Next Article in Journal
Contrasting Retromer with a Newly Described Retriever in Arabidopsis thaliana
Previous Article in Journal
Variation in Root-Associated Microbial Communities among Three Different Plant Species in Natural Desert Ecosystem
Previous Article in Special Issue
Cytological and Molecular Characterization of a New Ogura Cytoplasmic Male Sterility Restorer of Brassica napus L.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 17
10.3390/plants13172469
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity of Promising Spring Wheat Accessions from Russia and Kazakhstan for Rust Resistance

by
Elena Gultyaeva
1,*,
Ekaterina Shaydayuk
1,
Ekaterina Shreyder
2,
Igor Kushnirenko
2 and
Vladimir Shamanin
3
1
All Russian Institute of Plant Protection, Shosse Podbelskogo 3, 196608 St. Petersburg, Russia
2
Chelyabinsk Scientific Research Institute of Agriculture, 456404 Timiryazevskiy, Russia
3
Department of Agrotechnology, Omsk State Agrarian University, 644008 Omsk, Russia
*
Author to whom correspondence should be addressed.
Plants 2024, 13(17), 2469; https://doi.org/10.3390/plants13172469
Submission received: 18 August 2024 / Revised: 31 August 2024 / Accepted: 3 September 2024 / Published: 4 September 2024
(This article belongs to the Special Issue Genetic Resources of Cereal and Oilseed Crops for Sustainable Breeding and Food Security II)
Browse Figure
Versions Notes

Abstract

:
Spring bread wheat (Triticum aestivum) is a major crop in Russia and in Kazakhstan. The rust pathogens, leaf rust caused by the fungus Puccinia triticina, stem rust incited by P. graminis and yellow rust caused by P. striiformis, are the significant biotic factors affecting wheat production. In this study, 40 new promising spring wheat genotypes from the Kazakhstan-Siberia Network for Spring Wheat Improvement (KASIB) were tested for resistance to leaf, stem and yellow rust at the seedling stage, and for identification of rust resistance genes using molecular markers. In addition, the collection was tested for leaf rust resistance and grain yields in the South Urals agroclimatic zone of Russia in 2023. As a result, 16 accessions with seedling resistance to leaf rust, 21 to stem rust and 4 to yellow rust were identified. Three breeding accessions were resistant to all rust species, and nine to P. triticina and P. graminis. Wheat accessions resistant to leaf rust at the seedling stage were also resistant in the field. Molecular analysis showed the presence of cataloged resistance genes, Lr1, Lr3a, Lr9, Lr10, Lr19, Lr20, Lr24, Lr26, Sr15, Sr24, Sr25, Sr31, Sr38, Yr9 and Yr18; uncatalogued genes Lr6Agi1 and Lr6Agi2 from Thinopyrum intermedium and LrAsp from Aegilops speltoides; and 1AL.1RS translocation. The current analysis showed an increase in leaf and stem rust resistance of new KASIB genotypes and their genetic diversity due to the inclusion of alien genetic material in breeding.

1. Introduction

Spring bread wheat (Triticum aestivum) is a major crop in Russia and Kazakhstan. In Russia, spring wheat is grown in the Volga region, Western Siberia and the Urals [1]. In Kazakhstan, it is predominant in the northern regions [2]. The rust pathogens, leaf rust (causal agent Puccinia triticina), stem rust (causal agent P. graminis) and yellow (stripe) rust (causal agent P. striiformis), are the significant biotic factors for wheat production. Long-distance dispersal capacity, rapid changes in virulence and climatic adaptability make wheat rusts the most important threat to wheat production worldwide [3]. Of the three rust species, P. triticina is the most widely spread pathogen and develops annually in spring wheat areas in Russia and Kazakhstan. For a long time, P. graminis was not widely distributed, but in recent years, its importance has increased [4,5]. In Western Siberia in 2016–2018, strong development of stem rust led to a 25–35% reduction in grain yields [5]. P. striiformis is not a common disease of spring wheat in Russia and Kazakhstan. Nevertheless, it has been observed in West Siberia since 2015 [6]. In Kazakhstan, the main zone of yellow rust distribution is in the southern and southeastern regions [7]. However, its high dispersal capacity may contribute to the introduction of this pathogen to the North Kazakhstan regions, and under favorable weather conditions, this may lead to the development of the disease. A range of effective fungicides are available, but host resistance remains the most ecologically sustainable method for rust control. For this reason, the determination and evaluation of the presence of wheat cultivars resistant to rust diseases is of great importance for breeding. The durability of resistance and genetic diversity of wheat genotypes are the most important features of the resistance for global wheat improvement programs. Therefore, it is important to identify resistance genes present in promising wheat lines and commercial cultivars, as they may share resistance genes even if their pedigrees are different. Knowledge of resistance genes can prevent the release of monogenic cultivars containing the same resistance genes [8,9].
In the late 1990s, the International Maize and Wheat Improvement Center (CIMMYT) began a collaborative research and breeding program with northern Kazakhstan and Western Siberia, and by 2000, it had evolved into the Kazakhstan-Siberia Network for Spring Wheat Improvement (KASIB). The breeding institutions that contributed material stretch from the Volga region to the Ural Mountains, Western and Eastern Siberia in Russia, and northern, central and southern parts of Kazakhstan [2]. This has enabled the evaluation of the grain yield, quality, disease resistance and other traits through cooperative multi-location trials using materials exchanged between leading research and breeding institutes in both countries. Shuttle breeding with CIMMYT was used to incorporate stem and leaf rust resistance while maintaining local adaptation, drought tolerance and grain quality. Two to four new and promising genotypes are supplied by participating organizations and tested over 2 years by all cooperators. This program is an exemplary mechanism for germplasm evaluation and disease monitoring [2]. Notably, the State Registers of Breeding Achievements have included many elite genotypes from the program for commercial production in Russia and Kazakhstan.
Along with field trials, the program involves seedling stage assessment in the greenhouse using pathotypes with established virulence attributes. Molecular markers are used to identify rust resistance genes. Being complementary and confirmatory, the effectiveness of screening seedlings and adult plants and the use of diagnostic markers has been greatly enhanced.
With leaf rust being an ongoing problem for the production of spring wheat in Russia and Kazakhstan up to the mid-2010s, research and breeding institutes gave priority to developing new resistant cultivars, as there was initially a low proportion of resistant material identified [2]. With time, some progress has been achieved and the dynamics of increasing resistant leaf rust genotypes in the KASIB network remains stable in 2020 [10,11,12]. Due to the increasing potential importance of other rust species, it is relevant to expand research on the resistance of KASIB material to other rust species and to assess their genetic diversity.
In zones of spring wheat production in Russia and Kazakhstan, genes with high effectiveness in response to leaf rust (Lr24, Lr28, Lr29, Lr39, Lr45, Lr47, Lr51, Lr6Agi1 Lr6Agi2 and LrAspLrAsp), stem rust (Sr24, Sr30 and Sr31) and yellow rust (Yr5, Yr10, Yr15 and Yr24) were described [13,14,15]. The Lr9 and Lr19 genes have lost their effectiveness as single genes in the regions where the cultivars having them are widely grown (Volga, Urals, Siberia and northern Kazakhstan). However, the combination of Lr9 and Lr19 genes and their combination with Lr26 appear to be effective [16]. Adult plant resistance genes Lr34, Lr37, Sr57 and Yr18 and seedling race-specific resistance genes Lr21, Sr38 and Yr17 are moderately effective in Russia and Kazakhstan [14,15,16]. Molecular markers have been created for most of these genes, which allows for the successful identification of these genes [17].
Successful wheat breeding for rust resistance requires continuous monitoring of the efficacy of resistance genes and the evaluation of the effect of new wheat cultivars on pathogen virulence. The diversity of P. triticina populations in the West Asian part of Russia and northern Kazakhstan in terms of virulence and microsatellite loci has previously been studied [18]. Leaf rust samples were collected from wheat accessions tested within KASIB in 2016 at different points in Russia and Kazakhstan. A high similarity of leaf rust populations in the West Asian part of Russia and northern Kazakhstan was found for both markers. This indicates the existence of a single population of P. triticina in this area. The frequent emergence and rapid spread of more virulent and aggressive rust pathotypes pose a serious threat to wheat in these countries as well as to neighboring countries. The application of the strategy of mosaic cultivar placement, taking into account the optimal areas occupied by genetically similar genotypes, will stabilize the phytosanitary situation for rust in these regions. In this respect, continuous screening of new cultivars and promising breeding material for rust resistance and identification of rust resistance genes are needed. The objective of the work presented here was to evaluate seedling resistance to leaf, stem and yellow rust in new KASIB genotypes, to identify the rust resistance genes using molecular markers and multi-pathogen tests and to explore the rust resistance diversity of these genotypes.

2. Results

2.1. Identification of Rust Resistance Genes Using Molecular Markers

Molecular markers were used for the identification of 21 Lr genes (Lr1, Lr3, Lr9, Lr10, Lr19, Lr20, Lr21, Lr24, Lr25, Lr26, Lr28, Lr29, Lr34, Lr35, Lr37, Lr41(39), Lr47, Lr51, LrAsp, Lr6Agi1 and Lr6Agi2), seven Sr genes (Sr15, Sr24, Sr25, Sr31, Sr38, Sr39 and Sr57), seven Yr genes (Yr5, Yr9, Yr10, Yr15, Yr17, Yr18 and Yr24) and 1AL.1RS translocation. The 1RS translocation carries the stem rust resistance gene SrR, but no known leaf and stripe resistance genes [19].
Leaf rust resistance genes Lr1, Lr3, Lr9, Lr10, Lr19, Lr20, Lr24, Lr26, LrAsp, Lr6Agi1, Lr6Agi2; stem rust resistance genes Sr15, Sr24, Sr25, Sr31, Sr57; yellow rust resistance genes Yr9 and Yr18 genes; and the 1AL.1RS translocation were detected in KASIB accessions (Table 1, Figure S1). The most frequent rust genes identified alone, or in combination, were Lr3 (17 accessions); Lr26, Sr31 and Yr9 (13 accessions); Lr10 (10 accessions); Lr1 (9 accessions); and Lr19 and Sr25 (7 accessions). The Lr9, Lr21 and LrAsp genes and the 1AL.1RS translocation were identified in two accessions, and the Lr20, Lr24, Lr34, Lr6Agi1, Lr6Agi2, Sr15, Sr24 and Sr57 genes in one of these. No identified rust resistance genes were detected in eight genotypes.

2.2. Seedling Resistance Test

Leaf rust: Seedling infection type data for 40 promising spring wheat accessions inoculated with four P. triticina pathotypes are given in Table 1. Three Kazakh (16%) and thirteen Russian (62%) accessions were resistant to all pathotypes. According to molecular assessment, 10 of these resistant genotypes have highly effective resistant genes Lr6Agi1, Lr6Agi2 and LrAsp and the effective combination of Lr19 (or Lr9) with Lr26.
The leaf rust isolates differed in their virulence to the Lr2a, Lr2b, Lr2c, Lr9, Lr15, Lr19 and Lr26 genes. A multi-pathogen test revealed the Lr26 gene in seven wheat accessions (Lutescens 54 190/09, PCIb12I453, 249-A-25, L-6/SM, KS 29/17y, Kasibovskaya 2 and Zagadka). These genotypes were resistant (reaction type R) to PtK1 and PtK2 isolates avirulent to Lr26 and susceptible to virulent PtK3 and PtK4 isolates. Gene Lr9 was postulated in Lutescens 34-16 and gene Lr19 in Lutescens 1535, which were susceptible to PtK2 and PtK1 isolates, respectively. Overall, the results of the phytopathological study were in agreement with the molecular marker data.
The multi-pathogen tests revealed the absence of the Lr2a, Lr2b, Lr2c and Lr15 genes in the studied wheat collection. P. triticina isolate PtK4 differed from other ones for avirulence to the Lr2a, Lr2b, Lr2c and Lr15 genes. Accessions resistant to PtK4 isolate and susceptible to the other isolates tested were not detected.
Stem rust: High (R) and moderate (MR) resistance types to stem rust were determined for 4 (21%) Kazakh and 17 (81%) Russian accessions (Table 1). Figure 1 illustrates the rust responses to PgK1 isolate (race TTKTF). Thirteen (62%) resistant genotypes have Sr25 and Sr31 as single genes or in combination according to the molecular study.
P. graminis isolates differed in virulence to the Sr9d, Sr9g, Sr17 and Sr30 genes. The multi-pathogen tests revealed the absence of these genes in the studied collection because reaction types in response to both P. graminis isolates (PgK1 and PgK2) were mostly similar (Table 1).
Yellow rust: The number of accessions resistant to yellow rust was significantly lower than that for stem rust and leaf rust. Only four Russian accessions had resistant reactions to all P. striiformis isolates (lines L-407/ChT, L-235/PT, L447 and Lutescens 1485). Using molecular markers, highly effective resistant genes Yr5, Yr10, Yr15 and Yr24 were not identified in these genotypes. Gene Yr18 was postulated for line L-407/ChT, gene Lr9 for line L447, and 1AL.1RS translocation with no known stripe rust resistance genes for line L-235/PT, but these genes on their own are not effective against yellow rust in Russia and Kazakhstan.
Yellow rust isolates differed in virulence to Yr1, Yr4, Yr7, Yr27, YrSD and YrND genes. Multi-pathogen testing did not reveal any of these Yr genes in the wheat accessions tested.
Overall, in the seedling resistance study, three lines resistant to all rust species (L447, L-407/ChT and Lutescens 1485) were identified. Genes Lr3, Lr10, Lr26, Lr6Agi1, Sr31 and Yr9 were postulated as present in line L447; genes Lr10, Lr34, Sr57 and Yr18 in line L-407/ChT; and the Lr6Agi2 gene in Lutescens 1485. Genes Lr6Agi1 and Lr6Agi2 can provide effective resistance to leaf, stem and yellow rust pathogens in lines L447 and Lutescens 1485. Rust resistance genes identified for line L-407/ChT could not provide a high degree of protection. Accordingly, it may have other genes whose markers were not used in this work. This line has a complex pedigree (Lutescens 148-97-16//FRTL/2*PIFED/5/Seri*3//RL6010/4*YR/3/Pastor/4) and was developed using CIMMYT material.
Nine accessions were resistant to leaf and stem rust. According to the molecular study, six of these genotypes (1616ae14, L373, Lutescens 1510, 205/12-5, 242/13-10 and 74/16-1) have the combination of the Lr19/Sr25 and Lr26/Sr31 genes. Genes Sr25 and Sr31 are highly effective against stem rust in both countries. Genes Lr26 and Lr19 have lost effectiveness when deployed alone, but they are still effective in combination. Gene LrAsp was postulated in cv. Pamyati Tynina and Erythrospermum 26464. This gene provides a high degree of resistance to leaf rust and moderate resistance to stem rust. None of the identified genes were found in cv. Kudesnitsa. This cultivar was bred using synthetic hexaploid wheats developed by CIMMYT (Lutescens 30-94/3/T.dicoccon pi94625/Ae.squarrosa (372)//3*Pastor) and probably has new Lr and Sr genes.

2.3. Rust Assessment in the Field

The accessions were field-tested in 2023 in the South Urals agroclimatic zone of Russia in experimental fields of Chelyabinsk Scientific Research Institute of Agriculture (Chebarkul’sk district 54.93° N, 60.74 E) under natural leaf rust infection. The leaf rust development varied in susceptible cultivars (St) from 10 to 50% (Table 2). Among the new KASIB accessions, the highest disease severity (40–50%) was detected in lines with ineffective genes Lr1, Lr3 and Lr10 as single genes or in combination (line 155-A-1 (Lr10), line 218/10 (Lr1 + Lr3), and lines 98-A-2 and 249-A-25 (Lr3 + Lr10)). With the exception of 249-A-25, all these lines were highly susceptible at the seedling stage. Lines with Lr26 as a single gene (Lutescens 54–190/09) or in combination with Lr3 (L-6/SM) or Lr1 (KS 39/08-7) had disease severity from 1 to 20%. Disease severity in Lutescens 1535 with Lr19 and Lr3 genes fluctuated from 1 to 5% with a moderate susceptible reaction type (IT 2–3 and X). Lines with the Lr9 gene and the 1Al.1RS translocation had a disease severity of 1%. At the same time, cv. Tertsia with the gene Lr9 as a single gene was affected more (40–50%). Symptoms of leaf rust on wheat accessions with the Lr9 and Lr19 genes confirm the presence of isolates with virulence against the Lr9 and Lr19 genes in the regional P. triticina population.
Most KASB-24 accessions that were resistant to leaf rust at the seedling stage were free from rust infection in the field. Only one line, L1353 with the Lr1, Lr3 and Lr10 genes, was slightly affected in the field (1%) with the moderate resistance type (IT 1–2) (Table 2).
The development of stem rust in 2023 did not allow an evaluation of the resistance of the accessions tested. Only one line, PCIb12II189, was strongly affected (30%). But this line was moderately resistant to two P. graminis isolates at the seedling stage. Limited development of stem rust on single plants (disease severity 5%) was found in line L-235/PT, which was segregated for resistance in the seedling test. Of the four susceptible standards, stem rust was only detected in cv. Pamyati Azieva (1%).
The agronomic performance of 1000-grain weight and grain yield of spring wheat germplasm in the South Urals are given in Table 2. Substantial yield variation was observed between accessions (from 5.01 to 2.06 t/ha). The highest grain yields were found for susceptible lines 98-A-2 and 249-A-25 with the Lr3 and Lr10 genes (5.01 and 4.55 t/ha). Closer to them in yield was the leaf- and stem-rust-resistant cv. Pamyati Tynina with the highly effective resistance gene LrASp (4.39 t/ha). However, line Erythrospermum 26,464 with a similar gene had a lower yield (3.48 t/ha). The grain yield for resistant lines with a combination of the Lr19 and Lr26 genes varied from 4.05 to 3.24 t/ha. Resistant lines with genes Lr6Agi1 and Lr6Agi2 had corresponding grain yields of 3.34 and 3.58 t/ha. Thus, substantial variation was seen for resistant accessions with alien rust genes.

3. Discussion

This study has screened the 40 new and promising spring wheat genotypes developed by seven Kazakh and eight Russian breeding programs for leaf, stem and yellow rust resistance. Overall, 40% of the germplasm tested had resistance to P. triticina, 52% to P. graminis and 10% to P. striiformis. Of these, three accessions (7.5%) were resistant to all rust species, and nine accessions (22%) to leaf and stem rust. The number of resistant genotypes was higher in the Russian collection.
The use of molecular markers enables the flow and the build-up of resistance in the wheat germplasm to be monitored and the determination of the underlying genetic diversity. In the material studied, leaf rust resistance genes Lr1, Lr3, Lr9, Lr10, Lr19, Lr20, Lr21, Lr24, Lr26, Lr34, Lr6Agi1, Lr2Agi2 and LrAsp alone or in various combinations were postulated. Of these genes, only Lr24, Lr6Agi1, Lr6Agi2 and LrAsp are highly effective against leaf rust as single genes in spring wheat growing areas in Russia and Kazakhstan. Highly effective seedling resistance genes Lr25, Lr28, Lr29, Lr39(41), Lr47 and Lr51 and the moderately effective adult plant resistance gene Lr37 were not detected in the new KASIB collection despite the fact that donors of these genes have been used in Russian and Kazakh spring wheat breeding [20].
The Lr24 gene had low distribution in Russian and Kazakh commercially grown spring wheat cultivars, but it is reported as widespread in wheat genotypes in the USA, Australia and Western Europe [21]. The Lr24 gene is always completely associated with Sr24, which is highly effective against stem rust in Russia and Kazakhstan [15]. In the present study, the Lr24 gene was detected in only one line, but it was segregated for resistance to leaf and stem rust. In previous studies of KASIB germplasm [2,11], the Lr24 gene was detected in Kazakh cv. Aina and Russian cvs. Lider 80 and Niva 55. Cv. Aina was included in the Kazakh State Breeding Register in 2018 [22]; cvs. Lider 80 and Niva 55 were included in the Russian State Register in 2020 and 2022, respectively [23].
Alien genes LrAsp, Lr6Agi1 and Lr6Agi2 were not included in the Catalogue of Gene Symbols for Wheat [24]. They were used in breeding programs only in Russia. Gene LrAsp was transferred from Aegilops speltoides. The donor of LrAsp gene is a cuckoo-type line developed in N.I. Vavilov All-Russian Institute of Plant Genetic Resources (Saint Petersburg). This line came from crosses and backcrosses with bread wheat of the complex resistant amphidiploid Triticum dicoccum × Ae. speltoides and is highly resistant to leaf rust and moderately resistant to stem rust. The Gc-gene expression leads to the elimination of gametes having the recessive gc allele in the heterozygous sporophyte tissues [25]. The first commercial cultivar Chelyaba 75 with gene LrAsp was developed by the Chelyabinsk Research Institute of Agriculture in 2012 [25]. Adonina et al. [26], using molecular cytology analysis by C-banding and fluorescence in situ hybridization, revealed that cv. Chelyaba 75 has a 2DS.2SL translocation from Ae. speltoides. None of the five catalogued Lr genes introduced from Ae. speltoides are localized in this chromosome (Lr28 in 4AL chromosome, Lr35 in 6BL, Lr47 in 7AS, Lr51 in 1BL and Lr66 in 3AS) [21,27,28,29,30,31,32].
In 2023, the new spring wheat cv. Odintcovskaya with LrAsp genes was included in the Russian State Register and recommended for commercial production [23]. In 2024, the first winter wheat cultivar SPbSU 300 with gene LrAsp was submitted for Russian State variety testing. This cultivar was developed by the National Grain Centre and named after P.P. Lukyanenko (Krasnodar). In the present study, two new accessions with LrAsp genes were detected, and they were highly resistant to leaf and moderately resistant to stem rust. One of them, Pamyati Tyunina, was also submitted for State variety testing.
Two groups of spring wheat cultivars that have the Th. intermedium (6Agi1 and 6Agi2) chromosome substitution are widely cultivated in Russia. Cvs. Belyanka, Favorit, Voevoda and Lebiedushka developed in the Federal Agrarian Scientific Centre of the South-East have substitution 6Agi1. Commercially grown cvs. Tulaikovskaya 5, Tulaikovskaya 10 and Tulaikovskaya 100 with the 6Agi2 substitution were produced in the N.M. Tulaikov Research Institute of Agriculture. Resistance genes located in 6Agi1 and 6Agi2 chromosomes and conferring resistance to rust are not identical [33]. In 2018–2020, Ivanova et al. [6] evaluated fungal disease resistance in bread wheat hybrid lines with chromosome 6Agi2 in Western Siberia. They found that chromosome 6Agi2 enables plants to retain immunity to the West Siberian population of leaf rust and to dominant races of stem rust. It also provides medium-resistant and medium-susceptible types of response to yellow rust [6]. In the present study, two lines carrying the Th. intermedium (6Agi) chromosome substitution were postulated as present. Line L447 had the Lr6Agi1 gene, and Lutescens 1485 had the Lr6Agi2 gene. Both these lines were highly resistant to three rust species.
Widespread production of cultivars with the Lr9 gene in the Russian Ural and Siberia regions and northern Kazakhstan in 1995–2010 led to the pathogen overcoming their resistance in these regions, but this gene is still effective in European Russian regions. The Lr19 gene lost effectiveness in 1990 in Volga regions and later in other Russian and Kazakh regions. Effective combinations of these genes with other effective and partially effective genes can significantly increase field resistance. A combination of gene Lr9 (or Lr19) and gene Lr26 is effective against Russian and Kazakh P. triticina populations. Isolates virulent to Lr9, Lr19 and Lr26, as single genes, have a high distribution in local populations. Previously, we did not know of isolates virulent to a combination of these genes (Lr9 + Lr26, Lr19 + Lr26 and Lr9 + Lr19), and this has enabled the continued effectiveness of these combinations [13]. However, in pathogen populations, there is widespread virulence to Lr19 (or Lr9) along with Lr1, Lr2a, Lr2b, Lr2c, Lr3a, Lr3bg, Lr3ka, Lr10, Lr14a, Lr14b, Lr15, Lr17, Lr18, Lr20 and Lr30 [13,18].
Commercial spring wheat cultivars with the Lr19 and Lr26 genes (Omskaya 37, Omskaya 38, Omskaya 44) and the Lr9 and Lr26 genes (Chelyabinka, Silach) have been grown widely in West Siberia and the Urals [23] since 2010 and remain resistant to leaf rust. In the present study, six lines from three geographically separated Russian breeding centers (Samara, Saratov and Omsk) with the combination of the Lr19 and Lr26 genes were postulated. Thus, progress has now been made in developing wheat cultivars with a combination of these genes. The Sr31 and Sr25 genes, tightly linked with the Lr26 and Lr19 genes, are highly effective in response to stem rust in both countries. All lines with these genes were mostly susceptible to yellow rust at the seedling stage.
The Lr21 gene was introduced to common wheat from Ae. tauschii [21] and until 2020 was not postulated as present in Russian and Kazakh commercial cultivars. Initially, it was tested in spring wheat cv. Silantiy studied in KASIB in 2019–2020 and included in the Russian State Register in 2022. In the pedigree of this cultivar, there is synthetic hexaploid wheat with genetic material of Ae. tauschii from SIMMYT wheat programs. In the present study, two lines with the Lr21 gene were detected (201m/22 and L373). Line L373 developed by the Federal Agrarian Scientific Centre of the South-East (Russia) had a complex of rust genes, Lr3, Lr10, Lr19, Lr21, Lr26, Sr25, Sr31 and Yr9, and was resistant to all isolates of P. triticina and P. graminis and to four of five isolates of P. striiformis. The source of the Lr21 gene for this line is also the synthetic amphidiploid from SIMMYT (L505/3/Croc/Ae.squar(205)//Weaver/4/Л505/5/S68). At the same time, the Lr21 gene was not detected in cv. Kudesnitsa, which was developed using another accession of Ae. tauschii amphidiploid (Lutescens 30–94/3/T.dicoccon pi94625/Ae.squar(372)//3*Pastor). Kazakh line 201m/22 was developed using cvs. Stepnaya 18 and Tulaikovskaya 1 without the Lr21 gene. The used P. triticina isolates had moderately susceptible infection types on the Thatcher line with the Lr21 gene. Thus, the amplification of the marker in this strain may have been a false positive.
The Yr5, Yr10, Yr15 and Yr24 genes, which are highly effective against yellow rust in both countries, were not postulated as present in three accessions resistant to all used P. striiformis isolates. This suggests that they have new genes or efficient combinations of other genes.
The gene Yr9 has a high distribution in the studied KASIB-24 wheat collection. Most accessions with Yr9 were susceptible to yellow rust at the seedling stage. The Yr9 gene lost its effectiveness around the world, including in Russia and Kazakhstan [14,34,35]. Nevertheless, it can be used in combination with other seedling resistance or non-race-specific or partial Yr genes. This technique is becoming popular and most important for developing and improving the output of breeding to obtain broad-spectrum resistance capabilities.
All effective rust resistance genes in the new KASIB-24 germplasm are alien and have been transferred from wheatgrass, Aegilops and wild relatives. Chromosomal translocations in wheat derived from alien species are a valuable source of genetic diversity that have provided increases in resistance to various diseases and improved tolerance to abiotic stresses in wheat [36]. The chromosomal translocation involving 1RS rye (Secale cereale) and 1BL wheat (Triticum aestivum) has been one of the most widely used sources of alien genetic material in wheat cultivars around the world. It is also widely present in previous [2,11,12] and new KASIB collections. The short arm of the 1R chromosome carries the Lr26, Sr31, Yr9 and Pm8 genes and is associated with increased yield potential across a wide range of environments [37]. The second representation in the KASIB-24 collection was shown by accessions with Lr19/Sr25 genes transferred to wheat from Th. ponticum [2,11,12]. It has also been shown that this translocation was associated with increases in yield, final biomass and grain number [38]. In the present study, the grain yield of accessions with the 1BL.1RS and Lr19/Sr25 translocations, alone or in combination, varied greatly. A similar result was obtained for accessions with the LrAsp gene.
The moderately effective adult plant resistance genes Lr37, Sr38 and Yr17 were not postulated in this study. However, they have been identified in the previously studied KASIB collections [2,10,11,12]. These resistance genes have been incorporated into wheat cultivars in Northern Europe since the mid-1970s and have been widely used in CIMMYT breeding programs. The CIMMYT genotypes with the Lr37, Sr38 and Yr17 genes were the sources of these genes in previously studied KASIB accessions.
The locus with adult plant resistance genes Lr34, Sr67, Yr18 and Pm38 confers quantitative or partial resistance against multiple biotrophic pathogens. This is due to the pleiotropic effect of there being only one resistance gene. A similar effect was shown for loci with the Lr46, Sr58, Pm39, Yr29 genes and Lr67, Sr55, Yr46, Pm46 genes [18], but they were not used for KASIB breeding. In the presented molecular analysis, the Lr34, Sr67, Yr18 genes were detected only for one line. Remarkably, the role of Lr34 in leaf rust genetic protection in the KASIB germplasm was relatively weak in previous studies [2,10,11,12]. But these genes are most prevalent in Russian commercial winter wheat germplasm [16].
Multi-pathogen tests with an array of pathotypes differing in virulence genes are also widely used to determine genetic diversity for rust resistance. In this study, only Lr9, Lr19 and Lr26 as single resistance genes were determined in some accessions. Stem and yellow rust resistance genes have not been postulated. The diagnostic ability of this method was lower as most wheat accessions with a combination of resistance genes and no virulent isolates were identified in Russia and Kazakhstan. Molecular markers can detect target genes in germplasm collections in the absence of appropriate pathogen isolates.
Studies of KASIB genotypes in response to leaf rust using both methods have been conducted since 2015. In 2016–2019, 120 cultivars and breeding lines from the KASIB study in 2000–2016 with differing degrees of resistance to leaf rust were analyzed [2]. It was shown that the most frequent Lr genes identified in the KASIB germplasm alone or in combination were Lr1, Lr9, Lr10, Lr17, Lr19, Lr26 and Lr34. The Lr14a, Lr24, Lr37, Lr39 and LrAsp genes were identified in up to two genotypes each. An increasing diversity of Lr genes was found in the tested KASIB spring wheat accessions from 2019 to 2022. In addition to the above genes, the Lr3, Lr20, Lr21, Lr6Agi2 genes were identified [10,11,12]. The present study analyzed the resistance of new KASIB accessions to three rust species, and a large number of genotypes resistant to leaf and stem rust separately and in combination were identified. Most of these had either highly or partially effective single resistance genes or combinations of resistance genes that make it possible to maintain resistance levels over a long period of time. At the same time, global climate change and changes in the composition of pathogens in wheat growing areas require greater emphasis on advanced breeding, including breeding for resistance to yellow rust.

4. Materials and Methods

4.1. Plant Material

The study included 40 advanced spring wheat genotypes developed in seven Kazakhstan and eight Russian Wheat Breeding Centers and supplied for testing in KASIB trials in 2023–2024 (Table 3).

4.2. Identification of Lr, Sr and Yr Genes Using Molecular Markers

Molecular markers used for identification of Lr, Sr and Yr genes are presented in Table 4. DNA was extracted according to Dorokhov and Klocke [39]. PCRs were performed using a thermocycler (C1000, BioRad, Hercules, CA, USA). The PCR mixture (20 mL) contained 50–150 ng of genomic DNA, 2 units of Taq DNA polymerase, 1× PCR buffer, 2.5 mM of MgCl2, 100 µM of each dNTP and 10 pM of each primer. The recommended PCR protocol (Table 4) was used in amplifications. PCR products were separated on 1.5 to 3% agarose gels (depending on gene product size) and visualized under UV light using a digital gel imaging system (GelDocGo, BioRad, Hercules, CA, USA).

4.3. Seedling Tests

Leaf rust infection at the seedling stage was evaluated for four P. triticina isolates (Pt) with different virulence–avirulence combinations, stem rust infection for two P. graminis isolates (Pg), yellow rust for five P. striiformis isolates (Pst). Virulence–avirulence profiles of rust isolates at the seedling stage are presented in Table 5. Near isogenic Thatcher lines with Lr genes 1, 2a, 2b, 2c, 3a, 3bg, 3ka, 9, 10, 14a, 14b, 15, 16, 17, 18, 19, 20, 24, 26, 28, 29, 30, 47 and 51 were used for virulence characterization of P. triticina isolates. Near isogenic Marques lines with Sr genes 5, 6, 7b, 8a, 9a, 9b, 9g, 9e, 9d, 10, 11, 17, 21, 24, 24 + 31, 24 + 36, 25, 30, 31 were likewise used for P. graminis isolates, and near-isogenic Avocet lines with Yr genes 1, 5a, 6, 7, 8, 9 10, 15, 17, 24, 27 and 5b (YrSp = Spalding prolific) and differentials Heines VII (Yr2), Vilmorin 23 (Yr3), Hybrid 46 (Yr4), Nord Desprez (YrND), Strubes Dickkopf (YrSD) were used for P. striiformis isolates.
Based on the North American system of nomenclature [58] and additional sets describing the variation in Russia [13], P. triticina isolate PtK1 belonged to the TLT/TR race, isolate PtK2 to the TGT/TT race, isolate PtK3 to the THT/TR race and isolate PtK4 to the MHT/KH race. Avirulence/virulence was determined with the following differential sets: group I: Lr1, Lr2a, Lr2c and Lr3a; group II: Lr9, Lr16, Lr24 and Lr26; group III: Lr3ka, Lr11, Lr17 and Lr30; group IV: Lr2b, Lr3bg, Lr14a and Lr14b; and group V: Lr15, Lr18, Lr19 and Lr20. The designation of races for stem rust was performed using the following international differential sets: group I: Sr5, Sr21, Sr9e and Sr7b: group II: Sr9a11, Sr6, Sr8a and Sr9g; group III: Sr36, Sr9b, Sr30 and Sr17; group IV: Sr9a, Sr9d, Sr10 and SrTmp; and group IV: Sr24, Sr31, Sr38 and SrMcN [59]. Accordingly, isolate PgK1 was designated as race TTKTF and isolate PgK1 as race TSGPF, as no international race designation system has been proposed for the yellow rust pathogen.
For rust resistance assessments performed at the seedling stage, 8–10-day-old plants (with the primary leaves fully emerged) were used for inoculation by P. triticina and P. graminis, and 12–14-day-old plants (with emerged second leaf) for P. striiformis. Three to ten seeds of each genotype were planted in 10 cm diameter plastic pots in a disease-free area. Urediniospores of a single isolate were suspended in non-phytotoxic mineral oil Novec 7100 in a glass tube and connected to the airbrush spray gun. The plants inoculated by leaf and stem rust were incubated in a dark dew chamber at 20 °C for 24 h and then transferred to a growth chamber with a 16:8 h L/D photoperiod at a constant 20 °C. The plants inoculated by yellow rust were incubated in a dark dew chamber at 10 °C for 24 h and then transferred to a growth chamber (Environmental Test Chamber MLR-352H, Sanyo Electric Co., Ltd., Osaka, Japan) with 16:8 h L/D photoperiod at 16 and 10 °C, respectively [16].
Seedlings were assessed for their infection types according to Mains and Jackson [60] for leaf rust (10–12 d after inoculation), Stakman and Levin [61] for stem rust (12–14 d after inoculation), Gassner and Straib [62] for yellow rust (16–18 d after inoculation).

4.4. Disease Assessment in the Field

The accessions were field-tested in 2023 in the South Urals agroclimatic zone of Russia in experimental fields of Chelyabinsk Scientific Research Institute of Agriculture (Chebarkul’sk district, 54.93° N, 60.74° E). Spring wheat trials had 3-m2 plots each with three replicates. Rust reactions were evaluated under natural infection. Leaf and stem rust resistance of spring wheat accessions was evaluated using the modified Cobb scale [63]. The scoring was based both on disease severity (proportion of leaf area infected) and on the plant response to infection (reaction type). Plant responses were recorded as resistant (R), moderately resistant (MR), moderately susceptible (MS), and susceptible (S) reactions [64]. Cvs. Pamyati Azieva (Lr10), Tertsiya (Lr9), Omskaya 35 (Lr10) and Saratovskaya 29 (Lr10) were used as the susceptible controls (standards, St).
Weather conditions in 2023 were not favorable for rust development. Precipitation in the second ten days of May, given the good soil moisture reserves prior to sowing, favored early emergence despite the elevated air temperatures. Rainfall in June was in line with the annual average. July was unusually hot and dry: air temperature rose to 35–40 °C, soil temperature to 55–57 °C, rainfall was only 13.3 mm and there was a hydrothermal coefficient of 0.2. From 7 August, when the cultivars were close to ripening, the rain became prolonged. In the first and third 10 days of August, 115 and 101 mm of rain fell, giving a total of 218 mm for August, and there was a GTC of 4.2 with a norm of 1.2.
The first symptoms of leaf rust were noted in the phase of milk-wax ripeness, and stem rust in the phase of wax ripeness. The leaf rust development on the susceptible cultivars varied strongly (cv. Tertciya, 50%; cv. Saratovskaya, 40%; cv. Omskaya 35, 20%; and cv. Pamyati Azieva, 10%). The highest stem rust development (30%) was observed in line PCI b12I I189.
Additionally, the agronomic performance of 1000-grain weight and grain yield of spring wheat germplasm in Chelyabinsk (54°93 N, 60°74 E) in 2023 was determined. All entries were harvested, and yield components (1000-grain weight and yield) were evaluated following the methods of Pietragalla and Pask [65]. Statistical analysis was limited to ANOVA for yield components.

5. Conclusions

The new spring bread wheat collection from Kazakhstan-Siberia Network for Spring Wheat Improvement (KASIB-24) including 40 promising cultivars and breeding lines of Russian and Kazakh breeding (19 and 21, respectively) was characterized for resistance to three rust species. As a result, 16 breeding accessions with seedling resistance to leaf rust, 21 with resistance to stem rust and 4 with resistance to yellow rust were identified. Three breeding accessions were resistant to all rust species, and nine to P. triticina and P. graminis. The number of resistant genotypes was higher in the Russian collection. All wheat accessions highly resistant to leaf rust at the seedling stage were also resistant in the field in the South Urals agroclimatic zone of Russia in 2023.
High levels of diversity for rusts were found among accessions. Molecular analysis showed the presence of cataloged resistance genes Lr1, Lr3a, Lr9, Lr10, Lr19, Lr20, Lr24, Lr26, Sr15, Sr24, Sr25, Sr31, Sr38, Yr9 and Yr18; uncatalogued genes Lr6Agi1 and Lr6Agi2 from T. intermedium and LrAsp from Ae. speltoides; and 1AL.1RS translocation with the stem rust resistance gene SrR and no known leaf and yellow rust resistance genes.
The current rust resistance in KASIB spring wheat is effective, as resistance against various isolates has been introduced into promising genotypes. Breeding progress in rust resistance of KASIB genotypes can mostly be attributed to effective all-stage resistance genes alone or in effective combinations. The breeding strategies implemented for improved resistance have clearly been highly successful. Nevertheless, global climate change and changes in the composition of pathogens in wheat growing areas mean that ongoing work is needed to advance breeding, especially for resistance to yellow rust.
The diverse spring wheat accessions with rust resistance found in our study can be used in breeding programs for developing new wheat cultivars. The introduction of improved cultivars will prevent disease yield losses in Russia and in Kazakhstan, providing a direct contribution to yield increase.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants13172469/s1, Figure S1: Electrophoretogram for markers: (a) SCS265 (Lr19 and Sr25), (b) SCS5 (Lr9), (c) F1.2245/Lr10-6/r2 (Lr10), (d) Sr24≠50 (Lr24, Sr24), (e) SCM9 (Lr26, Sr31, Yr9 and 1AL.1RS), (f) STS638 (Lr20 and Sr15), (g) MF2/MR1r2 (Lr6Agi2), (i) S13-R16 (Lr66(Sp)), (k) Lr21F/R (Lr21), (l) WR003 F/R (Lr1).

Author Contributions

Conceptualization, E.G.; methodology, E.G., E.S. (Ekaterina Shaydayuk), E.S. (Ekaterina Shreyder) and I.K.; validation, E.G., E.S. (Ekaterina Shaydayuk), E.S. (Ekaterina Shreyder) and I.K., formal analysis, E.G.; investigation, E.S. (Ekaterina Shaydayuk), E.S. (Ekaterina Shreyder) and I.K.; data curation, E.G. and V.S.; writing—original draft preparation, E.G.; writing—review and editing, E.G.; project administration, E.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Russian Science Foundation, grant No. 23-26-00042.

Data Availability Statement

All data are provided in the manuscript.

Acknowledgments

The editorial support of Ian Riley is highly appreciated.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Afonin, A.N.; Greene, S.L.; Dzyubenko, N.I.; Frolov, A.N. (Eds.) Interactive Agricultural Ecological Atlas of Russia and Neighboring Countries. Economic Plants and Their Diseases, Pests and Weeds. 2008. Available online: http://www.agroatlas.ru (accessed on 12 August 2024). (In Russian).
  2. Morgounov, A.; Pozherukova, V.; Kolmer, J.; Gultyaeva, E.; Abugalieva, A.; Chudinov, V.; Kuzmin, O.; Rasheed, A.; Rsymbetov, A.; Shepelev, S.; et al. Genetic basis of spring wheat resistance to leaf rust (Puccinia triticina) in Kazakhstan and Russia. Euphytica 2020, 216, 170. [Google Scholar] [CrossRef]
  3. Ali, S.; Hodson, D. Wheat rust surveillance: Field disease scoring and sample collection for phenotyping and molecular genotyping. Methods Mol. Biol. 2017, 1659, 3–11. [Google Scholar] [CrossRef] [PubMed]
  4. Rsaliyev, A.S.; Rsaliyev, S.S. Principal approaches and achievements in studying race composition of wheat stem rust. Vavilov J. Genet. Breed. 2018, 22, 967–977. [Google Scholar] [CrossRef]
  5. Shamanin, V.P.; Pototskaya, I.V.; Shepelev, S.S.; Pozherukova, V.E.; Salina, E.A.; Skolotneva, E.S.; Hodson, D.; Hovmøller, M.; Patpour, M.; Morgounov, A.I. Stem rust in Western Siberia—Race composition and effective resistance genes. Vavilov J. Genet. Breed. 2020, 24, 131–138. [Google Scholar] [CrossRef]
  6. Ivanova, Y.N.; Rosenfread, K.K.; Stasyuk, A.I.; Skolotneva, E.S.; Silkova, O.G. Raise and characterization of a bread wheat hybrid line (Tulaykovskaya 10 × Saratovskaya 29) with chromosome 6Agi2 introgressed from Thinopyrum intermedium. Vavilov J. Genet. Breed. 2021, 25, 701–712. [Google Scholar] [CrossRef] [PubMed]
  7. Malysheva, A.A.; Kokhmetova, A.M.; Kumarbayeva, M.K.; Zhanuzak, D.K.; Bolatbekova, A.A.; Keishilov, Z.S.; Gultyaeva, E.I.; Kokhmetova, A.M.; Tsygankov, V.; Dutbayev, Y.B.; et al. Identification of carriers of Puccinia striiformis resistance genes in the population of recombinant inbred wheat lines. Int. J. Biol. Chem. 2022, 15, 4–10. [Google Scholar] [CrossRef]
  8. Dubekova, S.; Sarbaev, A.; Yessimbekova, M.; Morgounov, A.; Yesserkenov, A. Winter wheat resistance to yellow rust in Southeast Kazakhstan. SABRAO J. Breed. Genet. 2023, 55, 1910–1919. [Google Scholar] [CrossRef]
  9. Amil, R.E.; de Vallavieille Pope, C.; Leconte, M.; Nazari, K. Diversity of genes for resistance to stripe rust in wheat elite lines, commercial varieties and landraces from Lebanon and Syria. Phytopathol. Mediterr. 2019, 58, 607–627. [Google Scholar] [CrossRef]
  10. Rsaliyev, A.S.; Gultyaeva, E.I.; Shaydayuk, E.L.; Kovalenko, N.M.; Moldazhanova, R.A.; Pahratdinova, Z.U. Chracteristic of perspective common spring wheat accessions for resistance to foliar diseases. Plant Biotechnol. Breed. 2019, 2, 14–23. (In Russian) [Google Scholar] [CrossRef]
  11. Gultyaeva, E.L.; Shaydayuk, A.S.; Rsaliyev, A.R. Identification of leaf rust resistance genes in spring soft wheat samples developed in Russia and Kazakhstan. Plant Prot. News 2019, 3, 41–49. (In Russian) [Google Scholar] [CrossRef]
  12. Gultyaeva, E.I.; Shaydayuk, E.L.; Veselova, V.V.; Levitin, M.M. Genetic diversity of promising accessions of spring soft wheat of Russian and Kazakh breeding for resistance to leaf and yellow rust. Russ. Agric. Sci. 2024, 2, 43–48. (In Russian) [Google Scholar] [CrossRef]
  13. Gultyaeva, E.I.; Shaydayuk, E.L.; Kosman, E.G. Regional and temporal differentiation of virulence phenotypes of Puccinia triticina from common wheat in Russia during the period 2001–2018. Plant Pathol. 2020, 69, 860–871. [Google Scholar] [CrossRef]
  14. Gultyaeva, E.; Shaydayuk, E.; Kosman, E. Virulence diversity of Puccinia striiformis f. sp. tritici in common wheat in Russian regions in 2019–2021. Agriculture 2022, 12, 1957. [Google Scholar] [CrossRef]
  15. Skolotnevaa, E.S.; Kelbina, V.N.; Morgunov, A.I.; Boikova, N.I.; Shamanin, V.P.; Salina, E.A. Races composition of the Novosibirsk population of Puccinia graminis f. sp. tritici. Mikol. Fitopatol. 2020, 54, 49–58. (In Russian) [Google Scholar] [CrossRef]
  16. Gultyaeva, E.I.; Shaydayuk, E.L. Resistance of modern Russian winter wheat cultivars to yellow rust. Plants 2023, 12, 3471. [Google Scholar] [CrossRef]
  17. Mas Wheat. Available online: https://maswheat.ucdavis.edu/ (accessed on 12 August 2024).
  18. Gultyaeva, E.I.; Shaydayuk, E.L.; Shamanin, V.P.; Akhmetova, A.K.; Tyunin, V.A.; Shreyder, E.R.; Kashina, I.V.; Eroshenko, L.A.; Sereda, G.A.; Morgunov, A.I. Genetic structure of Russian and Kazakhstani leaf rust causative agent Puccinia triticina Erikss. Populations as assessed by virulence profiles and SSR markers. Agric. Biol. 2018, 53, 85–95. (In Russian) [Google Scholar] [CrossRef]
  19. Mago, R.; Spielmeyer, W.; Lawrence, G.J.; Lagudah, E.S.; Ellis, J.G.; Pryor, A. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1R of rye using wheat-rye translocation lines. Theor. Appl. Genet. 2002, 104, 1317–1324. [Google Scholar] [CrossRef]
  20. Gultyaeva, E.I.; Sibikeev, S.N.; Druzhin, A.E.; Shaydayuk, E.L. Enlargement of genetic diversity of spring bread wheat resistance to leaf rust (Puccinia triticina Eriks.) in lower Volga region. Agric. Biol. 2020, 55, 27–44. [Google Scholar] [CrossRef]
  21. McIntosh, R.A.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO: Canberra, Australia, 1995. [Google Scholar]
  22. State Register of Breeding Achievements Recommended for Use in the Republic of Kazakhstan. Available online: https://sortcom.kz (accessed on 12 July 2024). (In Kazakh and Russian).
  23. FGBNU. State Register for Selection Achievements Admitted for Usage; Nathional List; Plants Varieties: Moscow, Russia, 2023; Volume 1, 631p, Available online: https://gossortrf.ru/publication/reestry.php (accessed on 12 July 2024). (In Russian)
  24. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Xia, X.C.; Raupp, W.J.V. Catalogue of gene symbols for wheat: 2022 supplement. Annu. Wheat Newsl. 2022, 68, 68–81. Available online: https://wheat.pw.usda.gov/ggpages/awn/68/AWN (accessed on 12 August 2024).
  25. Kushnirenko, I.; Shreyder, E.; Bondarenko, N.; Shaydayuk, E.; Kovalenko, N.; Titova, J.; Gultyaeva, E. Genetic Protection of soft wheat from diseases in the southern Ural of Russia and virulence variability of foliar pathogens. Agriculture 2021, 11, 703. [Google Scholar] [CrossRef]
  26. Adonina, I.G.; Leonova, I.N.; Badaeva, E.D.; Salina, E.A. Genotyping of hexaploid wheat varieties from different Russian regions. Vavilov. J. Genet. Breed. 2016, 20, 44–50. (In Russian) [Google Scholar] [CrossRef]
  27. Cherukuri, D.P.; Gupta, S.K.; Charpe, A.; Koul, S.; Prabhu, K.V.; Singh, R.B.; Haq, Q.M.R. Molecular mapping of Aegilops speltoides derived leaf rust resistance gene Lr28 in wheat. Euphytica 2005, 143, 19–26. [Google Scholar] [CrossRef]
  28. Mago, R.; Zhang,, P.; Bariana, H.S.; Verlin, D.C.; Bansal, U.K.; Ellis, J.G.; Dundas, I.S. Development of wheat lines carrying stem rust resistance gene Sr39 with reduced Aegilops speltoides chromatin and simple PCR markers for marker-assisted selection. Theor. Appl. Genet. 2009, 124, 65–70. [Google Scholar] [CrossRef]
  29. Gold, J.; Harder, D.; Townley-Smith, F.; Aung, T.; Procunier, J. Development of a molecular marker for rust resistance genes Sr39 and Lr35 in wheat breeding lines. Electron. J. Biotechnol. 1999, 2, 35–40. [Google Scholar] [CrossRef]
  30. Helguera, M.; Khan, I.A.; Dubcovsky, J. Development of PCR markers for wheat leaf rust resistance gene Lr47. Theor. Appl. Genet. 2000, 101, 625–631. [Google Scholar] [CrossRef]
  31. Helguera, M.; Vanzetti, L.; Soria, M.; Khan, I.A.; Kolmer, J.; Dubcovsky, J. PCR markers for Triticum speltoides leaf rust resistance gene Lr51 and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2005, 45, 728–734. [Google Scholar] [CrossRef]
  32. Marais, G.F.; Bekker, T.A.; Eksteen, A.; McCallum, B.; Fetch, T.; Marais, A.S. Attempts to remove gametocidal genes co-transferred to common wheat with rust resistance from Aegilops speltoides. Euphytica 2010, 171, 71–85. [Google Scholar] [CrossRef]
  33. Sibikeev, S.N.; Druzhin, A.E.; Badaeva, E.D.; Shishkina, A.A.; Dragovich, A.Y.; Gultyaeva, E.I.; Kroupin, P.Y.; Karlov, G.I.; Khuat, T.M.; Divashuk, M.G. Comparative analysis of Agropyron intermedium (Host) Beauv. 6Agi and 6Agi2 chromosomes in bread wheat cultivars and lines with wheat–wheatgrass substitutions. Russ. J. Genet. 2017, 53, 314–324. [Google Scholar]
  34. Sharma-Poudyal, D.; Chen, X.M.; Wan, A.M.; Zhan, G.M.; Kang, Z.S.; Cao, S.Q.; Jin, S.L.; Morgounov, A.; Akin, B.; Mert, Z.; et al. Virulence characterization of international collections of the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici. Plant Dis. 2013, 97, 379–386. [Google Scholar] [CrossRef]
  35. Kokhmetova, A.; Rathan, N.D.; Sehgal, D.; Malysheva, A.; Kumarbayeva, M.; Nurzhuma, M.; Bolatbekova, A.; Krishnappa, G.; Gultyaeva, E.; Kokhmetova, A.; et al. QTL mapping for seedling and adult plant resistance to stripe and leaf rust in two winter wheat populations. Front. Genet. 2023, 14, 1265859. [Google Scholar] [CrossRef]
  36. Rosewarne, G.; Bonnett, D.; Rebetzke, G.; Lonergan, P.; Larkin, P.J. The potential of Lr19 and Bdv2 translocations to improve yield and disease resistance in the high rainfall wheat zones of Australia. Agronomy 2015, 5, 55–70. [Google Scholar] [CrossRef]
  37. Howell, T.; Hale, I.; Jankuloski, L.; Bonafede, M.; Gilbert, M.; Dubcovsky, J. Mapping a region within the 1RS.1BL translocation in common wheat affecting grain yield and canopy water status. Theor. Appl. Genet. 2014, 127, 2695–2709. [Google Scholar] [CrossRef] [PubMed]
  38. Reynolds, M.P.; Calderini, D.F.; Condon, A.G.; Rajaram, S. Physiological basis of yield gains in wheat associated with the Lr19 translocation from Agropyron Elongatum. Euphytica 2001, 119, 139–144. [Google Scholar] [CrossRef]
  39. Dorokhov, D.B.; Cloquet, E.A. Rapid and economic technique for RAPD analysis of plant genomes Fast and economical technology of RAPD analysis of plant genomes. Russ. J. Genet. 1997, 33, 358–365. [Google Scholar]
  40. Qiu, J.W.; Schürch, A.C.; Yahiaoui, N.; Dong, L.L.; Fan, H.J.; Zhang, Z.J.; Keller, B.; Ling, H.Q. Physical mapping and identification of a candidate for the leaf rust resistance gene Lr1 of wheat. Theor. Appl. Genet. 2007, 115, 159–168. [Google Scholar] [CrossRef] [PubMed]
  41. Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; William, M.; Rosewarne, G.; Djurle, A.; Yuen, J. Identification and mapping of Lr3 and a linked leaf rust resistance gene in durum wheat. Crop Sci. 2007, 47, 1459–1466. [Google Scholar] [CrossRef]
  42. Gupta, S.K.; Charpe, A.; Koul, S.; Prabhu, K.V.; Haq, Q.M.R. Affiliations expand development and validation of molecular markers linked to an Aegilops umbellulata–derived leaf rust resistance gene, Lr9, for marker-assisted selection in bread wheat. Genome 2005, 48, 823–830. [Google Scholar] [CrossRef]
  43. Chelkowski, J.; Golka, L.; Stepien, L. Application of STS markers for leaf rust resistance genes in near-isogenic lines of spring wheat cv. Thatcher. J. Appl. Genet. 2003, 44, 323–338. [Google Scholar]
  44. Fritz, A. Leaf Rust Resistance Gene Lr21. Available online: https://maswheat.ucdavis.edu/protocols/Lr21/ (accessed on 12 August 2024).
  45. Procunier, J.D.; Townley-Smith, T.F.; Fox, S.; Prashar, S.; Gray, M.; Kim, W.K.; Czarnecki, E.; Dyck, P.L. PCR-based RAPD/DGGE markers linked to leaf rust resistance genes Lr29 and Lr25 in wheat (Triticum aestivum L.). J. Genet. Breed. 1995, 49, 87–92. [Google Scholar]
  46. Brown-Guedira, G.; Singh, S. Leaf Rust Resistance Gene Lr39. Available online: https://maswheat.ucdavis.edu/protocols/Lr39/ (accessed on 12 August 2024).
  47. Stripe Rust Resistance Gene Yr5. Available online: https://maswheat.ucdavis.edu/protocols/Yr5/ (accessed on 12 August 2024).
  48. Bariana, H.S.; Brown, G.N.; Ahmed, N.U.; Khatkar, S.; Conner, R.L.; Wellings, C.R.; Haley, S.; Sharp, P.J.; Laroche, A. Characterization of Triticum vavilovii-derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. Theor. Appl. Genet. 2002, 104, 315–320. [Google Scholar] [CrossRef]
  49. Stripe Rust Resistance Gene Yr15. Available online: https://maswheat.ucdavis.edu/protocols/Yr15/ (accessed on 12 August 2024).
  50. Rani, R.; Singh, R.; Yadav, N.R. Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers. Comptes Rendus Biol. 2019, 342, 154–174. [Google Scholar] [CrossRef] [PubMed]
  51. Gupta, S.K.; Charpe, A.; Prabhu, K.W.; Haque, O.M.R. Identification and validation of molecular markers linked to the leaf rust resistance gene Lr19 in wheat. Theor. Appl. Genet. 2006, 113, 1027–1036. [Google Scholar] [CrossRef]
  52. Neu, C.; Stein, N.; Keller, B. Genetic mapping of the Lr20-Pm1 resistance locus reveals suppressed recombination on chromosome arm 7AL in hexaploid wheat. Genome 2002, 45, 737–744. [Google Scholar] [CrossRef]
  53. Mago, R.; Bariana, H.S.; Dundas, I.S. Development or PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor. Appl. Genet. 2005, 111, 496–504. [Google Scholar] [CrossRef] [PubMed]
  54. Weng, Y.; Azhaguvel, P.; Devkota, R.N.; Rudd, J.C. PCR based markers for detection of different sources of 1AL.1RS and 1BL.1RS wheat-rye translocations in wheat background. Plant Breed. 2007, 126, 482–486. [Google Scholar] [CrossRef]
  55. Lagudah, E.S.; McFadden, H.; Singh, R.P.; Huerta-Espino, J.; Bariana, H.S.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21–30. [Google Scholar] [CrossRef] [PubMed]
  56. Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong-qi, L.; Dubcovsky, J. PCR assays for the Lr37–Yr17–Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
  57. Gultyaeva, E.I. Genetic Structure of Puccinia triticina Populations in Russia and Its Variability under the Influence of Host Plant. Ph.D. Thesis, All-Russian Institute of Plant Protection, St. Petersburg, Russia, 2018; 312p. (In Russian). [Google Scholar]
  58. Long, D.L.; Kolmer, J.A. A North American system of nomenclature for Puccinia recondita f. sp. tritici. Phytopathology 1989, 79, 525–529. [Google Scholar] [CrossRef]
  59. GRRC—Global Rust Reference Center. Available online: https://agro.au.dk/forskning/internationale-platforme/wheatrust. (accessed on 12 August 2024).
  60. Mains, E.B.; Jackson, H.S. Physiologic specialization in the leaf rust of wheat Puccinia triticina Erikss. Phytopathology 1926, 16, 89–120. [Google Scholar]
  61. Stakman, E.C.; Levin, M.N. The determination of biologic forms of Puccinia graminis on Triticum spp. Minn. Agt. Exp. Star. Tech. Bull. 1922, 8, 38–41. [Google Scholar]
  62. Gassner, G.; Straib, W. Untersuchungen über die infektionsbedingungen von Puccinia glumarum und Puccinia graminis. Arb. Biol. Reichsanst. Land. Forstwirtsch. 1928, 16, 609–629. [Google Scholar]
  63. Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can. J. Res. 1948, 26, 496–500. [Google Scholar] [CrossRef]
  64. Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; D.F. CIMMYT: El Batan, Mexico, 1992. [Google Scholar]
  65. Pietragallam, J.; Pask, A. Grain yield and yield components. In Physiological Breeding II: A Field Guide to Wheat Phenotyping, 18th ed.; Pask, A.J.D., Pietragalla, J., Mullan, D.M., Reynolds, M.P., Eds.; CIMMYT: El Batan, Mexico, 2000; pp. 95–105. [Google Scholar]
Plants 13 02469 g001
Figure 1. Response of KASIB accessions to race TTKTF of Puccinia graminis at the seedling stage. 1–40 wheat accessions according to Table 1.
Figure 1. Response of KASIB accessions to race TTKTF of Puccinia graminis at the seedling stage. 1–40 wheat accessions according to Table 1.
Plants 13 02469 g001
Table 1. Reaction of spring wheat germplasm to rusts at the seedling stage and identified rust resistance genes.
Table 1. Reaction of spring wheat germplasm to rusts at the seedling stage and identified rust resistance genes.
EntryReaction Type to Rust Isolates at the Seedling StageIdentified Rust Resistance Genes
P. triticinaP. graminisP. striiformis
PtK1PtK2PtK3PtK4PgK1PgK2PstK1PstK2PstK3PstK4PstK5
1Line 201m/22SSSSSSSSSSSLr3 Lr10 Lr21
2Line 334m/22MRMRMRMRMSMSRMRRSMS-
3Line 337m/22MRMRSMRSSSSSSSLr10
4Line 55/08SSSSMS-SSSSSSSLr3
5Line 143/09SSSSSSSSSSS-
6Line 42/93-09-1RRMRRSSSSSSMSLr3
7Line 1205-09-8SSSSMS-SSRMRSSMR-
8Lutescens 54 190/09MRMRMSSMRMRSSSSSLr26 Sr31 Yr9
9Lutescens 20 161/08SSSSMS-SSRSSSS-
10KudesnitsaRRRRMRMRSSSSS-
11Lutescence 2216SSSSSSSSSSSLr3
12Lutescence 2222SSSSMS-SMSSSSSS-
13Saru Akca 27SSSSSSSSSSSLr1 Lr3
14Line 218/10SSSSSSSSSSSLr1 Lr3
15PCIb12I453RRSSMRMRSSSSSLr3 Lr20 Lr26 Sr15 Sr31 Yr9
16PCIb12I I189SSSSMRMRSSSSSLr1 Lr3
17Line 98-A-2SSSSSMSSSSSSLr3 Lr10
18Line 155-A-1SSSSSSSSSSSLr10
19Line 249-A-25RRSSMSMSSSSSSLr3 Lr10
20L-407/ChTRRRRMRMRRRRRRLr10 Lr34 Sr57 Yr18
21L-6/SMRRSSR-MRR-MRSRRSSLr3 Lr26 Sr31 Yr9
22L-235/PTR,SRMRR, SMR SMR, SRRMRRRLr9 Lr24 Sr24 1AL/1RS
23KS 39/08-7SSSSSSSSSSS-
24KS 29/17yRRSSR-MRR-MRSSSSSLr1 Lr26 Yr31 Yr9
25Lutescens 1485RRRRMRMRRRRMRRLr6Agi2
26Lutescens 1510RRRRRRMRMRSSMSLr19 Lr26 Sr25 Sr31 Yr9
27Lutescens 1535RSRRRRSMSSSSLr3 Lr19 Sr25
28Line 1616ae14RRRRRRSRRSSLr19 Lr26 Yr9 Sr25 Sr31
29L373RRRRRRRSMRRRLr3 Lr10 Lr19 Lr21 Lr26 Sr25 Sr31 Yr9
30L447RRRRRRRRRRRLr3 Lr10 Lr26 Lr6Agi1 Sr31 Yr9
31L2203SSSSSSSSSSS-
32L1353RRMRRMSMSSSSSSLr1 Lr3 Lr10
33Kasibovskaya 2RRSSR-MRR-MRMRMRSSMSLr1 Lr26 Sr31 Yr9
34Lutescens 34–16SRRRMRMRSSSSSLr9 AL.1RS
35Lutescens 205/12-5RRRRRRSSSSSLr1 Lr3 Lr19 Lr26 Sr25 Sr31 Yr9
36Lutescens 242/13-10RRRRRRSSSSSLr3 Lr19 Lr26 Sr25 Sr31 Yr9
37Lutescens 74/16-1RRRRRRSSSSSLr19 Lr26 Sr25 Sr31 Yr9
38Pamyaty TyninaRRRRR-MRR-MRSSSSSLr3 LrAsp
39ZagadkaRRSSMRMRSSSSSLr1 Lr10 Lr26 Sr31 Yr9
40Erythrospermum 26464RRRRMRMRSSSSSLr1 Lr3 LrAsp
Reaction types were 0 for resistance (R) and 4 for susceptibility (S), with 1–2 for moderately resistant (MR) and 2, 3(X) and 3 for moderately susceptible (MS). Lines 1–19, Kazakh; lines 20–40, Russian accessions.
Table 2. Leaf rust severity of KASIB-24 accessions in the field in South Urals agroclimatic zone in 2023 and agronomic performance of 1000-grain weight and grain yield.
Table 2. Leaf rust severity of KASIB-24 accessions in the field in South Urals agroclimatic zone in 2023 and agronomic performance of 1000-grain weight and grain yield.
No.EntryLeaf Rust Severity and Reaction Type in the Field1000-Grain Weight, gGrain Yield, t/ha
1Line 201m/221 MR38.03.19
2Line 334m/221 MS38.53.88
3Line 337m/221 MS38.34.00
4Line 55/0830 S37.13.83
5Line 143/0950 S37.63.68
6Line 42/93-09-15 S36.24.28
7Line 1205-09-810–20 S35.13.93
8Lutescens 54 190/091 S33.43.20
9Lutescens 20 161/08035.63.45
10Kudesnica034.23.20
11Lutescence 22165 S36.63.61
12Lutescence 2222036.13.25
13Saru Akca 275 MS32.63.55
14Line 218/1050 S42.02.56
15PCIb12I45320 S37.63.24
16PCIb12I I1891 S38.83.65
17Line 98-A-250 MS39.75.01
18Line 155-A-140 MS40.83.03
19Line 249-A-2550 S38.84.55
20L-407/ChT034.62.06
21L-6/SM10–20 S37.93.57
22L-235/PT0, 10 S35.73.65
23KS 39/08-750 S35.22.47
24KS 29/17y1 S44.13.68
25Lutescens 1485033.83.58
26Lutescens 1510038.24.02
27Lutescens 15351–5 MS41.44.00
28Line 1616ae14039.03.71
29L373036.34.05
30L447033.93.34
31L2203039.03.48
32L13531 MR36.83.42
33Kasibovskaya 21 S36.33.67
34Lutescens 34-161 MR38.72.98
35Lutescens 205/12-5038.63.24
36Lutescens 242/13-10037.73.67
37Lutescens 74/16-1033.83.36
38Pamyaty Tynina037.04.39
39Zagadka035.93.44
40Erythrospermum 26464034.13.48
StPamyati Azieva10 S36.83.04
StTertsiya40–50 MS36.33.38
StOmskaya 3520 S42.72.73
StSaratovskaya 2940 S39.53.22
LSD, p < 0.5 0.120.58
Table 3. Wheat cultivars and lines of the KASIB-24 nursery.
Table 3. Wheat cultivars and lines of the KASIB-24 nursery.
No.EntryOriginOrganization
1.Line 201m/22KZ: AktyubinskAktobe Agricultural Experimental Station
2.Line 334m/22
3.Line 337m/22
4.Line 55/08KZ: ShortanduScientific and Production Center of Grain Farming named after A. I. Barayev
5.Line 143/09
6.Line 42/93-09-1KZ: PavlodarPavlodar Agricultural Experimental Station
7.Line 1205-09-8
8.Lutescens 54 190/09KZ: KarabalykKarabalyk Agricultural Experimental Station
9.Lutescens 20 161/08
10.Kudesnica
11.Lutescence 2216KZ: KaragandaKaraganda Agricultural Experimental Station named after Khristenko
12.Lutescence 2222
13.Saru Akca 27
14.Line 218/10KZ: AkkaiynNorth Kazakhstan Agricultural Experimental Station
15.PCIb12I 453
16.PCIb12I I189
17.Line 98-A-2KZ: Ust-Kamenogorsk Pilot farm of oil plants
18.Line 155-A-1
19.Line 249-A-25
20.L-407/ChTRU: KurganKurgan Agricultural Research Institute
21.L-6/SM
22.L-235/PT
23.KS 39/08-7RU: Kurgan Research and Production Agroholding «Kurgansemena»
24.KS 29/17y
25.Lutescens 1485RU: SamaraN.M. Tulaikov Research Institute of Agriculture
26.Lutescens 1510
27.Lutescens 1535
28Line 1616ae14
29.L373RU: SaratovFederal Agrarian Scientific Centre of the South-East
30L447
31.L2203RU: NovosibirskSiberian Research Institute of Plant Cultivation and Breeding—Branch of Institute of Cytology and Genetics
32.L1353
33.Kasibovskaya 2RU: OmskOmsk State Agrarian University
34.Lutescens 34-16
35.Lutescens 205/12-5RU: Omsk Omsk Agrarian Centre
36.Lutescens 242/13-10
37Lutescens 74/16-1
38Pamyaty TyninaRU: ChelyabinskChelyabinsk Research Institute of Agriculture
39Zagadka
40Erythrospermum 26464
Table 4. Molecular markers used for identification of Lr, Sr and Yr genes.
Table 4. Molecular markers used for identification of Lr, Sr and Yr genes.
GeneMarkerPrimer SequenceAllele Size, bpReferences
Lr1WR003 F/RF: GGGACAGAGACCTTGGTGGA
R: GACGATGATGATTTGCTGCTGG		760[40]
Lr3aXmwg798F: GGCTGTCTACATCTTCTGCA
R: CAAGTGTTGAGAAGGAGAGT		365[41]
Lr9SCS5F: TGCGCCCTTCAAAGGAAG
R: TGCGCCCTTCTGAACTGTAT		550[42]
Lr10F1.2245/Lr10-6/r2F: GTGTAATGCATGCAGGTTCC
R: AGGTGTGAGTGAGTTATGTT		310[43]
Lr21Lr21F/RF: CGCTTTTACCGAGATTGGTC
R: TCTGGTATCTCACGAAGCCTT		669[44]
Lr25Lr25F20/R19F: CCACCCAGAGTATACCAGAG
R: CCACCCAGAGCTCATAGAA		1800[45]
Lr28SCS421F: ACAAGGTAAGTCTCCAACCA
R: AGTCGACCGAGATTTTAACC		570[27]
Lr29Lr29F24F: GTGACCTCAGGCAATGCACACAGT
R: GTGACCTCAGAACCGATGTCCATC		900[45]
Lr41(39)GDM35F: CCTGCTCTGCCCTAGATACG
R: ATGTGAATGTGATGCATGCA		190[46]
Lr47PS10F: GCTGATGACCCTGACCGGT
R: TCTTCATGCCCGGTCGGGT		282[30]
Lr51S30-13L/AGA7-759F: GCATCAACAAGATATTCGTTATGACC
R: TGGCTGCTCAGAAAACTGGAC		783, 422[31]
Lr66(Asp)S13-R16F: GGTGAACGCTAAACCCAGGTAACC
R: CAACCTGGGAAGATGCTGAG		695[32]
Yr5STS7/8F: GTA CAA TTC ACC TAG AGT
R GCA AGT TTT CTC CCT ATT		478[47]
STS9/10F: AAA GAA TAC TTT AAT GAA
R: CAA ACT TAT CAG GAT TAC		439
Yr10Xpsp3000F: GCAGACCTGTGTCATTGGTC
R: GATATAGTGGCAGCAGGATACG		220, 260[48]
Yr15Xbarc8F: GCGGGAATCATGCATAGGA
R: GCGGGGGCGAAACATACACATAAAAACA		96[49]
Yr24Barc181F: CGCTGGAGGGGGTAAGTCATCAC
R: CGCAAATCAAGAACACGGGAGAAAGAA		180[50]
Lr19, Sr25SCS265 F: GGCGGATAAGCAGAGCAGAG
R: GGCGGATAAGTGGGTTATGG		512[51]
Lr20, Sr15STS638F: ACAGCGATGAAGCAATGAAA
R: GTCCAGTTGGTTGATGGAAT		542[52]
Lr24, Sr24Sr24≠12F: CACCCGTGACATGCTCGTA
R: AACAGGAAATGAGCAACGATGT		500[53]
Sr24≠50 F: CCCAGCATCGGTGAAAGAA
R: ATGCGGAGCCTTCACATTTT		200
Lr26, Sr31, Yr9SCM9F: TGACAACCCCCTTTCCCTCGT
R: TCATCGACGCTAAGGAGGACCC		207(1BL.1RS)
228(1AL.1RS)		[54]
Lr34, Sr57, Yr18csLV34F: GTTGGTTAAGACTGGTGATGG
R: TGCTTGCTATTGCTGAATAGT		150[55]
Lr35, Sr39Sr39#22rF: AGAGAAGATAAGCAGTAAACATG
R: TGCTGTCATGAGAGGAACTCTG		487[28]
Sr39F2/R3F: AGAGAGAGTAGAAGAGCT
R: AGAGAGAGAGCATCCACC		900[29]
Lr37, Sr38, Yr17Ventriup/LN2F: AGGGGCTACTGACCAAGGCT
R: TGCAGCTACAGCAGTATGTACACAAAA		259[56]
Lr_Yr6Agi2MF2/MR1r2F: GATGTCG-AGGAGCATTTTC
R: GTGGTAGATTACTAGAGTTCAAGTG		347[6]
Lr6Agi1j09/1 + F2
j09/1 + 4a		Not published–confidential
Not published–confidential		272
269		[57]
[57]
Table 5. Virulence–avirulence profile of Puccinia triticina, Puccinia graminis and Puccinia striiformis isolates.
Table 5. Virulence–avirulence profile of Puccinia triticina, Puccinia graminis and Puccinia striiformis isolates.
Isolate OriginationVirulence to GenesAvirulence to Genes (Reaction Type)
Puccinia triticina
PtK1Chelyabinsk, 2022Lr: 1, 2a, 2b, 2c, 3a, 3bg, 3ka, 9,10, 14a, 14b, 15, 17, 18, 20, 30Lr: 19 (R), 16 (R), 24(R), 26(R), 28(R), 29(R), 47(R), 51(R)
PtK2Saratov, 2021Lr: 1, 2a, 2b, 2c, 3a, 3bg, 3ka, 10, 14a, 14b, 15, 16, 17, 18, 19, 20, 30Lr: 9(R), 24(R), 26(R), 28(R), 29(R), 47(R), 51(R)
PtK3Novosibirsk 2021Lr: 1, 2a, 2b, 2c, 3a, 3bg, 3ka, 10, 14a, 14b, 15, 16, 17, 18, 20, 26, 30Lr: 9(R), 19(R), 24(R), 28(R), 29(R), 47(R), 51(R)
PtK4Chelyabinsk, 2022Lr: 1, 3a, 3bg, 3ka, 10, 14a, 14b, 16, 17, 18, 20, 26, 30Lr: 2a(R), 2b(R), 2c(MR), 9(R), 15(R), 19(R), 24(R), 28(R), 29(R), 47(R), 51(R)
Puccinia graminis
PgK1Chelyabinsk, 2022Sr: 5, 6, 7b, 8a, 9a, 9b, 9g, 9e, 9d, 10, 11, 17, 21, 30, 38, Tmp, McNSr: 24(MR), 25(R), 24 + 31(R), 24 + 36(R), 31(MR), 36(R)
PgK2Chelyabinsk, 2019Sr: 5, 6, 7b, 8a, 9a, 9b, 9e, 10, 11, 21, 38, Tmp, McNSr: 9d(MR), 9g(MR), 17(MR), 24(R), 25(R), 24 + 31(R), 24 + 36(R), 30(R), 31(MR), 36(R)
Puccinia striiformis
PstK1Saratov, 2023Yr: 1, 2, 3, 4, 6, 8, 9, 27, NDYr: 5(R), 7(MR), 10(R), 15(R), 17(MR), 24(R), SP(R), SD(MR)
PstK2St Petersburg, 2022Yr: 2, 3, 4, 6, 8, 9, 27Yr: 1(R), 5(R), 7(MR), 10(R), 15(R), 17(MR), 24(MR), SP(R), SD(MR), ND(R)
PstK3Krasnodar, 2022Yr: 1, 2, 3, 4, 6, 7, 8, 9, Yr: 5(R), 10(R), 15(R), 17(R), 24(R), 27(R), SP(R), SD(R), ND(MR)
PstK4Dagestan, 2023Yr: 2, 3, 4, 6, 7, 8, 9, 27, SD, NDYr: 1(R), 5(R), 10(R), 15(R), 17(MR), 24(R), SP(R)
PstK5 Novosibirsk, 2021Yr: 1, 2, 3, 6, 8, 9, 27, SD Yr: 4(MR), 5(R), 7(MR), 10(R), 15(R), 17(R), 24(R), SP(R), ND(MR)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gultyaeva, E.; Shaydayuk, E.; Shreyder, E.; Kushnirenko, I.; Shamanin, V. Genetic Diversity of Promising Spring Wheat Accessions from Russia and Kazakhstan for Rust Resistance. Plants 2024, 13, 2469. https://doi.org/10.3390/plants13172469

AMA Style

Gultyaeva E, Shaydayuk E, Shreyder E, Kushnirenko I, Shamanin V. Genetic Diversity of Promising Spring Wheat Accessions from Russia and Kazakhstan for Rust Resistance. Plants. 2024; 13(17):2469. https://doi.org/10.3390/plants13172469

Chicago/Turabian Style

Gultyaeva, Elena, Ekaterina Shaydayuk, Ekaterina Shreyder, Igor Kushnirenko, and Vladimir Shamanin. 2024. "Genetic Diversity of Promising Spring Wheat Accessions from Russia and Kazakhstan for Rust Resistance" Plants 13, no. 17: 2469. https://doi.org/10.3390/plants13172469

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop