Next Article in Journal
How Do Plant Growth-Promoting Bacteria Use Plant Hormones to Regulate Stress Reactions?
Previous Article in Journal
Transcriptomic and Metabolomic Analysis Reveals the Potential Roles of Polyphenols and Flavonoids in Response to Sunburn Stress in Chinese Olive (Canarium album)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 17
10.3390/plants13172370
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ectopic Expression of AetPGL from Aegilops tauschii Enhances Cadmium Tolerance and Accumulation Capacity in Arabidopsis thaliana

by
Junxing Yu
1,†,
Xiaopan Hu
1,†,
Lizhou Zhou
1,
Lvlan Ye
1,
Tuo Zeng
1,
Xuye Du
1,
Lei Gu
1,
Bin Zhu
1,
Yingying Zhang
2,* and
Hongcheng Wang
1,*
1
School of Life Sciences, Guizhou Normal University, Guiyang 550025, China
2
Institute of Animal Husbandry & Veterinary Science, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(17), 2370; https://doi.org/10.3390/plants13172370
Submission received: 27 June 2024 / Revised: 11 August 2024 / Accepted: 23 August 2024 / Published: 25 August 2024
(This article belongs to the Special Issue Physiological and Biochemical Responses of Plants to Heavy Metal Stress)
Browse Figures
Versions Notes

Abstract

:
Cadmium (Cd) is a toxic heavy metal that accumulates in plants, negatively affecting their physiological processes, growth, and development, and poses a threat to human health through the food chain. 6-phosphogluconolactonase (PGL) is a key enzyme in the Oxidative Pentose Phosphate Pathway(OPPP) in plant cells, essential for cellular metabolism. The OPPP pathway provides energy and raw materials for organisms and is involved in antioxidant reactions, lipid metabolism, and DNA synthesis. This study describes the Cd responsive gene AetPGL from Aegilops tauschii. Overexpression of AetPGL under Cd stress increased main root length and germination rate in Arabidopsis. Transgenic lines showed higher antioxidant enzyme activities and lower malondialdehyde (MDA) content compared to the wild type. The transgenic Arabidopsis accumulated more Cd in the aboveground part but not in the underground part. Expression levels of AtHMA3, AtNRAMP5, and AtZIP1 in the roots of transgenic plants increased under Cd stress, suggesting AetPGL may enhance Cd transport from root to shoot. Transcriptome analysis revealed enrichment of differentially expressed genes (DEGs) in the plant hormone signal transduction pathway in AetPGL-overexpressing plants. Brassinosteroids (BR), Gibbenellin acid (GA), and Jasmonic acid (JA) contents significantly increased after Cd treatment. These results indicate that AetPGL may enhance Arabidopsis’ tolerance to Cd by modulating plant hormone content. In conclusion, AetPGL plays a critical role in improving cadmium tolerance and accumulation and mitigating oxidative stress by regulating plant hormones, providing insights into the molecular mechanisms of plant Cd tolerance.

1. Introduction

As industry and agriculture continue to advance rapidly, the escalating issue of environmental heavy metals (HMs) pollution is a matter of increasing concern. Soil microorganisms are unable to break down toxic heavy metals such as cadmium (Cd), lead, mercury, and aluminum [1]. Nevertheless, the deleterious effects of these heavy metals on plants are substantial, with even minute quantities exerting a detrimental influence on plant growth [2]. Metal poisoning results in an imbalance in plant nutrition, sluggish growth, and alterations in essential physiological processes such as photosynthesis, respiration, and transpiration, ultimately culminating in the demise of the plant [3,4]. These toxic heavy metals accumulate in plants and enter the food chain, posing a threat to the health of animals and humans. Excessive metal buildup in the human body has been linked to issues such as cancer and damage to organs such as the liver, kidneys, spleen, bones, and reproductive system, according to studies [5,6]. As a non-essential element for plants, animals, and humans, Cd concentrations were reported to surpass the national standard by 7.0%, as per a government report in China [7]. Consequently, elucidating the molecular mechanism of plant Cd tolerance and cultivating crops with robust Cd tolerance and minimal Cd accumulation have become pressing issues.
The oxidative pentose phosphate pathway (OPPP) is a classical metabolic route in plants [8]. Key enzymes within this pathway, including 6-phosphogluconolactonase (PGL), 6-phosphogluconate dehydrogenase (6PGD), and glucose-6-phosphate dehydrogenase (G6PD), are essential for NADPH (Nicotinamide Adenine Dinucleotide Phosphate) production. NADPH acts as a critical reducing agent, aiding in the elimination of reactive oxygen species (ROS) [9,10]. Thus, the OPPP is crucial for regulating plant growth, development, and responses to various environmental stresses. Increased Cyt-G6PDH activity enhances drought resistance in soybean roots through ABA-dependent signaling [11,12]. Transgenic tobacco plants overexpressing G6PDH show greater cold tolerance than controls, as well as increased activities of superoxide dismutase (SOD) and peroxidase (POD), improving freezing resistance in poplar [13]. Additionally, G6PDH modulates cellular redox balance and oxidative stress responses by affecting H+-ATPase and Na+/H+ antiporters in the plasma membrane and participating in antioxidant synthesis under salt and drought conditions [14,15]. The expression and activity of TaG6PD and Ta6PGD are upregulated in winter wheat under cold stress, a response further enhanced by exogenous abscisic acid (ABA). When overexpressed in Arabidopsis, TaG6PD and Ta6PGD increase ROS-scavenging ability and survival rates compared to wild-type plants under cold stress [16]. Similarly, the transcript levels of Os6PGDH1 and Os6PGDH2 rise in rice seedlings exposed to drought, cold, high salinity, and ABA treatments [17,18]. Studies have shown that Gm6PGDH1 overexpression enhances soybean tolerance to phosphate starvation by improving root development and antioxidant system modulation [19]. Unlike G6PD and 6PGD, the role of PGL in plant responses to abiotic stress has been less studied. Recent findings emphasize PGL’s significant role in bacterial pathogen resistance [20] and regulation of the glucose metabolism pathway [21,22].
Plant hormones are increasingly recognized by researchers as an eco-friendly method to enhance plant tolerance to HM stress. These hormones, produced in minute quantities, act as chemical messengers, crucially regulating plant growth and development. Additionally, they enhance plant resistance to various stresses [23]. Early studies have shown that exogenous application of plant hormones can improve plant tolerance to HM exposure [24]. For example, foliar application of 0.1 mM salicylic acid (SA) significantly improved the physiological characteristics of rice seedlings under Cd stress by reducing the accumulation of malondialdehyde (MDA) and hydrogen peroxide (H2O2) [25]. Similarly, applying auxin (IAA) to mustard plants mitigated As-induced oxidative damage by decreasing reactive oxygen species (ROS) and lipid peroxidation while enhancing membrane stability and rigidity [26]. Furthermore, HM exposure causes significant changes in endogenous plant hormone levels, regulating various plant stress adaptation mechanisms [27]. Experiments on Lycium chinense under Cd stress revealed the protective role of ethylene, showing that upregulation of the LchERF gene and accumulation of oxidized glutathione (GSG) significantly increased endogenous ethylene production, thereby enhancing Cd stress tolerance [28]. Moreover, HMA4 (Heavy Metal ATPase 4) is responsible for transporting Cd from the roots to the stem and accumulating it in stem tissue. Upregulation of HMA4 can also modify endogenous ABA levels, reducing oxidative damage and toxicity caused by Cd in plants [29].
Common wheat (Triticum aestivum L.) ranks among the world’s most extensively cultivated crops, featuring three genomes (A, B, and D). Aegilops tauschii, the D genome donor of common wheat, exhibits abundant genetic diversity and resilience to various biotic and abiotic stresses [30,31]. In a previous study, differentially expressed genes (DEGs) under Cd stress were discerned in Ae. tauschii through transcriptome sequencing. Additionally, our investigation revealed significant upregulation of the AetPGL gene under Cd stress. This study predominantly elucidates the role of AetPGL, overexpressed in A. thaliana, and demonstrates its capacity to enhance Cd tolerance and accumulation in transgenic plants by augmenting phytohormone synthesis. The findings deepened the understanding of the mechanism of AetPGL’s functions as a key component in the phytohormone-mediated signaling pathway in Cd stress.

2. Materials and Methods

2.1. Plant Culture and Treatments

The experimental plant materials comprised Ae. tauschii and A. thaliana. A. thaliana seeds were disinfected using 75% ethanol for 3 min, followed by rinsing with sterile water and 2% NaClO for 10 min each, and finally rinsed with sterile water three times to remove any residual NaClO on the seed surface. After washing, the seeds underwent vernalization at 4 °C for 3 days, germinated vertically on Murashige and Skoog (MS) medium for 7 days, and were subsequently transplanted into nutrient soil. After three weeks of growth in nutrient soil, nine pots of wild-type plants and three pots of transgenic lines (each pot containing four plants) were selected and divided into three sets. The plants were cultivated in Hoagland nutrient solution for 14 days, with an option to include or exclude 2.5 mmol/L CdCl2. A. thaliana seeds disinfected as described above were placed in 1/2 MS medium containing 100 μM and 150 μM Cd, followed by vernalization at 4 °C for three days. Observations on root length and germination rate were made after 11 days of growth under standard conditions.

2.2. Phylogenetic and Conserved Motif Analysis of AetPGL Proteins

We used the PGL protein sequence as the query condition to search the protein sequence in the NCBI database. The AetPGL sequence was aligned with related proteins using DNAMAN 5.2.2. Subsequently, phylogenetic relationships were analyzed employing the maximum likelihood method and visualized using MEGA 7.0. The genetic phylogenetic tree for the 15 PGL proteins was constructed using the maximum likelihood (ML) method (model: Jones–Taylor–Thornton). A total of 1000 bootstrap replicates were performed using MEGA 7.0.

2.3. RNA Isolation and qRT-PCR

RNA extraction and RT-qPCR were conducted in accordance with the procedures outlined in the published research [32]. The RT-qPCR was performed using the BIOER FQD-48A system (BIOER, Hangzhou, China). The primer sequences used in this analysis are available in the attached Table, with actin 1 utilized as the reference gene. The 2−∆∆CT method, which was reported previously, was employed to estimate gene expression [33].

2.4. Construction of the AetPGL Expression Vector and Genetic Transformation of Arabidopsis thaliana

The RNA extracted from Ae. tauschii was reverse transcribed into cDNA using the ExonScript RT Mix (Bgbiotech, Chongqing, China). The CDS sequence of AetPGL was amplified with a high-fidelity enzyme (Yeasen, Shanghai, China), using primers listed in Table A1, and ligated into the pBI121 plasmid using the Hieff Clone® Plus One Step Cloning Kit (Yeasen, Shanghai, China) to form the recombinant plasmid pBI121-AetPGL [34]. The recombinant plasmid pBI121-AetPGL was then transformed into Agrobacterium tumefaciens strain GV3101. After the wild-type A. thaliana began flowering, genetic transformation was carried out using the floral dip method to introduce the recombinant Agrobacterium GV3101 carrying the target gene into the wild-type A. thaliana [35]. Positive plants were selected on 1/2 MS medium containing 50 mg/L kanamycin. T3 generation seeds were obtained through multiple rounds of screening and used for subsequent experiments.

2.5. Phenotypic Analysis and Physiological Index Determination

The activities of antioxidant enzymes (POD; SOD; peroxidase, APX; catalase, CAT), along with the concentrations of malondialdehyde (MDA) and proline (Pro), were measured and analyzed in both the shoots and roots of WT and transgenic Arabidopsis. Quantification was conducted using a test kit with detailed experimental procedures (Solarbio, Beijing, China). Additionally, the concentrations of cytokinin (CK), brassinosteroids (BR), gibberellic acid (GA), and jasmonic acid (JA) in the aerial parts of both wild-type and transgenic Arabidopsis were assessed. Quantification was performed using a test kit with detailed experimental procedures (Jingmei Biological Technology, Yancheng China).

2.6. Determination of Cadmium Content

Cd accumulation in the roots and shoots of both the OE2 and the WT was determined. It is crucial to note that the plants should be thoroughly washed to eliminate any external Cd that may impact the determination results. The cleaned and collected plant samples are then subjected to a 7-day drying period in an oven to ensure the complete removal of any moisture. Subsequently, the thoroughly dried plants are finely ground into a powder. Finally, the content measurements are conducted using ICP-MS, following the specific procedural steps outlined in the published paper [36].

2.7. RNA-Seq Analysis

We subjected both the WT and transgenic Arabidopsis to treatments with 0 mM CdCl2 and 2.5 mM CdCl2. Subsequently, the aboveground portions were selected for transcriptome sequencing. Then, RNA was extracted from plant tissues using the EASY spin Plant RNA extraction kit (Aidlab, Beijing, China). The purity of the extracted RNA, as determined by OD260/280 and OD260/230 ratios, was assessed using the Nanodrop (2000) spectrophotometer (Thermo Scientific, Waltham, MA, USA). Following this, RNA integrity and the presence of DNA contamination were evaluated through 1.5% agarose gel electrophoresis (PAGE). To minimize the potential impacts of RNA structural variations on sequencing results, the Agilent 2100 biological analyzer software (Santa Clara, CA, USA) was utilized for precise RNA integrity assessment. Following library construction, initial quantification was conducted using Qubit 3.0 software. The Illumina NovaSeq 6000 sequencer (San Diego, CA, USA), renowned for its advanced sequencing technology, was then employed for transcriptome sequencing after a comprehensive library inspection. Real-time quantitative PCR (RT-qPCR) was subsequently employed to validate the accuracy of the transcriptome data.

2.8. Statistical Analysis

Regression analysis was conducted using SPSS V25, which is appropriate for evaluating variance among groups. Each treatment group and the data presented in the article were subjected to the experiment three times.

2.9. Primers

All the primers used in this study are listed in Table A1.

3. Results

3.1. AetPGL Conserved Motif and Phylogenetic Analysis

The PGL protein is conserved among these 15 proteins, and sequence alignment reveals that AetPGL shares the same protein domain as PGL in other plants (Figure 1a). To gain a deeper insight into the phylogenetic relationships among these 15 proteins, a phylogenetic analysis of protein sequences was conducted using MEGA7.0 software. The evolutionary analysis indicates that the PGL protein of Ae. tauschii is most closely related to the PGL protein in wheat (Figure 1b).

3.2. Cd-Induced AetPGL Expression

RT-qPCR results showed that under normal conditions (0 mM Cd), AetPGL was not expressed in roots and shoots. However, after applying 2.5 mM Cd stress, significant expression occurred in roots and shoots, mRNA levels were significantly increased, and the mRNA level in shoots was higher than that in roots. The results showed that AetPGL was a key gene in response to Cd stress, and its expression was upregulated under Cd stress (Figure 2a).

3.3. Overexpression of AetPGL Enhanced the Tolerance of Arabidopsis to Cd

We generated 11 transgenic lines using the inflorescence infection method. The expression levels of these 11 lines were assessed through fluorescence quantitative RT-qPCR, and three overexpression lines (OE2, OE4, and OE6) exhibiting the highest expression levels were chosen for subsequent experiments (Figure 2b). Under normal medium conditions (1/2 MS), there were no significant differences in root length and germination rate between the WT and overexpression lines. However, in 1/2 MS medium containing 100 μM and 150 μM Cd, the root growth and seed germination of the WT were severely inhibited. The roots were significantly shorter compared to the transgenic lines, and the germination rate was markedly lower (Figure 3a,b). Consequently, we quantified the root length and germination rate (Figure 4a,b). Under normal conditions, the growth patterns of both WT and transgenic lines remained consistent. However, after 7 days of treatment with 2.5 mM Cd, the growth of the WT was inhibited, and the leaves exhibited a significantly higher degree of yellowing compared to the overexpression lines. This suggests that overexpression of AetPGL enhances Cd tolerance in transgenic Arabidopsis (Figure 3c).

3.4. Overexpression of AetPGL Enhanced the Antioxidant Capacity of Transgenic Arabidopsis

We measured the physiological indices of the roots and shoots in both the WT and overexpression lines. The contents of Pro and MDA can serve as indicators to validate plant damage under stressful conditions. In this study, following Cd stress, the MDA content in the WT significantly exceeded that of the transgenic lines (Figure 5a and Figure 6a). Conversely, the Pro content was noticeably lower in the WT compared to the transgenic lines (Figure 5b and Figure 6b), suggesting more severe damage to the cells of WT plants. Furthermore, Cd stress increased the activities of antioxidant enzymes (CAT, APX, SOD, and POD) in the overexpression lines (Figure 5c,d and Figure 6c,d). These results indicated that the overexpression of the AetPGL gene in A. thaliana increased antioxidant capacity and enhanced tolerance to Cd.

3.5. AetPGL Increased Cadmium Uptake by Regulating the Expression of Heavy Metal Transporters in Roots

We measured the Cd content in OE2 and WT plants after treatment. While there was no difference in the roots, the Cd content in the shoots of the overexpression lines was significantly higher than in the wild type (Figure 7a). The results indicate that overexpression of the AetPGL gene enhances Cd accumulation in the aerial parts. The increased expression levels of the ZIP, IRT, YSL, HMA, and NRAMP genes led to an increase in Cd content in the plants, as their high expression enhances Cd uptake and transport capacity [37]. Therefore, we measured the transcript levels of HM transporter-related genes in OE and WT plants. Before and after Cd treatment, the expression level of AtYSL1 in the roots showed no change in either WT or OE plants, but its expression in the shoots of OE plants significantly increased after treatment (Figure 7d,h). Compared to WT, after treatment with 2.5 mM Cd, the transcript levels of AtHMA3, AtZIP1, and AtNRAMP5 were significantly upregulated in the roots of OE2 (Figure 7e–g) and the transcript level of AtHMA3 in the shoots was significantly increased, while the other two genes did not show significant changes (Figure 7i). These results suggest that AetPGL increases Cd content in the aerial parts by upregulating the genes for root transporters in the overexpression lines.

3.6. AetPGL Promotes Phytohormone Synthesis in Aboveground Parts

To further understand the effect of the AetPGL gene on A. thaliana, we performed transcriptome sequencing and analyzed its regulatory network. A total of 691 DEGs were identified in the Cd-treated WT and transgenic lines (CdOE2 vs. CdWT) (Figure 8a). The results showed that the AetPGL gene affected the transcription of transgenic Arabidopsis after Cd stress. We conducted Gene Ontology (GO) enrichment analysis on the transcriptome data to categorize the biological functions of DEGs identified in CdOE2 and CdWT. We found that these DEGs were mainly enriched in the cellular anatomical entity, cellular processes, binding, and responses to stimulus (Figure 8b). Most of these biological processes are related to cell molecular activity and response to stress. In the KEGG pathway, DEGs are mainly enriched in metabolic pathways, biosynthesis of secondary metabolites, and glutathione and plant hormone signal transduction pathways (Figure 8c).
Notably, we observed significant changes in the expression levels of key genes involved in plant hormone signal transduction (Table A2). Subsequently, we analyzed this pathway and identified two, one, two, and four genes that were significantly upregulated in the synthesis pathways of brassinosteroids, gibberellin acid, jasmonic acid, and cytokinin, respectively (Figure 8d). We selected eight hormone-related genes for RT-qPCR verification, and also verified the consistency of the transcriptome data (Figure 9). Following this, we determined the contents of CK, GA, BR, and JA in both WT and transgenic plants. Prior to Cd treatment, there were no differences in hormone content between the WT and OE lines. However, after treatment with 2.5 mM Cd, the BR, GA, and JA in both WT and OE2 lines exhibited an increasing trend, and significant differences were observed, although CK showed no difference (Figure 10a–d). Under Cd stress, all hormone levels significantly increased in both WT and transgenic plants. Importantly, the levels of GA, JA, and BR in transgenic plants were significantly higher than in the WT. These results indicate that AetPGL may enhance the Cd tolerance of transgenic Arabidopsis by regulating these plant hormones.

4. Discussion

PGL, as one of the key enzymes in the OPPP pathway, serves as a crucial source of NADPH in plant organisms, maintaining the balance of NADPH within the plant. Current research indicates that NADPH is considered the most important molecule determining the potential antioxidant capacity of cells. When plants undergo oxidative stress, more NADPH is required to maintain normal redox status [38]. ROS is a metabolite that plays a crucial role in regulating plant growth and development. It is considered to be a significant mediator involved in plant signal transduction, contributing greatly to the growth and development of plants at various stages and their responses to various environmental stresses [39]. The levels of ROS are determined by a tightly controlled balance between production and decomposition, achieved through complex and highly intricate antioxidant systems. However, excessive ROS can have toxic effects on plants, leading to rapid cell death [40]. As the final product of membrane lipid peroxidation, the content of MDA will increase with the damage of membrane lipids, which also reflects the more serious cell damage. Pro can regulate the permeability of membrane lipids, prevent cells from being overoxidized, and reflect the antioxidant capacity of plants [41,42]. Plants have developed a unique antioxidant system under stress conditions, and SOD, POD, APX, and CAT are considered crucial scavengers of ROS and integral components of plant antioxidant defenses [43]. In this study, WT plants experienced more severe peroxidation damage, while transgenic plants overexpressing AetPGL exhibited a stronger antioxidant capacity under Cd stress (Figure 5c–f and Figure 6c–f). In comparison to the WT, Cd stress was less toxic to transgenic plants, resulting in a significant reduction in MDA content (Figure 5a and Figure 6a). However, Pro levels increased significantly (Figure 5b and Figure 6b), indicating an enhanced response to oxidative stress in the transgenic plants.
The absorption of Cd from the soil and its transport within plants depend on the involvement of various transport proteins. Numerous studies have reported that multiple transporters, including IRT, ZIP, NRAMP, and HMA, participate in the uptake and transport of heavy metals, making them critical in heavy metal detoxification. In this study, it was found that the Cd content in the leaves of OE2 transgenic Arabidopsis was significantly higher than in the WT, with no significant difference in the roots, as shown in Figure 7a. Under Cd treatment, the Cd content in the stems of transgenic plants was more than 75.86% higher than in the WT, suggesting that AetPGL may enhance heavy metal resistance in Arabidopsis by regulating transporters to sequester Cd in vacuoles within the leaves. HMA, as a major transporter of heavy metals, plays a crucial role in plant heavy metal resistance. We observed that the expression level of AtHMA3 in both the aerial and root parts of OE lines was significantly higher than in the WT after Cd treatment. In Arabidopsis, AtHMA3 is primarily localized on the vacuolar membrane, where its main function is to transport Cd into vacuoles for sequestration, thereby reducing the toxic effects on other organelles. Overexpression of AtHMA3 has been shown to lead to the accumulation of more Cd in roots and stems [44]. In rice, OsHMA3 is a key determinant of heavy metal accumulation in grains, as it is highly expressed in roots and sequesters Cd into vacuoles [45]. In this study, we found that after treatment, the expression level of AtHMA3 in both the shoots and roots of OE lines was significantly elevated. This may be one of the reasons why the Cd content in the shoots was higher than in the WT. However, in the roots, although the expression level of AtHMA3 increased, the Cd content did not show a significant change compared to the WT. We speculate that this could be due to the combined effects of AtHMA3 with other metal transport proteins [46]. NRAMP5 primarily functions in the roots, and in this study, we observed that its expression level in the roots of OE lines was significantly increased after treatment. However, the specific function of AtNRAMP5 has not yet been fully studied. In rice, OsNRAMP5, a homolog of AtNRAMP5, is located on the plasma membrane and, when highly expressed in the roots, transports Cd and Mn into the stems, leading to increased Cd accumulation in the stems. Knockout lines of OsNRAMP5 showed lower levels of Mn and Cd in roots and stems compared to control lines, indicating a loss of the ability to uptake Mn and Cd [47]. IRT is another key transporter, and ectopic expression of AtIRT1 in Solanum nigrum enhanced antioxidant capacity and increased Cd accumulation by 19% compared to control groups [48]. The increased expression of IRT1 induced by soil iron availability promotes Cd accumulation and transport in dicotyledonous vegetables [49]. However, in this study, the OE lines did not show a significant increase in expression levels compared to the WT, suggesting that AetPGL may not regulate IRT proteins. In contrast, the suppression of BcIRT1 and BcZIP2 expression levels reduced Cd uptake in Brassica chinensis roots [50]. AtZIP1, as an important transporter, primarily transports divalent metal ions in plants and can move Cd from the root to the shoot. Studies have shown that increased ZIP1 expression promotes Cd accumulation and transport in both Arabidopsis and maize [51,52]. In this study, after Cd treatment, the expression level of AtZIP1 was upregulated in the roots of OE lines, but there was no significant change in the shoots, while the expression level in the WT showed no significant change before and after treatment. This indicates that the expression of AetPGL may lead to changes in ZIP1, enhancing the transport of Cd to the shoots. In this study, the expression of genes encoding heavy metal transporters in the roots of the transgenic lines was significantly higher than in the WT lines (Figure 7c–e), which enhanced the transport of Cd from roots to stems.
As endogenous substances, plant hormones play a crucial role in regulating plant growth and development, particularly at extremely low concentrations, with complex and intricate functions. Plant hormones, acting as signal transduction biomolecules, typically operate in small quantities, extensively regulating the physiological and biochemical mechanisms of plants. Moreover, they play a key role in resisting external stress [53,54]. Additionally, genes such as AtAHP4, AtARR11, AtRGL1, AtBES1, AtTCH4, AtTIFY7, AtTIFY10B, and AtJAZ3, all participating in hormone synthesis (including cytokinin, jasmonic acid, gibberellin, and brassinosteroids), were upregulated under Cd stress (Figure 9a–h).
Prior studies have indicated that the application of plant hormones on plant leaves can effectively alleviate toxicity and enhance plant tolerance to HMs. Furthermore, when plants are stressed by HMs, their endogenous plant hormones undergo immediate changes to cope with the toxic effects and mitigate damage [55,56]. Brassinosteroids are hormones capable of regulating the absorption of ions by plant cells, thereby significantly reducing the accumulation of heavy metals. Cd, even at lower concentrations, can induce harmful effects in plants by hindering chlorophyll biosynthesis and the expression of enzymes [57]. Researchers have discovered that another brassinosteroid, BR-epibrassinolide (EPL), reduces Cd-induced oxidative burst by upregulating the expression of antioxidant enzymes and various stresses signaling hormones, particularly in photosynthetic pigments and cotyledons [58]. GA not only promotes the normal growth and development of plants but also participates in the detoxification of heavy metals [59]. Protein and nitrogen content are key factors for stress resistance and adaptation. In a previous study on peas, 10 µM GA improved seed germination and stem elongation in chromium-stressed pea plants by increasing protein and nitrogen content [60]. Additionally, GA treatment of pepper plants can modulate their endogenous iron homeostasis mechanism, slowing down overall plant growth to protect, prevent, or adapt to cadmium stress [61]. In fava beans, JA alleviates the detrimental effects of Cd stress by enhancing antioxidant enzyme activity and reducing the deposition of Cd, hydrogen peroxide (H2O2), and MDA in plant tissues [62]. Additionally, the addition of JA to rapeseed plants reduces MDA concentration and Cd uptake in leaves, leading to increased tolerance to HM stress in rapeseed seedlings under Cd stress [63]. Moreover, it has been reported that the exogenous application of MeJA (1, 5, and 10 µM) can enhance the growth of peas under Cd stress [64]. Cytokinin is not only involved in cell division and plant morphogenesis but also plays a role in the stress response to HMs. After Cd stress, cytokinin signal transduction in A. thaliana is activated, and overexpression in roots results in the significant upregulation of genes related to cytokinin synthesis, including AtARR1, AtARR12, and AtAHK3, to cope with the damage caused by Cd stress [65]. Furthermore, the foliar application of CK and ABA substantially mitigates the toxic effects of cobalt (Co) in tomato seedlings by modulating the absorption, transport, and chelation of Co in plant tissues [66]. In the study, the contents of BR, GA, and JA were significantly different after treatment, and the content of OE2 was significantly higher than that of the WT (Figure 10a–c). The results showed that the AetPGL gene reduced the harm of Cd stress by regulating plant hormones.

5. Conclusions

In this study, the AetPGL gene was identified from Ae. tauschii and found to be responsive to Cd stress. The ectopic expression of AetPGL enhanced Cd tolerance by regulating the activities of antioxidant enzymes. Furthermore, it increased Cd accumulation in A. thaliana by influencing the expression of heavy metal transporters such as AtHMA3, AtNRAMP5, and AtIRT1 in the roots. Transcriptome analysis showed that DEGs were involved in plant hormone signal transduction pathways along with the increase in plant hormone levels (including BR, GA, JA, and CK) under Cd stress. These results are helpful to reveal the tolerance mechanism of plants to Cd and provide a theoretical basis for molecular breeding in crops with low Cd accumulation.

Author Contributions

Conceptualization, H.W. and Y.Z.; methodology, J.Y.; software, X.H.; validation, L.Z. and L.Y.; formal analysis, T.Z.; writing—original draft preparation, H.W.; writing—review and editing, X.D.; visualization, L.G. and B.Z.; supervision, Y.Z.; project administration, Y.Z.; funding acquisition, H.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant number 32260506 and the earmarked fund for GZMARS-Rapeseed.

Data Availability Statement

The RNA-seq reads are available under Bio Project PRJNA1065971 in the NCBISRA database.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Primers used in experiments.
Table A1. Primers used in experiments.
Gene NameForward PrimerReverse Primer
pBI121-AetPGLCGCGGATCCGCGATGGAGAGGGAAATGGCTGCCCAAGCTTGGGCTAGTACTCACGATGCTGCTGCT
AtACTINCTTAACCCAAAGGCCAACAGAGCAAGGTCAAGACGGAGGAT
qAetPGLTGGATTGGTCTAAATGGTACGAATTTGTCATCAGGCAG
qAtHMA3TGCTGCTCATAAGGCAAGCACTAGTCCAGTATCCGCGATCACT
qAtNRAMP5ACAGCCACGGTTCGAATTGCCGTGGGCATCCGACCA
qAtYSL1TGCGAAAGGATGTGGCAGCCGTTCCCGACAACGCATAAGAACCTCTTTGA
qAtIRT1TATCGCCAAATGGGCTTAACAAACCGATAGAGAATCGAGACG
qAtZIP1ATGTGTTGTGCCTCGAGTGATATCAACGGTAGACTCACGCC
qAtAHP4GCTCCAAGATGATGCAAACCCTCGTGCTGCTTCCCTTAAACT
qAtRGL1AAGACCGGGTAGAGAGGCATCGTTTGCCATCCAAGCAACA
qAtBES1CCGTTTTATGCGGTGTCTGCCGAGGTTGGCACCATAGAGG
qAtTCH4ATCACTTGGGGTGATGGTCGTCGTCCCATGTTGTTCCAGG
qAtTIFY7ATCATGTTATGCGCCGGGAAGGGTGTGTCCCTACACCTTG
qAtTIFY10BAAAAACCGCAGCACAAGAGCCTGAGCCAAGCTGGGTTAGT
qAtJAZ3AGTAGCACAAACGGACTCGGTCGTGACCCTTTCTTTGCGT
Table A2. DEGs involved in plant hormone biosynthesis and plant hormone signal transduction.
Table A2. DEGs involved in plant hormone biosynthesis and plant hormone signal transduction.
KEGGGeneIDGeneNameCdOE_1CdOE_2CdOE_3CdWT_1CdWT_2CdWT_3log2FC
CytokinineAT3G16360AHP410.025610.055916.16016.435011.36375.44290.6409
AT1G67710ARR111.41580.79911.33160.54460.31580.66601.2162
GibbenellinAT1G66350RGL17.79419.962214.52317.690211.24104.74970.4469
BrassinosteroidAT1G19350BES138.301322.016125.594615.742612.665319.87370.8314
AT5G57560TCH47.895150.0741179.467711.74276.529029.79522.3044
jasmonicacidAT1G70700TIFY7287.7421346.7738292.9672302.0224307.5035253.31080.1042
AT1G72450JAZ662.5468145.3204116.0356113.8443153.559075.0006−0.0801
AT1G74950TIFY10B71.2557181.2355115.7101110.3789127.303570.04560.2588
AT3G17860JAZ313.842623.741823.251217.658919.286212.51510.2987

References

  1. Alengebawy, A.; Abdelkhalek, S.T.; Qureshi, S.R.; Wang, M.Q. Heavy metals and pesticides toxicity in agricultural soil and plants: Ecological risks and human health implications. Toxics 2021, 9, 42. [Google Scholar] [CrossRef]
  2. DalCorso, G.; Manara, A.; Furini, A. An Overview of Heavy Metal Challenge in Plants: From Roots to Shoots. Metallomics 2013, 5, 1117. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, W.; Song, J.; Yue, S.; Duan, K.; Yang, H. MhMAPK4 from Malus hupehensis Rehd. decreases cell death in tobacco roots by controlling Cd2+ uptake. Ecotoxicol. Environ. Saf. 2019, 168, 230–240. [Google Scholar] [CrossRef] [PubMed]
  4. Ali, B.; Tao, Q.; Zhou, Y.; Gill, R.A.; Ali, S.; Rafiq, M.T.; Xu, L.; Zhou, W. 5-Aminolevolinic acid mitigates the cadmium-induced changes in Brassica napus as revealed by the biochemical and ultra-structural evaluation of roots. Ecotoxicol. Environ. Saf. 2013, 92, 271–280. [Google Scholar] [CrossRef]
  5. Tahir, I.; Alkheraije, K.A. A review of important heavy metals toxicity with special emphasis on nephrotoxicity and its management in cattle. Front. Vet. Sci. 2023, 10, 1149720. [Google Scholar] [CrossRef]
  6. Ahmed, T.; Noman, M.; Rizwan, M.; Ali, S.; Shahid, M.S.; Li, B. Recent progress on the heavy metals ameliorating potential of engineered nanomaterials in rice paddy: A comprehensive outlook on global food safety with nanotoxicitiy issues. Crit. Rev. Food Sci. Nutr. 2023, 63, 2672–2686. [Google Scholar] [CrossRef]
  7. Cang, L.; Xing, J.; Liu, C.; Wang, Y.; Zhou, D. Effects of different water management strategies on the stability of cadmium and copper immobilization by biochar in rice-wheat rotation system. Ecotoxicol. Environ. Saf. 2020, 202, 110887. [Google Scholar] [CrossRef] [PubMed]
  8. Lejay, L.; Wirth, J.; Pervent, M.; Cross, J.M.; Tillard, P.; Gojon, A. Oxidative pentose phosphate pathway-dependent sugar sensing as a mechanism for regulation of root ion transporters by photosynthesis. Plant Physiol. 2008, 146, 2036–2053. [Google Scholar] [CrossRef]
  9. Bussell, J.D.; Keech, O.; Fenske, R.; Smith, S.M. Requirement for the plastidial oxidative pentose phosphate pathway for nitrate assimilation in Arabidopsis. Plant J. 2013, 75, 578–591. [Google Scholar] [CrossRef] [PubMed]
  10. Leustek, T.; Martin, M.N.; Bick, J.A.; Davies, J.P. Pathways and regulation of sulfur metabolism revealed through molecular and genetic studies. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2000, 51, 141–165. [Google Scholar] [CrossRef]
  11. Liu, J.; Wang, X.; Hu, Y.; Hu, W.; Bi, Y. Glucose-6-phosphate dehydrogenase plays a pivotal role in tolerance to drought stress in soybean roots. Plant Cell Rep. 2013, 32, 415–429. [Google Scholar] [CrossRef]
  12. Wang, H.; Yang, L.; Li, Y.; Hou, J.; Huang, J.; Liang, W. Involvement of ABA- and H2O2-dependent cytosolic glucose-6-phosphate dehydrogenase in maintaining redox homeostasis in soybean roots under drought stress. Plant Physiol. Biochem. 2016, 107, 126–136. [Google Scholar] [CrossRef]
  13. Lin, Y.; Lin, S.; Guo, H.; Zhang, Z.; Chen, X. Functional analysis of PsG6PDH, a cytosolic glucose-6-phosphate dehydrogenase gene from Populus suaveolens, and its contribution to cold tolerance improvement in tobacco plants. Biotechnol. Lett. 2013, 35, 1509–1518. [Google Scholar] [CrossRef]
  14. Liu, Y.; Wu, R.; Wan, Q.; Xie, G.; Bi, Y. Glucose-6-phosphate dehydrogenase plays a pivotal role in nitric oxide-involved defense against oxidative stress under salt stress in red kidney bean roots. Plant Cell Physiol. 2007, 48, 511–522. [Google Scholar] [CrossRef]
  15. Li, J.; Chen, G.; Wang, X.; Zhang, Y.; Jia, H.; Bi, Y. Glucose-6-phosphate dehydrogenase-dependent hydrogen peroxide production is involved in the regulation of plasma membrane H+-ATPase and Na+/H+ antiporter protein in salt-stressed callus from Carex moorcroftii. Physiol. Plant 2011, 141, 239–250. [Google Scholar] [CrossRef] [PubMed]
  16. Tian, Y.; Peng, K.; Bao, Y.; Zhang, D.; Meng, J.; Wang, D.; Wang, X.; Cang, J. Glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase genes of winter wheat enhance the cold tolerance of transgenic Arabidopsis. Plant Physiol. Biochem. 2021, 161, 86–97. [Google Scholar] [CrossRef]
  17. Huang, J.; Zhang, H.; Wang, J.; Yang, J. Molecular cloning and characterization of rice 6-phosphogluconate dehydrogenase gene that is up-regulated by salt stress. Mol. Biol. Rep. 2003, 30, 223–227. [Google Scholar] [CrossRef] [PubMed]
  18. Hou, F.; Huang, J.; Yu, S.; Zhang, H. The 6-phosphogluconate dehydrogenase genes are responsive to abiotic stresses in rice. J. Integr. Plant Biol. 2007, 49, 655–663. [Google Scholar] [CrossRef]
  19. Li, C.; Li, K.; Zheng, M.; Liu, X.; Ding, X.; Gai, J.; Yang, S. Gm6PGDH1, a cytosolic 6-phosphogluconate dehydrogenase, enhanced tolerance to phosphate starvation by improving root system development and modifying the antioxidant system in soybean. Front. Plant Sci. 2021, 12, 704983. [Google Scholar] [CrossRef] [PubMed]
  20. Van Loon, L.C.; Van Strien, E.A. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–97. [Google Scholar] [CrossRef]
  21. Xiong, Y.; DeFraia, C.; Williams, D.; Zhang, X.; Mou, Z. Characterization of Arabidopsis 6-phosphogluconolactonase T-DNA insertion mutants reveals an essential role for the oxidative section of the plastidic pentose phosphate pathway in plant growth and development. Plant Cell Physiol. 2009, 50, 1277–1291. [Google Scholar] [CrossRef]
  22. Lansing, H.; Doering, L.; Fischer, K.; Baune, M.C.; Schaewen, A.V. Analysis of potential redundancy among Arabidopsis 6-phosphogluconolactonase isoforms in peroxisomes. J. Exp. Bot. 2020, 71, 823–836. [Google Scholar] [CrossRef] [PubMed]
  23. Peres, A.; Soares, J.S.; Tavares, R.G.; Righetto, G.; Zullo, M.; Mandava, N.B.; Menossi, M. Brassinosteroids, the sixth class of phytohormones: A molecular view from the discovery to hormonal interactions in plant development and stress adaptation. Int. J. Mol. Sci. 2019, 20, 331. [Google Scholar] [CrossRef] [PubMed]
  24. Saini, S.; Kaur, N.; Pati, P.K. Phytohormones: Key players in the modulation of heavy metal stress tolerance in plants. Ecotoxicol. Environ. Saf. 2021, 223, 112578. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, F.; Tan, H.; Huang, L.; Cai, C.; Ding, Y.; Bao, H.; Chen, Z.; Zhu, C. Application of exogenous salicylic acid reduces Cd toxicity and Cd accumulation in rice. Ecotoxicol. Environ. Saf. 2021, 207, 111198. [Google Scholar] [CrossRef]
  26. Srivastava, S.; Srivastava, A.K.; Suprasanna, P.; D’Souza, S.F. Identification and profiling of arsenic stress-induced microRNAs in Brassica juncea. J. Exp. Bot. 2013, 64, 303–315. [Google Scholar] [CrossRef] [PubMed]
  27. Kumari, S.; Nazir, F.; Maheshwari, C.; Kaur, H.; Gupta, R.; Siddique, K.; Khan, M. Plant hormones and secondary metabolites under environmental stresses: Enlightening defense molecules. Plant Physiol. Biochem. 2024, 206, 108238. [Google Scholar] [CrossRef] [PubMed]
  28. Guan, C.; Ji, J.; Li, X.; Jin, C.; Wang, G. LcMKK, a MAPK kinase from Lycium chinense, confers cadmium tolerance in transgenic tobacco by transcriptional upregulation of ethylene responsive transcription factor gene. J. Genet. 2016, 95, 875–885. [Google Scholar] [CrossRef]
  29. Tao, Q.; Jupa, R.; Dong, Q.; Yang, X.; Liu, Y.; Li, B.; Yuan, S.; Yin, J.; Xu, Q.; Li, T.; et al. Abscisic acid-mediated modifications in water transport continuum are involved in cadmium hyperaccumulation in Sedum alfredii. Chemosphere 2021, 268, 129339. [Google Scholar] [CrossRef] [PubMed]
  30. Luo, M.C.; Gu, Y.Q.; Puiu, D.; Wang, H.; Twardziok, S.O.; Deal, K.R.; Huo, N.; Zhu, T.; Wang, L.; Wang, Y.; et al. Genome sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature 2017, 551, 498–502. [Google Scholar] [CrossRef]
  31. Mahmoodi, S.; Aghaei, M.J.; Ahmadi, K.; Naghibi, A. Climate-change-driven shifts in Aegilops tauschii species distribution: Implications for food security and ecological conservation. Diversity 2024, 16, 241. [Google Scholar] [CrossRef]
  32. De Vries, S.; Hoge, H.; Bisseling, T. Isolation of Total and Polysomal RNA from Plant Tissues. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Verma, D.P.S., Eds.; Springer: Dordrecht, The Netherlands, 1989; pp. 323–335. ISBN 978-94-010-6918-2. [Google Scholar]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  34. Renu, K.; Chakraborty, R.; Myakala, H.; Koti, R.; Famurewa, A.C.; Madhyastha, H.; Vellingiri, B.; George, A.; Valsala, G.A. Molecular mechanism of heavy metals (Lead, Chromium, Arsenic, Mercury, Nickel and Cadmium)—Induced hepatotoxicity—A review. Chemosphere 2021, 271, 129735. [Google Scholar] [CrossRef] [PubMed]
  35. Gerhardt, K.E.; Gerwing, P.D.; Greenberg, B.M. Opinion: Taking phytoremediation from proven technology to accepted practice. Plant Sci. 2017, 256, 170–185. [Google Scholar] [CrossRef]
  36. Kamar, V.; Dagalp, R.; Tastekin, M. Determination of heavy metals in almonds and mistletoe as a parasite growing on the almond tree using ICP-OES or ICP-MS. Biol. Trace Elem. Res. 2018, 185, 226–235. [Google Scholar] [CrossRef]
  37. Komal, T.; Mustafa, M.; Ali, Z.; Kazi, A.G. Heavy Metal Uptake and Transport in Plants. In Heavy Metal Contamination of Soils; Sherameti, I., Varma, A., Eds.; Soil Biology; Springer International Publishing: Cham, Switzerland, 2015; Volume 44, pp. 181–194. ISBN 978-3-319-14525-9. [Google Scholar]
  38. Hurbain, J.; Thommen, Q.; Anquez, F.; Pfeuty, B. Quantitative modeling of pentose phosphate pathway response to oxidative stress reveals a cooperative regulatory strategy. Iscience 2022, 25, 104681. [Google Scholar] [CrossRef] [PubMed]
  39. Parveen, N.; Kandhol, N.; Sharma, S.; Singh, V.P.; Chauhan, D.K.; Ludwig-Muller, J.; Corpas, F.J.; Tripathi, D.K. Auxin crosstalk with reactive oxygen and nitrogen species in plant development and abiotic stress. Plant Cell Physiol. 2023, 63, 1814–1825. [Google Scholar] [CrossRef]
  40. Ahanger, M.A.; Siddique, K.; Ahmad, P. Understanding drought tolerance in plants. Physiol. Plant 2021, 172, 286–288. [Google Scholar] [CrossRef] [PubMed]
  41. Sedaghat, M.; Tahmasebi-Sarvestani, Z.; Emam, Y.; Mokhtassi-Bidgoli, A. Physiological and antioxidant responses of winter wheat cultivars to strigolactone and salicylic acid in drought. Plant Physiol. Biochem. 2017, 119, 59–69. [Google Scholar] [CrossRef] [PubMed]
  42. Shahzad, B.; Tanveer, M.; Che, Z.; Rehman, A.; Cheema, S.A.; Sharma, A.; Song, H.; Rehman, S.U.; Zhaorong, D. Role of 24-epibrassinolide (EBL) in mediating heavy metal and pesticide induced oxidative stress in plants: A review. Ecotoxicol. Environ. Saf. 2018, 147, 935–944. [Google Scholar] [CrossRef]
  43. Labidi, O.; Vives-Peris, V.; Gomez-Cadenas, A.; Perez-Clemente, R.M.; Sleimi, N. Assessing of growth, antioxidant enzymes, and phytohormone regulation in Cucurbita pepo under cadmium stress. Food Sci. Nutr. 2021, 9, 2021–2031. [Google Scholar] [CrossRef]
  44. Morel, M.; Crouzet, J.; Gravot, A.; Auroy, P.; Leonhardt, N.; Vavasseur, A.; Richaud, P. AtHMA3, a P1B-ATPase allowing Cd/Zn/Co/Pb vacuolar storage in Arabidopsis. Plant Physiol. 2009, 149, 894–904. [Google Scholar] [CrossRef] [PubMed]
  45. Yan, J.; Wang, P.; Wang, P.; Yang, M.; Lian, X.; Tang, Z.; Huang, C.F.; Salt, D.E.; Zhao, F.J. A loss-of-function allele of OsHMA3 associated with high cadmium accumulation in shoots and grain of Japonica rice cultivars. Plant Cell Environ. 2016, 39, 1941–1954. [Google Scholar] [CrossRef] [PubMed]
  46. Williams, L.E.; Mills, R.F. P1B-ATPases—An Ancient Family of Transition Metal Pumps with Diverse Functions in Plants. Trends Plant Sci. 2005, 10, 491–502. [Google Scholar] [CrossRef]
  47. Ishimaru, Y.; Takahashi, R.; Bashir, K.; Shimo, H.; Senoura, T.; Sugimoto, K.; Ono, K.; Yano, M.; Ishikawa, S.; Arao, T.; et al. Characterizing the role of rice NRAMP5 in Manganese, Iron and Cadmium Transport. Sci. Rep. 2012, 2, 286. [Google Scholar] [CrossRef] [PubMed]
  48. Ye, P.; Wang, M.; Zhang, T.; Liu, X.; Jiang, H.; Sun, Y.; Cheng, X.; Yan, Q. Enhanced cadmium accumulation and tolerance in transgenic hairy roots of Solanum nigrum L. expressing Iron-Regulated Transporter gene IRT1. Life 2020, 10, 324. [Google Scholar] [CrossRef]
  49. Xu, Z.R.; You, T.T.; Liu, W.Y.; Ye, K.; Zhao, F.J.; Wang, P. Mitigating cadmium accumulation in dicotyledonous vegetables by iron fertilizer through inhibiting Fe transporter IRT1-mediated Cd uptake. Chemosphere 2024, 346, 140559. [Google Scholar] [CrossRef] [PubMed]
  50. Wu, X.; Su, N.; Yue, X.; Fang, B.; Zou, J.; Chen, Y.; Shen, Z.; Cui, J. IRT1 and ZIP2 were involved in exogenous hydrogen-rich water-reduced cadmium accumulation in Brassica chinensis and Arabidopsis thaliana. J. Hazard. Mater. 2021, 407, 124599. [Google Scholar] [CrossRef]
  51. Meng, Y.; Huang, J.; Jing, H.; Wu, Q.; Shen, R.; Zhu, X. Exogenous abscisic acid alleviates Cd toxicity in Arabidopsis thaliana by inhibiting Cd uptake, translocation and accumulation, and promoting Cd chelation and efflux. Plant Sci. 2022, 325, 111464. [Google Scholar] [CrossRef]
  52. Shafiq, S.; Ali, A.; Sajjad, Y.; Zeb, Q.; Shahzad, M.; Khan, A.R.; Nazir, R.; Widemann, E. The interplay between toxic and essential metals for their uptake and translocation is likely governed by DNA methylation and histone deacetylation in maize. Int. J. Mol. Sci. 2020, 21, 6959. [Google Scholar] [CrossRef]
  53. Bucker-Neto, L.; Paiva, A.; Machado, R.D.; Arenhart, R.A.; Margis-Pinheiro, M. Interactions between plant hormones and heavy metals responses. Genet. Mol. Biol. 2017, 40, 373–386. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, Y.; Yang, C.; Liu, S.; Xie, Z.; Chang, H.; Wu, T. Phytohormones-Mediated Strategies for Mitigation of Heavy Metals Toxicity in Plants Focused on Sustainable Production. Plant Cell Rep. 2024, 43, 99. [Google Scholar] [CrossRef]
  55. Bilal, S.; Saad, J.S.; Shahid, M.; Asaf, S.; Khan, A.L.; Lubna; Al-Rawahi, A.; Lee, I.J.; Al-Harrasi, A. Novel insights into exogenous phytohormones: Central regulators in the modulation of physiological, biochemical, and molecular responses in rice under metal(loid) stress. Metabolites 2023, 13, 1036. [Google Scholar] [CrossRef]
  56. Dai, Z.; Guan, D.; Bundschuh, J.; Ma, L.Q. Roles of phytohormones in mitigating abiotic stress in plants induced by metal(loid)s As, Cd, Cr, Hg, and Pb. Crit. Rev. Environ. Sci. Technol. 2023, 53, 1310–1330. [Google Scholar] [CrossRef]
  57. Großkinsky, D.K.; Van Der Graaff, E.; Roitsch, T. Regulation of Abiotic and Biotic Stress Responses by Plant Hormones. In Plant Pathogen Resistance Biotechnology; Collinge, D.B., Ed.; Wiley: Hoboken, NJ, USA, 2016; pp. 131–154. ISBN 978-1-118-86776-1. [Google Scholar]
  58. Gong, Q.; Li, Z.H.; Wang, L.; Zhou, J.Y.; Kang, Q.; Niu, D.D. Gibberellic acid application on biomass, oxidative stress response, and photosynthesis in spinach (Spinacia oleracea L.) seedlings under copper stress. Environ. Sci. Pollut. Res. Int. 2021, 28, 53594–53604. [Google Scholar] [CrossRef] [PubMed]
  59. Javed, T.; Ali, M.M.; Shabbir, R.; Anwar, R.; Afzal, I.; Mauro, R.P. Alleviation of copper-induced stress in pea (Pisum sativum L.) through foliar application of gibberellic acid. Biology 2021, 10, 120. [Google Scholar] [CrossRef]
  60. Gangwar, S.; Singh, V.P.; Srivastava, P.K.; Maurya, J.N. Modification of chromium (VI) phytotoxicity by exogenous gibberellic acid application in Pisum sativum (L.) seedlings. Acta Physiol. Plant 2011, 33, 1385–1397. [Google Scholar] [CrossRef]
  61. Uzal, O.; Yasar, F. Effects of GA3 hormone treatments on ion uptake and growth of pepper plants under cadmium stress. Appl. Ecol. Environ. Res. 2017, 15, 1347–1357. [Google Scholar] [CrossRef]
  62. Ahmad, P.; Alyemeni, M.N.; Wijaya, L.; Alam, P.; Ahanger, M.A.; Alamri, S.A. Jasmonic acid alleviates negative impacts of cadmium stress by modifying osmolytes and antioxidants in faba bean (Vicia faba L.). Arch. Agron. Soil Sci. 2017, 63, 1889–1899. [Google Scholar] [CrossRef]
  63. Ali, E.; Hussain, N.; Shamsi, I.H.; Jabeen, Z.; Siddiqui, M.H.; Jiang, L.X. Role of jasmonic acid in improving tolerance of rapeseed (Brassica napus L.) to Cd toxicity. J. Zhejiang Univ. Sci. B 2018, 19, 130–146. [Google Scholar] [CrossRef]
  64. Manzoor, H.; Mehwish; Bukhat, S.; Rasul, S.; Rehmani, M.; Noreen, S.; Athar, H.U.; Zafar, Z.U.; Skalicky, M.; Soufan, W.; et al. Methyl jasmonate alleviated the adverse effects of cadmium stress in pea (Pisum sativum L.): A nexus of photosystem II activity and dynamics of redox balance. Front. Plant Sci. 2022, 13, 860664. [Google Scholar] [CrossRef] [PubMed]
  65. Bruno, L.; Pacenza, M.; Forgione, I.; Lamerton, L.R.; Greco, M.; Chiappetta, A.; Bitonti, M.B. In Arabidopsis thaliana cadmium impact on the growth of primary root by altering SCR expression and auxin-cytokinin cross-talk. Front. Plant Sci. 2017, 8, 1323. [Google Scholar] [CrossRef] [PubMed]
  66. Kamran, M.; Danish, M.; Saleem, M.H.; Malik, Z.; Parveen, A.; Abbasi, G.H.; Jamil, M.; Ali, S.; Afzal, S.; Riaz, M.; et al. Application of abscisic acid and 6-benzylaminopurine modulated morpho-physiological and antioxidative defense responses of tomato (Solanum lycopersicum L.) by minimizing cobalt uptake. Chemosphere 2021, 263, 128169. [Google Scholar] [CrossRef] [PubMed]
Plants 13 02370 g001
Figure 1. Evolutionary relationships (a) and sequence analysis (b) between relevant PGL proteins.
Figure 1. Evolutionary relationships (a) and sequence analysis (b) between relevant PGL proteins.
Plants 13 02370 g001
Plants 13 02370 g002
Figure 2. Expression patterns of the AetPGL gene. (a) Relative expression of AetPGL under Cd stress in Aegilops tauschii. (b) Relative expression of AetPGL in wild-type (WT) and transgenic Arabidopsis overexpressing the AetPGL gene. Different colors represent different overexpression lines. Different letters indicate a statistically significant difference at p < 0.05.
Figure 2. Expression patterns of the AetPGL gene. (a) Relative expression of AetPGL under Cd stress in Aegilops tauschii. (b) Relative expression of AetPGL in wild-type (WT) and transgenic Arabidopsis overexpressing the AetPGL gene. Different colors represent different overexpression lines. Different letters indicate a statistically significant difference at p < 0.05.
Plants 13 02370 g002
Plants 13 02370 g003aPlants 13 02370 g003b
Figure 3. The growth state of Arabidopsis overexpressing the AetPGL gene and WT plants under Cd stress. (a,b) Root length and germination rate of transgenic Arabidopsis grown for 14 days on half-strength Murashige and Skoog (1/2 MS) medium with or without 100 µM and 150 µM Cd. Scale bar = 1.5 cm. (c) Stem morphology of wild-type and transgenic Arabidopsis treated with 0 or 2.5 mM Cd for 14 days. Scale bar = 5 cm.
Figure 3. The growth state of Arabidopsis overexpressing the AetPGL gene and WT plants under Cd stress. (a,b) Root length and germination rate of transgenic Arabidopsis grown for 14 days on half-strength Murashige and Skoog (1/2 MS) medium with or without 100 µM and 150 µM Cd. Scale bar = 1.5 cm. (c) Stem morphology of wild-type and transgenic Arabidopsis treated with 0 or 2.5 mM Cd for 14 days. Scale bar = 5 cm.
Plants 13 02370 g003aPlants 13 02370 g003b
Plants 13 02370 g004
Figure 4. The root length and germination rate of WT and transgenic Arabidopsis were cultured on half-strength mouse and Skoog (1/2 MS) medium without or with 100 µM and 150 µM Cd for 14 days. (a) Root lengths of WT and transgenic lines before and after treatment. (b) Germination rates of WT and transgenic lines before and after treatment. Different letters indicate a statistically significant difference at p < 0.05.
Figure 4. The root length and germination rate of WT and transgenic Arabidopsis were cultured on half-strength mouse and Skoog (1/2 MS) medium without or with 100 µM and 150 µM Cd for 14 days. (a) Root lengths of WT and transgenic lines before and after treatment. (b) Germination rates of WT and transgenic lines before and after treatment. Different letters indicate a statistically significant difference at p < 0.05.
Plants 13 02370 g004
Plants 13 02370 g005
Figure 5. The physiological indices of the aboveground parts of WT and transgenic plants expressing AetPGL under control and Cd stress conditions. (a) Malondialdehyde (MDA) content. (b) Proline (Pro) content. (c) Catalase (CAT) activity. (d) Ascorbate peroxidase (APX) activity. (e) Superoxide dismutase (SOD) activity. (f) Peroxidase (POD) activity. Different letters indicate statistically significant differences at p < 0.05.
Figure 5. The physiological indices of the aboveground parts of WT and transgenic plants expressing AetPGL under control and Cd stress conditions. (a) Malondialdehyde (MDA) content. (b) Proline (Pro) content. (c) Catalase (CAT) activity. (d) Ascorbate peroxidase (APX) activity. (e) Superoxide dismutase (SOD) activity. (f) Peroxidase (POD) activity. Different letters indicate statistically significant differences at p < 0.05.
Plants 13 02370 g005
Plants 13 02370 g006
Figure 6. The physiological indexes of the underground part of WT and transgenic plants expressing AetPGL under control and Cd stress conditions. (a) Malondialdehyde (MDA) content. (b) Proline (Pro) content. (c) Catalase (CAT) activity. (d) Ascorbate peroxidase (APX) activity. (e) Superoxide dismutase (SOD) activity. (f) Peroxidase (POD) activity. Different letters indicate a statistically significant difference at p < 0.05.
Figure 6. The physiological indexes of the underground part of WT and transgenic plants expressing AetPGL under control and Cd stress conditions. (a) Malondialdehyde (MDA) content. (b) Proline (Pro) content. (c) Catalase (CAT) activity. (d) Ascorbate peroxidase (APX) activity. (e) Superoxide dismutase (SOD) activity. (f) Peroxidase (POD) activity. Different letters indicate a statistically significant difference at p < 0.05.
Plants 13 02370 g006
Plants 13 02370 g007
Figure 7. (a) Cd concentration in the roots and shoots of WT and transgenic Arabidopsis plants overexpressing AetPGL (OE2) after a 14-day treatment with 2.5 mM Cd. (b) Expression level of AtNRAMP5 in the root, (c) expression level of AtIRT1 in the shoot, (d–g) expression levels in the root for AtHMA3, AtYSL1, AtZIP1, and AtNRAMP5. (h–k) The expression levels in the shoot for AtHMA3, AtYSL1, AtZIP1, and AtNRAMP5. Different letters indicate statistically significant differences at p < 0.05.
Figure 7. (a) Cd concentration in the roots and shoots of WT and transgenic Arabidopsis plants overexpressing AetPGL (OE2) after a 14-day treatment with 2.5 mM Cd. (b) Expression level of AtNRAMP5 in the root, (c) expression level of AtIRT1 in the shoot, (d–g) expression levels in the root for AtHMA3, AtYSL1, AtZIP1, and AtNRAMP5. (h–k) The expression levels in the shoot for AtHMA3, AtYSL1, AtZIP1, and AtNRAMP5. Different letters indicate statistically significant differences at p < 0.05.
Plants 13 02370 g007
Plants 13 02370 g008aPlants 13 02370 g008b
Figure 8. Transcriptome analysis of DEGs in the shoots of WT and OE2 plants overexpressing AetPGL under Cd stress. (a) Number of DEGs. (b) Gene Ontology (GO) classification of DEGs. (c) KEGG pathway enrichment of DEGs. (d) Expression of DEGs in the plant hormone signal transduction pathway.
Figure 8. Transcriptome analysis of DEGs in the shoots of WT and OE2 plants overexpressing AetPGL under Cd stress. (a) Number of DEGs. (b) Gene Ontology (GO) classification of DEGs. (c) KEGG pathway enrichment of DEGs. (d) Expression of DEGs in the plant hormone signal transduction pathway.
Plants 13 02370 g008aPlants 13 02370 g008b
Plants 13 02370 g009
Figure 9. The expression of related key genes in the plant hormone pathway. (a) AtAHP, (b) AtARR11, (c) AtRGL1, (d) AtBES1, (e) AtTCH4, (f) AtTIFY7, (g) AtTIFY10B, (h) AtJAZ3. Different letters indicate a statistically significant difference at p < 0.05.
Figure 9. The expression of related key genes in the plant hormone pathway. (a) AtAHP, (b) AtARR11, (c) AtRGL1, (d) AtBES1, (e) AtTCH4, (f) AtTIFY7, (g) AtTIFY10B, (h) AtJAZ3. Different letters indicate a statistically significant difference at p < 0.05.
Plants 13 02370 g009
Plants 13 02370 g010
Figure 10. Plant hormone content of WT and OE2 plants before and after treatment. (a) Brassinosteriods (BR) content. (b) Gibbenellin acid (GA) content. (c) Jasmonic acid (JA) content. (d) Cytokinine (CK) content. Different letters indicate a statistically significant difference at p < 0.05.
Figure 10. Plant hormone content of WT and OE2 plants before and after treatment. (a) Brassinosteriods (BR) content. (b) Gibbenellin acid (GA) content. (c) Jasmonic acid (JA) content. (d) Cytokinine (CK) content. Different letters indicate a statistically significant difference at p < 0.05.
Plants 13 02370 g010
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, J.; Hu, X.; Zhou, L.; Ye, L.; Zeng, T.; Du, X.; Gu, L.; Zhu, B.; Zhang, Y.; Wang, H. Ectopic Expression of AetPGL from Aegilops tauschii Enhances Cadmium Tolerance and Accumulation Capacity in Arabidopsis thaliana. Plants 2024, 13, 2370. https://doi.org/10.3390/plants13172370

AMA Style

Yu J, Hu X, Zhou L, Ye L, Zeng T, Du X, Gu L, Zhu B, Zhang Y, Wang H. Ectopic Expression of AetPGL from Aegilops tauschii Enhances Cadmium Tolerance and Accumulation Capacity in Arabidopsis thaliana. Plants. 2024; 13(17):2370. https://doi.org/10.3390/plants13172370

Chicago/Turabian Style

Yu, Junxing, Xiaopan Hu, Lizhou Zhou, Lvlan Ye, Tuo Zeng, Xuye Du, Lei Gu, Bin Zhu, Yingying Zhang, and Hongcheng Wang. 2024. "Ectopic Expression of AetPGL from Aegilops tauschii Enhances Cadmium Tolerance and Accumulation Capacity in Arabidopsis thaliana" Plants 13, no. 17: 2370. https://doi.org/10.3390/plants13172370

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop