fiber (ADF) contents were determined, in accordance with the methodology described by Van Soest et al. [48]. A Kjeldahl technique [49] was used to determine the crude protein (CP) level, and an autoanalyzer (Kjeltec 8400; FOSS Co., Ltd., Hillerød, Denmark) was utilized. Water-soluble carbohydrate (WSC) content was measured using colorimetry, following a reaction with the anthrone reagent [50].
The 20 g silage samples were combined with 180 mL of sterile water and refrigerated for 18 h at 4 °C. Using a pH meter with a glass electrode (PB-10, Sartorius Group, Göttingen, Germany), the pH of the extract was determined [11]. Using a 210 nm UV detector (Waters2414, Waters Corporation, Milford, MA, USA) and a chromatographic column (Sepax Technologies, Inc., Newark, DE, USA), high-performance liquid chromatography (Waters1525, Waters Corporation, Milford, MA, USA) was used to determine the organic acid content. The temperature was 55 °C, the flow rate was 0.6 mL/min, and the mobile phase was 2.5 mmol/L H2SO4 [51]. Using colorimetry and the phenol–sodium hypochlorite technique, the ammonia nitrogen (NH3-N) concentration was determined [52]. The extract was gradually diluted, and the amounts of filamentous fungus, yeasts, coliform bacteria, and lactic acid bacteria were counted by cultivating them on rose Bengal medium, violet-red bile agar, and MRS agar, in that order [53].

4.4. Bacterial and Fungal Community Analysis

A cryogenic oscillator (THZ-98C, Shanghai Yiheng Scientific Instrument Co., Ltd., Shanghai, China) was used to shake the fresh samples (10 g) in 90 mL of sterile distilled water for 30 min at 4 °C and 180 rpm. The samples were then filtered through three layers of sterile gauze. To enrich the sediment, the filtrate was centrifuged for 15 min at 4 °C at 13,000× g in a cryogenic centrifuge (ST 16R, Thermo Fisher Scientific, Inc., Waltham, MA, USA). High-throughput sequencing was carried out on the sediments [54].
The FastDNA® Spin Kit (MP Biomedicals, Solon, OH, USA) was utilized to extract total DNA from the bacteria and fungus present in the silage samples. Full-length fungal internal transcribed spacers (ITS) were amplified with specific forward ITS1F (CTTGGTCATTTAGAGGAAGTAA) and reverse ITS2R (GCTGCGTTCTTCATCGATGC) primers, while the hypervariable region V3–V4 of full-length bacterial 16S rRNA genes was amplified using PCR, with specific forward 341F (CCTAYGGGRBGCASCAG) and reverse 806R (GGACTACNNGGGTATCTAAT) primers [23]. The PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA); the MiSeq PE300 platform of the Illumina Company was used for sequencing (Shanghai Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China), with a QuantusTM Fluorometer (Promega, Madison, WI, USA) being used for quantitative determination. Subsequently, raw sequences were spliced using FLASH (FLASH 1.2.11), and quality checking was handled via fastp. Moreover, sequences with 97% similarity were clustered in operational taxonomic units (OTUs) using UPARSE software (UPARSE 11). The microbiological diversity in each sample was evaluated using alpha diversity indexes, including the Chao richness estimator, Simpson diversity index, and Shannon diversity index. In order to evaluate the structural variation of the microbiota, beta diversity was examined. Principal coordinates analysis (PCoA) was then carried out [55]. The majorbio cloud platform, available online for free, was used to examine the data. The NCBI Sequence Read Archive database received the sequencing data (accession: PRJNA1000435).

4.5. Statistical Analysis

Using the General Line Model of SPSS (SPSS 22.0 program, SPSS Inc., Chicago, IL, USA), a factorial analysis of variance was used to examine the effects of the additives, the duration of aerobic exposure, and their interactions on the fermentation quality, microbial counts, and bacterial and fungal community indices of silage. Tukey multiple range tests were used to examine significant differences, with p < 0.05 indicating statistical significance.

5. Conclusions

Inoculation with Lactobacillus buchneri or Bacillus licheniformis maintained a good fermentation quality for whole-plant corn silage during the aerobic exposure phase, reduced the relative abundance of undesirable microorganisms, and improved aerobic stability. When silage was exposed to an aerobic environment, the fermentation products were not correlated with the bacterial community, but were significantly correlated with the fungal community. Acetobacter, Paenibacillus, and Bacillus participated in aerobic spoilage bacterial processes. Issatchenkia, Monascus, and Tetrapisispora were the dominant fungal communities in the late aerobic exposure period. Inoculation with Lactobacillus buchneri or Bacillus licheniformis slows down the succession of the fungal community from Issatchenkia to Monascus, thus delaying the aerobic spoilage process.

Author Contributions

Conceptualization, J.S., Z.Y., C.B. and Y.X.; formal analysis, H.Y.; investigation, H.Y. and R.Y.; data curation, H.Y. and M.Z.; writing—original draft, H.Y. and C.B.; writing—review and editing, J.S., C.B. and Y.X.; funding acquisition, Z.Y., C.B. and Y.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by a project of the Education Department of Liaoning Province (LJKMZ20221021), the National Natural Science Foundation of China (31872422 and 32160342), the National Key R&D Program of China (2022YFE0111000), and the Project of Central Government Guiding Fund for Developing Local Science and Technology—Free Exploration Basic Research Project (2022ZY0152).

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hao, Y.; Huang, S.; Liu, G.; Zhang, J.; Liu, G.; Cao, Z.; Wang, Y.; Wang, W.; Li, S. Effects of different parts on the chemical composition, silage fermentation profile, in vitro and in situ digestibility of paper mulberry. Animals 2021, 11, 413. [Google Scholar] [CrossRef]
  2. Han, H.; Wang, C.; Huang, Z.; Zhang, Y.; Sun, L.; Xue, Y.; Guo, X. Effects of lactic acid bacteria-inoculated corn silage on bacterial communities and metabolites of digestive tract of sheep. Fermentation 2022, 8, 320. [Google Scholar] [CrossRef]
  3. Danner, H.; Holzer, M.; Mayrhuber, E.; Braun, R. Acetic acid increases stability of silage under aerobic conditions. Appl. Environ. Microbiol. 2003, 69, 562–567. [Google Scholar] [CrossRef] [PubMed]
  4. Wilkinson, J.M.; Davies, D.R. The aerobic stability of silage: Key findings and recent developments. Grass Forage Sci. 2013, 68, 1–19. [Google Scholar] [CrossRef]
  5. Chen, L.; Guo, G.; Yuan, X.; Shimojo, M.; Yu, C.; Shao, T. Effect of applying molasses and propionic acid on fermentation quality and aerobic stability of total mixed ration silage prepared with whole-plant corn in Tibet. Asian-Australas. J. Anim. Sci. 2014, 27, 349–356. [Google Scholar] [CrossRef] [PubMed]
  6. Santos, A.P.M.d.; Santos, E.M.; Araújo, G.G.L.d.; Oliveira, J.S.d.; Zanine, A.d.M.; Pinho, R.M.A.; Cruz, G.F.d.L.; Ferreira, D.d.J.; Perazzo, A.F.; Pereira, D.M.; et al. Effect of inoculation with preactivated Lactobacillus buchneri and urea on fermentative profile, aerobic stability and nutritive value in corn silage. Agriculture 2020, 10, 335. [Google Scholar] [CrossRef]
  7. Weinberg, Z.G.; Khanal, P.; Yildiz, C.; Chen, Y.; Arieli, A. Ensiling fermentation products and aerobic stability of corn and sorghum silages. Grassl. Sci. 2011, 57, 46–50. [Google Scholar] [CrossRef]
  8. Da Silva, T.C.; Smith, M.L.; Barnard, A.M.; Kung, L. The effect of a chemical additive on the fermentation and aerobic stability of high-moisture corn. J. Dairy Sci. 2015, 98, 8904–8912. [Google Scholar] [CrossRef] [PubMed]
  9. B Benjamim da Silva, É.; Costa, D.M.; Santos, E.M.; Moyer, K.; Hellings, E.; Kung, L. The effects of Lactobacillus hilgardii 4785 and Lactobacillus buchneri 40788 on the microbiome, fermentation, and aerobic stability of corn silage ensiled for various times. J. Dairy Sci. 2021, 104, 10678–10698. [Google Scholar] [CrossRef]
  10. Serva, L.; Magrin, L.; Marchesini, G.; Andrighetto, I. Short communication: Prognostic values of a multiparametric risk score in maize silage undergoing different ensiling conditions. Agronomy 2022, 12, 774. [Google Scholar] [CrossRef]
  11. Xia, G.-h.; Huang, Y.; Wu, C.-r.; Zhang, M.-z.; Yin, H.-y.; Yang, F.; Chen, C.; Hao, J. Characterization of mycotoxins and microbial community in whole-plant corn ensiled in different silo types during aerobic exposure. Front. Microbiol. 2023, 14, 1136022. [Google Scholar] [CrossRef] [PubMed]
  12. Hu, W.; Schmidt, R.J.; McDonell, E.E.; Klingerman, C.M.; Kung, L. The effect of Lactobacillus buchneri 40788 or Lactobacillus plantarum MTD-1 on the fermentation and aerobic stability of corn silages ensiled at two dry matter contents. J. Dairy Sci. 2009, 92, 3907–3914. [Google Scholar] [CrossRef] [PubMed]
  13. Reich, L.J.; Kung, L. Effects of combining Lactobacillus buchneri 40788 with various lactic acid bacteria on the fermentation and aerobic stability of corn silage. Anim. Feed Sci. Technol. 2010, 159, 105–109. [Google Scholar] [CrossRef]
  14. Ranjit, N.K.; Kung, L. The effect of Lactobacillus buchneri, Lactobacillus plantarum, or a chemical preservative on the fermentation and aerobic stability of corn silage. J. Dairy Sci. 2000, 83, 526–535. [Google Scholar] [CrossRef] [PubMed]
  15. Gandra, J.R.; Oliveira, E.R.; de Sena Gandra, E.R.; Takiya, C.S.; Tonissi Buschineli de Goes, R.H.; Pires Oliveira, K.M.; Silveira, K.A.; Cariolano Araki, H.M.; Orbach, N.D.; Vasquez, D.N. Inoculation of Lactobacillus buchneri alone or with Bacillus subtilis and total losses, aerobic stability, and microbiological quality of sunflower silage. J. Appl. Anim. Res. 2017, 45, 609–614. [Google Scholar] [CrossRef]
  16. Bonaldi, D.S.; Carvalho, B.F.; Ávila, C.L.d.S.; Silva, C.F. Effects of Bacillus subtilis and its metabolites on corn silage quality. Appl. Microbiol. Biotechnol. 2021, 73, 46–53. [Google Scholar] [CrossRef]
  17. Bampidis, V.; Azimonti, G.; Bastos, M.D.L.; Christensen, H.; Dusemund, B.; Kouba, M.; Kos, D.M.; Lópezalonso, M.; López, P.S.; Marcon, F.; et al. Safety and efficacy of Bacillus licheniformis DSM 32457 as a silage additive for all animal species. EFSA J. 2019, 17, 5787. [Google Scholar]
  18. Afordoanyi, D.; Diabankana, R.; Krupin, E.; Bikchantaev, I.; Taylan, A.; Validov, S. Inhibitory effects of Bacillus licheniformis WJ53A and homofermentative lactic acid bacteria on clostridial growth in corn silage. Pak. J. Agric. Sci. 2023, 60, 53–63. [Google Scholar]
  19. Zhu, Y.; Xiong, H.; Wen, Z.; Tian, H.; Chen, Y.; Wu, L.; Guo, Y.; Sun, B. Effects of different concentrations of Lactobacillus plantarum and Bacillus licheniformis on silage quality, in vitro fermentation and microbial community of Hybrid Pennisetum. Animals 2022, 12, 1752. [Google Scholar] [CrossRef]
  20. Liu, B.; Yang, Z.; Huan, H.; Gu, H.; Xu, N.; Ding, C. Impact of molasses and microbial inoculants on fermentation quality, aerobic stability, and bacterial and fungal microbiomes of barley silage. Sci. Rep. 2020, 10, 5342. [Google Scholar] [CrossRef]
  21. Wang, T.; Teng, K.; Cao, Y.; Shi, W.; Xuan, Z.; Zhou, J.; Zhang, J.; Zhong, J. Effects of Lactobacillus hilgardii 60TS-2, with or without homofermentative Lactobacillus plantarum B90, on the aerobic stability, fermentation quality and microbial community dynamics in sugarcane top silage. Bioresour. Technol. 2020, 312, 123600. [Google Scholar] [CrossRef]
  22. Liu, Y.; Li, Y.; Lu, Q.; Sun, L.; Du, S.; Liu, T.; Hou, M.; Ge, G.; Wang, Z.; Jia, Y. Effects of lactic acid bacteria additives on the quality, volatile chemicals and microbial community of leymus chinensis silage during aerobic exposure. Front. Microbiol. 2022, 13, 938153. [Google Scholar] [CrossRef]
  23. Yin, H.; Zhao, M.; Pan, G.; Zhang, H.; Yang, R.; Sun, J.; Yu, Z.; Bai, C.; Xue, Y. Effects of Bacillus subtilis or Lentilactobacillus buchneri on aerobic stability, and the microbial community in aerobic exposure of whole plant corn silage. Front. Microbiol. 2023, 14, 1177031. [Google Scholar] [CrossRef] [PubMed]
  24. Guyader, J.; Baron, V.S.; Beauchemin, K.A. Effect of harvesting corn after frost in Alberta (Canada) on whole-plant yield, nutritive value, and kernel properties. Agronomy 2021, 11, 459. [Google Scholar] [CrossRef]
  25. Shi, J.; Zhang, G.; Ke, W.; Pan, Y.; Hou, M.; Chang, C.; Sa, D.; Lv, M.; Liu, Y.; Lu, Q. Effect of endogenous sodium and potassium ions in plants on the quality of alfalfa silage and bacterial community stability during fermentation. Front. Plant Sci. 2023, 14, 1295114. [Google Scholar] [CrossRef] [PubMed]
  26. Kung, L.; Taylor, C.C.; Lynch, M.P.; Neylon, J.M. The effect of treating alfalfa with Lactobacillus buchneri 40788 on silage fermentation, aerobic stability, and nutritive value for lactating dairy cows. J. Dairy Sci. 2003, 86, 336–343. [Google Scholar] [CrossRef]
  27. Guo, X.; Guo, W.; Yang, M.; Sun, Y.; Wang, Y.; Yan, Y.; Zhu, B. Effect of Bacillus additives on fermentation quality and bacterial community during the ensiling process of whole-plant corn silage. Processes 2022, 10, 978. [Google Scholar] [CrossRef]
  28. ZieliDska, K.; Fabiszewska, A.; StefaDska, I. Different aspects of Lactobacillus inoculants on the improvement of quality and safety of alfalfa silage. Chil. J. Agric. Res. 2015, 75, 298–306. [Google Scholar] [CrossRef]
  29. Bai, J.; Xu, D.; Xie, D.; Wang, M.; Li, Z.; Guo, X. Effects of antibacterial peptide-producing Bacillus subtilis and Lactobacillus buchneri on fermentation, aerobic stability, and microbial community of alfalfa silage. Bioresour. Technol. 2020, 315, 123881. [Google Scholar] [CrossRef]
  30. Wu, B.; Ai, J.; Li, T.; Qin, W.; Hu, Z.; Siqin, T.; Wu, T.; Wang, C.; Niu, H. Fermentation quality, aerobic stability, and microbiome structure and function of Caragana korshinskii silage inoculated with/without Lactobacillus rhamnosus or Lactobacillus buchneri. Front. Sustain. Food Syst. 2023, 7, 1255936. [Google Scholar] [CrossRef]
  31. Liu, Q.; Lindow, S.E.; Zhang, J. Lactobacillus parafarraginis ZH1 producing anti-yeast substances to improve the aerobic stability of silage. Anim. Sci. J. 2018, 89, 1302–1309. [Google Scholar] [CrossRef] [PubMed]
  32. Ferrero, F.; Tabacco, E.; Borreani, G. Lentilactobacillus hilgardii inoculum, dry matter contents at harvest and length of conservation affect fermentation characteristics and aerobic stability of corn silage. Front. Microbiol. 2021, 12, 675563. [Google Scholar] [CrossRef] [PubMed]
  33. Tabacco, E.; Piano, S.; Revello-Chion, A.; Borreani, G. Effect of Lactobacillus buchneri LN4637 and Lactobacillus buchneri LN40177 on the aerobic stability, fermentation products, and microbial populations of corn silage under farm conditions. J. Dairy Sci. 2011, 94, 5589–5598. [Google Scholar] [CrossRef] [PubMed]
  34. Huang, Z.; Wang, M.; Ke, W.; Guo, X. Screening of high 1,2-propanediol production by Lactobacillus buchneri strains and their effects on fermentation characteristics and aerobic stability of whole-plant corn silage. Agriculture 2021, 11, 590. [Google Scholar] [CrossRef]
  35. Filya, I. The effect of Lactobacillus buchneri, with or without homofermentative lactic acid bacteria, on the fermentation, aerobic stability and ruminal degradability of wheat, sorghum and maize silages. J. Appl. Microbiol. 2003, 95, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, Y.-C.; Li, D.-X.; Wang, X.-K.; Lin, Y.-L.; Zhang, Q.; Chen, X.-Y.; Yang, F.-Y. Fermentation quality and aerobic stability of mulberry silage prepared with lactic acid bacteria and propionic acid. Anim. Sci. J. 2019, 90, 513–522. [Google Scholar] [CrossRef] [PubMed]
  37. Méndez-García, C.; Peláez, A.I.; Mesa, V.; Sánchez, J.; Golyshina, O.V.; Ferrer, M. Microbial diversity and metabolic networks in acid mine drainage habitats. Front. Microbiol. 2015, 6, 475. [Google Scholar]
  38. Wang, Z.; Tan, Z.; Wu, G.; Wang, L.; Qin, G.; Wang, Y.; Pang, H. Investigation on fermentation characteristics and microbial communities of wheat straw silage with different proportion artemisia argyi. Toxins 2023, 15, 330. [Google Scholar] [CrossRef] [PubMed]
  39. Sun, L.; Xue, Y.; Xiao, Y.; Te, R.; Wu, X.; Na, N.; Wu, N.; Qili, M.; Zhao, Y.; Cai, Y. Community synergy of lactic acid bacteria and cleaner fermentation of oat silage prepared with a multispecies microbial inoculant. Microbiol. Spectr. 2023, 11, e00705-23. [Google Scholar] [CrossRef]
  40. Liu, Q.H.; Shao, T.; Zhang, J.G. Determination of aerobic deterioration of corn stalk silage caused by aerobic bacteria. Anim. Feed Sci. Technol. 2013, 183, 124–131. [Google Scholar] [CrossRef]
  41. Liu, M.; Sun, L.; Wang, Z.; Ge, G.; Jia, Y.; Du, S. Effects of alfalfa hay to oat hay ratios on chemical composition, fermentation characteristics, and fungal communities during aerobic exposure of fermented total mixed ration. Fermentation 2023, 9, 480. [Google Scholar] [CrossRef]
  42. Liu, B.; Huan, H.; Gu, H.; Xu, N.; Shen, Q.; Ding, C. Dynamics of a microbial community during ensiling and upon aerobic exposure in lactic acid bacteria inoculation-treated and untreated barley silages. Bioresour. Technol. 2019, 273, 212–219. [Google Scholar] [CrossRef] [PubMed]
  43. Jiang, D.; Li, B.; Zheng, M.; Niu, D.; Zuo, S.; Xu, C. Effects of Pediococcus pentosaceus on fermentation, aerobic stability and microbial communities during ensiling and aerobic spoilage of total mixed ration silage containing alfalfa (Medicago sativa L.). Grassl. Sci. 2020, 66, 215–224. [Google Scholar] [CrossRef]
  44. Su, R.; Li, F.; Liang, Y.; Sheoran, N.; Bai, J.; Hao, L.; Ke, W.; Hu, C.; Jia, M.; Usman, S.; et al. Responses of microbial community dynamics, co-occurrences, functional shifts, and natural fermentation profiles of Elymus nutans silage to altitudinal gradients. Microbiol. Spectr. 2024, 12, e02516-23. [Google Scholar] [CrossRef]
  45. Kitamoto, H.K.; Ohmomo, S.; Nakahara, T. Selection of killer yeasts (Kluyveromyces lactis) to prevent aerobic deterioration in silage making. J. Dairy Sci. 1993, 76, 803–811. [Google Scholar] [CrossRef] [PubMed]
  46. Comitini, F.; Ciani, M. The zymocidial activity of Tetrapisispora phaffii in the control of Hanseniaspora uvarum during the early stages of winemaking. Lett. Appl. Microbiol. 2010, 50, 50–56. [Google Scholar] [CrossRef] [PubMed]
  47. Tao, X.; Wang, S.; Zhao, J.; Dong, Z.; Li, J.; Liu, Q.; Sun, F.; Shao, T. Effect of ensiling alfalfa with citric acid residue on fermentation quality and aerobic stability. Anim. Feed Sci. Technol. 2020, 269, 114622. [Google Scholar] [CrossRef]
  48. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [PubMed]
  49. Ke, W.; Wang, Y.; Rinne, M.; de Oliveira Franco, M.; Li, F.; Lin, Y.; Zhang, Q.; Cai, Y.; Zhang, G. Effects of lactic acid bacteria and molasses on the fermentation quality, in vitro dry matter digestibility, and microbial community of Korshinsk peashrub (Caragana korshinskii Kom.) silages harvested at two growth stages. Grass Forage Sci. 2023, 66, 215–224. [Google Scholar] [CrossRef]
  50. Arthur Thomas, T. An automated procedure for the determination of soluble carbohydrates in herbage. J. Sci. Food Agric. 1977, 28, 639–642. [Google Scholar] [CrossRef]
  51. Wang, C.; Han, H.; Sun, L.; Na, N.; Xu, H.; Chang, S.; Jiang, Y.; Xue, Y. Bacterial succession pattern during the fermentation process in whole-plant corn silage processed in different geographical areas of northern China. Processes 2021, 9, 900. [Google Scholar] [CrossRef]
  52. Feng, Q.; Zhang, J.; Ling, W.; Degen, A.A.; Zhou, Y.; Ge, C.; Yang, F.; Zhou, J. Ensiling hybrid Pennisetum with lactic acid bacteria or organic acids improved the fermentation quality and bacterial community. Front. Microbiol. 2023, 14, 1216722. [Google Scholar] [CrossRef] [PubMed]
  53. Bai, C.; Pan, G.; Leng, R.; Ni, W.; Yang, J.; Sun, J.; Yu, Z.; Liu, Z.; Xue, Y. Effect of ensiling density and storage temperature on fermentation quality, bacterial community, and nitrate concentration of sorghum-sudangrass silage. Front. Microbiol. 2022, 13, 828320. [Google Scholar] [CrossRef]
  54. Wang, M.; Xu, S.; Wang, T.; Jia, T.; Xu, Z.; Wang, X.; Yu, Z. Effect of inoculants and storage temperature on the microbial, chemical and mycotoxin composition of corn silage. Asian-Australas. J. Anim. Sci. 2018, 31, 1903–1912. [Google Scholar] [CrossRef] [PubMed]
  55. Vázquez-Baeza, Y.; Pirrung, M.; Gonzalez, A.; Knight, R. EMPeror: A tool for visualizing high-throughput microbial community data. GigaScience 2013, 2, 16. [Google Scholar] [CrossRef] [PubMed]
Plants 13 01471 g001
Figure 1. Dynamics of silage temperature (°C) (A) and aerobic stability (B) during aerobic exposure. Means with different lowercase letters (a,b) indicate significant differences in aerobic stability time (p < 0.05). AT + 2 °C represents ambient temperature plus 2 °C. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Figure 1. Dynamics of silage temperature (°C) (A) and aerobic stability (B) during aerobic exposure. Means with different lowercase letters (a,b) indicate significant differences in aerobic stability time (p < 0.05). AT + 2 °C represents ambient temperature plus 2 °C. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Plants 13 01471 g001
Plants 13 01471 g002
Figure 2. pH (A), lactic acid (B), acetic acid (C), and propanoic acid (D) of silage during aerobic exposure. Means with different lowercase letters (a,b) differ significantly (p < 0.05). D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Figure 2. pH (A), lactic acid (B), acetic acid (C), and propanoic acid (D) of silage during aerobic exposure. Means with different lowercase letters (a,b) differ significantly (p < 0.05). D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Plants 13 01471 g002
Plants 13 01471 g003
Figure 3. Lactic acid bacteria (A), coliform bacteria (B), yeasts (C), and filamentous fungi (D) of silage during aerobic exposure. * significance at p < 0.05. D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Figure 3. Lactic acid bacteria (A), coliform bacteria (B), yeasts (C), and filamentous fungi (D) of silage during aerobic exposure. * significance at p < 0.05. D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days. CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis.
Plants 13 01471 g003
Plants 13 01471 g004
Figure 4. Venn diagram of bacterial (A) and fungal (B) OTUs in silage during aerobic exposure. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Figure 4. Venn diagram of bacterial (A) and fungal (B) OTUs in silage during aerobic exposure. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Plants 13 01471 g004
Plants 13 01471 g005
Figure 5. Principal coordinate analysis of bacterial (A) and fungal (B) communities in silage during aerobic exposure. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Figure 5. Principal coordinate analysis of bacterial (A) and fungal (B) communities in silage during aerobic exposure. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Plants 13 01471 g005
Plants 13 01471 g006
Figure 6. Changes of bacteria at the phylum level (A), genus level (B), and the differences in genus level (C). * significance at p < 0.05; ** significance at p < 0.01. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Figure 6. Changes of bacteria at the phylum level (A), genus level (B), and the differences in genus level (C). * significance at p < 0.05; ** significance at p < 0.01. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Plants 13 01471 g006
Plants 13 01471 g007
Figure 7. Changes in fungi at the phylum level (A), genus level (B), and the differences in genus level (C). * significance at p < 0.05; ** significance at p < 0.01. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Figure 7. Changes in fungi at the phylum level (A), genus level (B), and the differences in genus level (C). * significance at p < 0.05; ** significance at p < 0.01. CK0, CK3, and CK7 represent silage not inoculated at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; LB0, LB3, and LB7 represent silage inoculated with Lactobacillus buchneri at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively; BL0, BL3, and BL7 represent silage inoculated with Bacillus licheniformis at 0 d, 3 d, and 7 d of the aerobic exposure stage, respectively.
Plants 13 01471 g007
Plants 13 01471 g008
Figure 8. Spearman analysis between silage parameters and bacterial species (A), and fungal species (B) during aerobic exposure; Mantel tests were used to analyze the correlations of fermentation characteristics and the abundance of bacterial and fungal communities (C). * significance at p < 0.05; ** significance at p < 0.01; *** significance at p < 0.001.
Figure 8. Spearman analysis between silage parameters and bacterial species (A), and fungal species (B) during aerobic exposure; Mantel tests were used to analyze the correlations of fermentation characteristics and the abundance of bacterial and fungal communities (C). * significance at p < 0.05; ** significance at p < 0.01; *** significance at p < 0.001.
Plants 13 01471 g008
Plants 13 01471 g009
Figure 9. Interaction networks of the silage in bacterial (A–C) and fungal (D–F) communities. (A,C) represent silage not inoculated; (B,E) represent silage inoculated with Lactobacillus buchneri; (C,F) represent silage inoculated with Bacillus licheniformis. Node size and color represent the bacterial phylum and relative abundance, respectively; the edges are colored based on negative (green) and positive (red) correlations.
Figure 9. Interaction networks of the silage in bacterial (A–C) and fungal (D–F) communities. (A,C) represent silage not inoculated; (B,E) represent silage inoculated with Lactobacillus buchneri; (C,F) represent silage inoculated with Bacillus licheniformis. Node size and color represent the bacterial phylum and relative abundance, respectively; the edges are colored based on negative (green) and positive (red) correlations.
Plants 13 01471 g009
Table 1. Chemical and microbial characteristics of fresh whole-plant corn.
Table 1. Chemical and microbial characteristics of fresh whole-plant corn.
ItemWhole-Plant CornSEM
DM (g/kg FW)372.544.286
CP (g/kg DM)79.840.541
aNDF (g/kg DM)375.7218.067
ADF (g/kg DM)173.8410.825
WSC (g/kg DM)113.7010.085
Ash (g/kg DM)41.513.850
Lactic acid bacteria (lg CFU/g)5.640.106
Coliform bacteria (lg CFU/g)5.900.174
Yeasts (lg CFU/g)6.390.019
Filamentous fungi (lg CFU/g)<2.00-
DM represents dry matter; FW represents fresh weight; CP represents crude protein; aNDF represents neutral detergent fiber assayed with a heat-stable amylase; ADF represents acid detergent fiber; WSC represents water soluble carbohydrates; SEM represents standard error of the mean.
Table 2. Nutrient composition of whole-plant corn silage after 60 days of ensiling.
Table 2. Nutrient composition of whole-plant corn silage after 60 days of ensiling.
ItemTreatmentsSEMp Value
CKLBBL
DM (g/kg FW)371.05374.90374.333.1730.869
CP (g/kg DM)83.6585.9882.650.6130.904
aNDF (g/kg DM)352.37343.40340.0011.4800.766
ADF (g/kg DM)171.33171.60169.876.5200.993
WSC (g/kg DM)46.9339.8339.251.3820.089
Ash (g/kg DM)46.53 a41.60 ab40.90 b0.725<0.05
Means with different lowercase letters in the same row (a,b) differ significantly (p < 0.05). FW represents fresh weight; DM represents dry matter; CP represents crude protein; aNDF represents neutral detergent fiber assayed with a heat-stable amylase; ADF represents acid detergent fiber; WSC represents water soluble carbohydrates; CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis; SEM represents standard error of the mean.
Table 3. Variations in the richness and diversity of the bacterial community in whole-plant corn silage after aerobic exposure.
Table 3. Variations in the richness and diversity of the bacterial community in whole-plant corn silage after aerobic exposure.
ItemDTreatmentsSEMp Value
CKLBBLDTD*T
Shannon02.93 Aa2.67 Ba3.04 Aa0.034<0.01<0.01<0.01
32.86 Aa0.81 Bb0.50 Bb
70.60 Ab0.59 Ab0.35 Bb
Simpson00.10 Bb0.14 Ab0.10 Bb0.019<0.01<0.01<0.01
30.10 Bb0.70 Aa0.77 Aa
70.63 a0.70 a0.60 a
Chao0281.53 Ba387.13 Aa350.13 Aa3.933<0.01<0.01<0.01
3217.60 Ab164.03 Ab59.20 Bb
710.92 Ac8.25 Bc8.63 Bb
Coverage (%)099.83 b99.78 c99.82 b0.000<0.010.4640.130
399.88 b99.91 b99.93 a
799.99 a99.99 a99.99 a
Means with different uppercase letters in the same row (A,B) differ significantly (p < 0.05). Means with different lowercase letters in the same column (a–c) differ significantly (p < 0.05). CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis. SEM represents standard error of the mean. D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days.
Table 4. Variations in the richness and diversity of the fungal community in whole-plant corn silage after aerobic exposure.
Table 4. Variations in the richness and diversity of the fungal community in whole-plant corn silage after aerobic exposure.
ItemDTreatmentsSEMp Value
CKLBBLDTD*T
Shannon02.68 a2.94 a2.89 a0.037<0.01<0.01<0.01
32.91 a2.57 b2.96 a
70.99 Bb1.53 ABc2.09 Ab
Simpson00.21 Ab0.14 Cc0.18 Bab0.009<0.01<0.01<0.01
30.11 Bb0.20 Ab0.13 Bb
70.68 Aa0.41 Ba0.24 Ba
Chao0630.02 Ba750.19 Aa653.06 Ba7.387<0.01<0.05<0.01
3745.05 a647.32 b684.13 a
7268.08 Ab88.27 Bc302.61 Ab
Coverage (%)099.66 b99.62 b99.71 b0.000<0.050.8750.451
399.66 b99.67 b99.66 b
799.86 a99.91 a99.86 a
Means with different uppercase letters in the same row (A–C) differ significantly (p < 0.05). Means with different lowercase letters in the same column (a–c) differ significantly (p < 0.05). CK represents silage without inoculation; LB represents silage with inoculation of Lactobacillus buchneri; BL represents silage with inoculation of Bacillus licheniformis. SEM represents standard error of the mean. D represents aerobic exposure days; T represents treatments; D*T represents interaction between treatments and aerobic exposure days.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yin, H.; Zhao, M.; Yang, R.; Sun, J.; Yu, Z.; Bai, C.; Xue, Y. Effect of Regulation of Whole-Plant Corn Silage Inoculated with Lactobacillus buchneri or Bacillus licheniformis Regarding the Dynamics of Bacterial and Fungal Communities on Aerobic Stability. Plants 2024, 13, 1471. https://doi.org/10.3390/plants13111471

AMA Style

Yin H, Zhao M, Yang R, Sun J, Yu Z, Bai C, Xue Y. Effect of Regulation of Whole-Plant Corn Silage Inoculated with Lactobacillus buchneri or Bacillus licheniformis Regarding the Dynamics of Bacterial and Fungal Communities on Aerobic Stability. Plants. 2024; 13(11):1471. https://doi.org/10.3390/plants13111471

Chicago/Turabian Style

Yin, Hang, Meirong Zhao, Rui Yang, Juanjuan Sun, Zhu Yu, Chunsheng Bai, and Yanlin Xue. 2024. "Effect of Regulation of Whole-Plant Corn Silage Inoculated with Lactobacillus buchneri or Bacillus licheniformis Regarding the Dynamics of Bacterial and Fungal Communities on Aerobic Stability" Plants 13, no. 11: 1471. https://doi.org/10.3390/plants13111471

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop