Next Article in Journal
The Variability of Berry Parameters Could Be an Indicator of the Potential Quality of the Vineyard
Previous Article in Journal
Optimal Light Intensity for Lettuce Growth, Quality, and Photosynthesis in Plant Factories
Previous Article in Special Issue
Dissection of the Genetic Basis of Genotype by Environment Interactions for Morphological Traits and Protein Content in Winter Wheat Panel Grown in Morocco and Spain
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 18
10.3390/plants13182615
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization and Transcriptomic Analysis of Sorghum EIN/EIL Family and Identification of Their Roles in Internode Maturation

by
Min Tu
1,*,†,
Yuqing Hua
1,†,
Ti Shao
2,
Siyu Zhang
1,
Zihan Xiang
3,
Manting Yu
3,
Guoli Wang
2,
Zhuang Li
1,
Yun He
1,
Lin Yang
1 and
Yin Li
2,*
1
Hubei Technical Engineering Research Center for Chemical Utilization and Engineering Development of Agricultural and Byproduct Resources, School of Chemical and Environmental Engineering, Wuhan Polytechnic University, Wuhan 430023, China
2
The Genetic Engineering International Cooperation Base of Chinese Ministry of Science and Technology, Key Laboratory of Molecular Biophysics of Chinese Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
3
School of Mathematics and Computer Science, Wuhan Polytechnic University, Wuhan 430023, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(18), 2615; https://doi.org/10.3390/plants13182615
Submission received: 8 August 2024 / Revised: 18 September 2024 / Accepted: 18 September 2024 / Published: 19 September 2024
(This article belongs to the Special Issue Genetics, Genomics, and Biotechnology for Cereal Crop Improvements)
Browse Figures
Versions Notes

Abstract

:
Ethylene-insensitive 3/Ethylene-insensitive3-like proteins (EIN3/EIL) represent a group of transcription factors critical for the ethylene signaling transduction that manipulate downstream ethylene-responsive genes, thereby regulating plant growth, development, and stress responses. However, the identification, evolution, and divergence of the EIL family remain to be studied in Sorghum bicolor. Here, we identified eight SbEILs, which were expanded due to whole-genome-duplication (WGD) events. Characterization of the protein sequences and expression atlas demonstrates that the WGD-duplicated SbEILs could become divergent due to the differential expression patterns, rather than domain and motif architectures. Comparative expression analysis was performed between the RNA-seq data sets of internodes from several sorghum cultivars to understand the potential roles of SbEIL members in internode elongation and maturation. Our results identified SbEIL3 and 7 (the latter as a homolog of OsEIL7/OsEIL1) to be the highly expressed SbEIL genes in sorghum internodes and revealed a potential functional link between SbEIL7 and internode maturation. The co-expression analysis and comparative expression analysis with ethylene-regulated gene sets found that SbEIL7 was co-regulated with a set of ubiquitin-related protein degradation genes, suggesting possible involvement of SbEIL7 in protein degradation and processing during the post-anthesis stages. Altogether, our findings lay a foundation for future functional studies of ethylene signaling-mediated gene regulation and improvement of sorghum internode development.

1. Introduction

Ethylene is a gaseous phytohormone that affects various plant developmental processes, including seed germination, flower and leaf senescence, fruit ripening, root development, programmed cell death, responsiveness to biotic and abiotic stresses, etc. [1,2,3,4]. Ethylene signaling starts with receptors sensing ethylene in plants. The N-terminal region of CTR1 (Constitutive Triple Response 1) interacts with ethylene receptors, while the C-terminus is a Raf-like Ser/Thr protein kinase domain [5,6,7]. In the absence of ethylene, CTR1 inhibits downstream ethylene responses by phosphorylating the C-terminus of EIN2 (Ethylene-insensitive 2) [8]. On the contrary, the presence of ethylene inactivates the receptor and CTR1, reduces the phosphorylation of EIN2, resulting in its C-terminal fragment being cleaved and transferred into the nucleus, and finally activates the transcriptional cascade of EIN3/EIL1 (Ethylene-insensitive 3/Ethylene-insensitive3-like proteins) [9].
EIN3/EIL1 acts as the master transcription factors in the ethylene signaling pathway, manipulating downstream genes or regulators associated with ethylene responses, such as ERF1 (Ethylene Response Factor), which further regulate diverse aspects of plant growth, development, and stress responses [6,10,11,12,13,14].
EIL1 belongs to a gene family of transcription factors designated as EIN3/EIL (abbreviated as the EIL family hereafter) that encodes proteins containing the EIN3 domain [15], of which the structures are mainly characterized by highly conserved N-terminal and less conservative C-terminal sequences, suggesting the various functions of EIL1 homologs in different plant species [10]. In the model species, such as Arabidopsis thaliana and rice (Oryza sativa), EIL family members have been known to regulate not only the processes of plant growth and development but also various molecular responses to biotic and abiotic stresses [1,16,17].
As a multigenic family, functional studies of the EIL members were mainly concentrated in the dicot model Arabidopsis. Recently, the roles of EIL members have been gradually explored in monocot crops, especially rice. In rice, OsEIL1 has higher expression levels than that of OsEIL2. Both OsEIL1 and 2 are repressed with the ethylene treatment and are wound-inducible [18]. In the rice maohuzi6 mutant (MHZ6), MHZ6 encodes OsEIL1, with OsEIL1 mutations leading to ethylene insensitivity mainly in roots, but OsEIL2 mutations cause ethylene insensitivity mainly in coleoptiles [19]. OsEIL plays a major role in ethylene signaling with pleiotropic effects. For example, OsEIL is involved in the crosstalk between ethylene- and jasmonic acid-pathway responses to a piercing–sucking insect in rice [20]; OsEIL targets the promoter of OsERF115 to control grain size and weight [21]; and OsEIL also participates in positive feedback regulation of ethylene signaling by auxin biosynthesis for root growth [22].
Genome-wide analysis of the EIL family in major staple crops (i.e., rice and maize) and functional characterization of several OsEILs serve as the foundation for reverse genetic studies and comparative genomic studies to bridge the ethylene-related knowledge between the major monocot model species and the other understudied species (like sorghum) [18,19,20,21,22,23,24]. The EIL family from both rice and maize consists of nine members [25,26], while 21 EIL members were identified in wheat [27]. According to phylogenetic analyses, OsEIL1/2 (LOC_Os03g20780 and LOC_Os07g48630, respectively; the former also named as OsEIL7 by Aluko et al.) [26], TaEIL1, and ZmEIL1/9 are homologous to the master regulators in the ethylene signaling pathway AtEIL1/EIN3, indicating that these EIL homologs from crops may also play crucial roles in ethylene-mediated biological processes in crops.
Importantly, the evolution of Poaceae grass species (e.g., rice, maize, sorghum, and Brachypodium) has been extensively studied, and the whole-genome duplication events (e.g., τ-WGD and ρ-WGD) of the common ancestor of Poaceae have greatly shaped the genomic contents of the grass species [28,29,30,31]. The established evolutionary relationships between these grass genomes help understand and translate gene functions from the model species (rice, for instance) to the understudied relatives (e.g., sorghum). Indeed, analytical strategies have been established in the Triticeae species with similar concepts as integrative gene duplication and genome-wide analysis [32]. In the present study, to infer the evolution trajectory of SbEILs and to lay a foundation for future functional studies about ethylene signaling-mediated gene regulation in sorghum, we performed genome-wide identification of SbEILs and particularly analyzed the evolution between SbEILs and their orthologs in maize and rice (ZmEILs and OsEILs), highlighting the WGD-driven expansion of the SbEIL family. Comprehensive expression analyses demonstrated that WGD-duplicated SbEILs could become divergent due to differentiated expression patterns. Expression analyses focused on the internode tissues indicated that SbEIL3 and 7 might have previously unknown roles during the process of internode elongation and maturation.

2. Results and Discussion

2.1. Ancient Whole-Genome Duplication Events Drive the Expansion of the EIL Family in Rice, Maize, and Sorghum

We combined the BLAST-based and protein domain search-based methods to identify SbEIL genes in sorghum. A total of eight SbEILs were identified. According to the annotated transcripts and predicted protein sequences, these SbEIL genes putatively encode 16 proteins. To understand their orthologous relationships with OsEILs and AtEILs, we performed phylogenetic analysis with the protein sequences of the identified SbEILs, together with nine ZmEILs, nine OsEILs, and six AtEILs [25,27,33]. The monocot EIL proteins fall into three phylogenetic clades (i.e., clades A, B, and C) (Figure 1). Possibly owing to the far evolutionary relationships between the dicot model species Arabidopsis thaliana and the monocot species, AtEIL1, AtEIL2, and AtEIN3 were not grouped together with the clade A EILs but represent the AtEILs closest to clade A. Considering the critical roles of AtEIL1/2 and AtEIN3 in the ethylene signal pathway, the clade A EILs may likely be the homologs both evolutionarily and functionally [6,10]. Notably, the OsEIL nomenclature in our work was according to Aluke et al. [26]. Even though they were identified in the previous study, the evolutionary information and expression profiles of SbEILs have not been characterized in detail [26]. The Poaceae grass species feature unique WGD events, including the one that happened in the Poaceae ancestor and the paleo-tetraploidization event specific to modern maize [28,29,30,31]. Taking advantage of this Poaceae WGD information, we found that, generally, the monocot EIL family expands due to WGD events. In the rice genome, three pairs of WGD-derived OsEILs were identified, namely OsEIL1/9 (LOC_Os08g39830 and LOC_Os09g31400), OsEIL4/5 (LOC_Os07g17160 and LOC_Os07g12210), and OsEIL3/7 (LOC_Os07g48630 and LOC_Os03g20790), while OsEIL6 and 7 were produced probably by tandem duplication. Based on the reciprocal BLAST search between rice, maize, and sorghum and the established syntenic orthologous relationships between sorghum and maize, we determined that the WGD-duplicated pairs (i.e., OsEIL1/9, OsEIL4/5, and OsEIL3/7) were maintained in the sorghum BTx623 genome, leading to the sorghum WGD-duplicated EIL pairs, SbEIL1/9, SbEIL4/5, and SbEIL3/7 [34,35]. The tandemly duplicated OsEIL6 and 7 appear to be rice-specific. The paleo-tetraploidization event of the maize genome contributed to the expansion of ZmEILs, as Zm00001d047563 and Zm00001d028974, Zm00001d022530 and Zm00001d007188, and Zm00001d016924 and Zm00001d050861 are specifically duplicated in the maize genome according to the previous genomic studies [30,31,35]. In short, phylogenetic and evolutionary analyses revealed that ancient whole-genome duplication events drove the expansion of the EIL family in rice, maize, and sorghum.

2.2. Distinct Expression Patterns Could Contribute to the Divergence of Duplicated SbEILs

We sought to address whether the WGD-duplicated SbEILs have redundant or divergent functions. Duplicated genes could evolve to have different architectures of domains and/or motifs, or adopt distinct expression profiles, allowing for functional divergence. The SbEIL proteins vary in length, ranging from 322 amino acids (AAs) to 643 AAs, with the molecular weight ranging from 33.7 kDa to 71.8 kDa (Table 1). The SbEILs were acidic proteins with their isoelectric points (pI) varying from 4.94 to 6.05. Based on the prediction, SbEIL1 could be stable, while the remaining SbEILs might be unstable. The aliphatic index of the SbEILs is predicted to range between 59.9 and 80.3. The aliphatic index (AI) is directly related to the mole fraction of Ala, Ile, Leu, and Val in the protein [36] and is a positive factor for the thermo-stability of proteins [37]. SbEIL proteins are predicted to be localized in the nucleus, consistent with their roles as transcription factors.
Alignment of the SbEIL protein sequences with representative EILs (AtEIL3 and OsEIL7) found that the N-terminal regions of most SbEILs are conserved with AtEIL3 and OsEIL7 (Figure 2). In the N-terminal region of EIL, five conserved α-helices were identified in SbEILs except for SbEIL4 and SbEIL5. Structural studies and predictions have determined that these five α-helices form a V-shape DNA-binding domain critical for the function of the EIL transcription factor. In addition, the proline-rich region of EIL proteins contributes to the main-chain/side-chain interactions and the packing of α-helices 2 and 3 [38,39]. Indeed, the proline-rich region was detected in all of the SbEILs, and these proline-rich regions contain α-helix 2 and the adjacent loops. In addition, we also observed four basic amino acid domains (highlighted in red boxes in Figure 2) that have been considered as the conserved domains important for EIL proteins’ functions [38]. In order to describe the structural diversity of SbEIL-encoding genes and the proteins, we analyzed the exon–intron structure of SbEIL genes and predicted the potentially conserved motifs with MEME (Figure 3). The MEME-predicted motifs 1, 2, 3, 5, and 6 were conserved among all SbEILs except for SbEILs 4 and 5. This finding is in agreement with the sequence alignment results that SbEIL4 and 5 have a distinct content of domains and motifs, and the overall protein similarities of SbEIL 4 and 5 are ~25% compared with the other SbEILs (Figure S1).
We took advantage of the publicly available sorghum expression atlas to investigate the expression patterns of SbEILs. Based on the expression data in the reference cultivar BTx623, SbEIL1, 2, 3, 7, 8, and 9 were expressed in multiple tissues and stages, whereas SbEIL4 and 5 were not expressed (Figure 4). According to the expression data available from the Rice Gene Index, OsEIL4 and 5 were barely expressed in the leaf, root, and panicle tissues, while they are expressed in the anther, suggesting that SbEIL4 and 5 might also be specifically expressed in particular tissues not covered in the present sorghum expression database [40,41]. SbEIL2 and 8 exhibited tissue-specific expression, only expressed in the seeds. By contrast, the remaining four SbEILs (SbEIL1, 3, 7, and 9) were ubiquitously expressed with clear tissue and stage specificity. For example, SbEIL3, 7, and 9 were up-regulated in the leaf tissues after floral initiation. SbEIL1 had higher expression levels in the root than in the other tissues. SbEIL1 and 9 both showed high levels of expression during seed imbibition but were expressed at very low levels during seed maturation. Importantly, the SbEIL expression profiles allow us to address whether the WGD-derived SbEIL pairs have different expression patterns. Indeed, SbEIL1 and 9 were differentially expressed in the stem and leaf tissues. SbEIL9 was highly expressed in the stem and leaf after floral initiation, but SbEIL1 had a much lower expression level. SbEIL7 was also highly expressed in the leaf tissue after floral initiation, while the expression levels of SbEIL3 in the corresponding tissues were lower. Collectively, these data support that the WGD-duplicated SbEILs could become divergent likely because they have evolved with differentiated expression patterns, but unlikely because of the variations in domain architectures.
Plants 13 02615 g002
Figure 2. Alignment of the protein sequences identifies the conserved domains in the EIL proteins. Full-length protein sequences of SbEILs and representative EILs (AtEILs and OsEIL7) were aligned with the MUSCLE method, with their phylogenetic clades indicated with the same background colors in Figure 1. In the N-terminal DNA-binding domain, the five predicted α-helix regions are highlighted with a red background, while the proline-rich region is indicated with a yellow background. The red arrowhead indicates the Arabidopsis ein3-3 mutational site, which is very conserved between the proteins [38]. The red boxes indicate the four small clusters of basic amino acids (known as the basic domains, BD I, BD II, BD III, and BD IV). * indicates the amino acid residues that are conserved among the EIL proteins used for the alignment. The black underline indicates the putative nuclear localization signal (amino acid sequence “GPPPYKKPHDLKKAWK”) [38,39,42].
Figure 2. Alignment of the protein sequences identifies the conserved domains in the EIL proteins. Full-length protein sequences of SbEILs and representative EILs (AtEILs and OsEIL7) were aligned with the MUSCLE method, with their phylogenetic clades indicated with the same background colors in Figure 1. In the N-terminal DNA-binding domain, the five predicted α-helix regions are highlighted with a red background, while the proline-rich region is indicated with a yellow background. The red arrowhead indicates the Arabidopsis ein3-3 mutational site, which is very conserved between the proteins [38]. The red boxes indicate the four small clusters of basic amino acids (known as the basic domains, BD I, BD II, BD III, and BD IV). * indicates the amino acid residues that are conserved among the EIL proteins used for the alignment. The black underline indicates the putative nuclear localization signal (amino acid sequence “GPPPYKKPHDLKKAWK”) [38,39,42].
Plants 13 02615 g002
Plants 13 02615 g003
Figure 3. The conserved motif and gene architecture of the EIL proteins. (A) The MEME-predicted conserved motifs of SbEILs and the exon–intron architectures of the corresponding encoding genes [43]. (B) Motif logo of the EIL family. Ten motifs were predicted with the MEME software.
Figure 3. The conserved motif and gene architecture of the EIL proteins. (A) The MEME-predicted conserved motifs of SbEILs and the exon–intron architectures of the corresponding encoding genes [43]. (B) Motif logo of the EIL family. Ten motifs were predicted with the MEME software.
Plants 13 02615 g003
Plants 13 02615 g004
Figure 4. Expression profiles of SbEILs across multiple tissues and organs and developmental stages. Z-score values of the RNA-seq expression data (in FPKM) are shown in the heat map with blue and red indicating low and high expression levels, respectively. Gray means the gene was not expressed (FPKM = 0) in the corresponding tissues and stages. The expression heatmap is ordered first by the tissues/organs and then by stages. Different tissues or organs are indicated with background colors. Two pairs of WGD-derived SbEILs (i.e., SbEIL1/9 and SbEIL3/7) are labeled, with the SbEIL phylogenetic clades indicated in green, blue, and red background colors, respectively.
Figure 4. Expression profiles of SbEILs across multiple tissues and organs and developmental stages. Z-score values of the RNA-seq expression data (in FPKM) are shown in the heat map with blue and red indicating low and high expression levels, respectively. Gray means the gene was not expressed (FPKM = 0) in the corresponding tissues and stages. The expression heatmap is ordered first by the tissues/organs and then by stages. Different tissues or organs are indicated with background colors. Two pairs of WGD-derived SbEILs (i.e., SbEIL1/9 and SbEIL3/7) are labeled, with the SbEIL phylogenetic clades indicated in green, blue, and red background colors, respectively.
Plants 13 02615 g004

2.3. Expression Analysis Identifies SbEIL Members with Previously Unknown Involvements in Internode Maturation

EILs have been known as a key component of the ethylene signaling pathway and have been involved in growth and responses to biotic and abiotic stresses in the model plant species [26,33]. Sorghum has been proposed as a research model for grass bioenergy crops with high biomass yields and the stems represent a major component of the biomass [44,45]. Thus, identifying regulators involved in sorghum stem growth, maturation, and carbohydrate allocation during the post-elongation stages is of great interest [46]. To this end, we utilized the previously reported expression data sets to understand the potential roles of SbEILs in the development of sorghum stems/internodes [47,48,49,50] (Figure 5). Among the SbEILs, SbEIL2 and 8 were barely expressed in the internode. SbEIL5 was not expressed in the internode samples, while SbEIL4 was expressed at relatively low levels with variations between the data sets (Figure 5). In turn, the two pairs of WGD-duplicated SbEILs (SbEIL1/9 and SbEIL3/7) represent major EIL genes expressed in the sorghum internode samples. Particularly, we noticed that SbEIL7 which is orthologous to OsEIL6/7 (LOC_Os03g20780 and LOC_Os03g20790) was slightly down-regulated in the internode from sweet sorghum (i.e., Rio, SIL-05, and Della) but significantly up-regulated in non-sweet sorghum cultivars (BTx406 and R9188). In BTx406 internodes, the SbEIL7 expression level was increased from 80 to 216 (in FPKM), while the SbEIL7 expression level was up-regulated to a lesser extent in the R9188 internodes (from 114 to 182 FPKM values), correlating with the sugar-accumulating phenotypes between the cultivars Rio (high sugar contents), R9188 (intermediate sugar contents), and BTx406 (low sugar contents) (Figure 5A). SbEIL3 was highly expressed in the internode tissue but down-regulated after flowering in both Rio, SIL-05, and Della. The distinct expression patterns and absolute levels of SbEIL3 and 7 suggest that these two SbEILs likely play a role in sorghum internodes and their functions could be different. In rice, qPCR expression analysis indicated that OsEIL1 and 2 were the two highly expressed OsEIL members among the leaf, root, and panicle organs. Our RNA-seq analysis of SbEILs found that SbEIL7 (the syntenic ortholog of OsEILs 6 and 7 [OsEIL1 by Yang et al.], Sobic.001G387600) was the SbEIL gene with the highest expression level ranging from ~72 FPKM to 451 FPKM, whereas SbEIL3 (the syntenic ortholog of OsEIL3/OsEIL2, Sobic.002G422300) had comparable expression levels with the other SbEILs (SbEIL1 and 9), ranging from ~1 FPKM to ~15 FPKM. The expression levels of SbEIL7 were higher than the other SbEILs with one order of magnitude (Figure 4; Table S1). Thus, we reason that SbEIL7 could be the major EIL member to regulate ethylene signaling in sorghum, while other SbEILs might have regulatory roles or functions in particular cell types not abundant in the tissues.
We employed qPCR analysis to determine whether SbEIL3 and 7 could be involved in ethylene responses. BTx623 seeds were germinated with or without the treatments of ethylene or 1-methycyclopropene (1-MCP, an ethylene inhibitor), and the germinated shoots after 48 h or 72 h of the treatments were subject to expression analyses. Indeed, SbEIL3 and 7 were repressed by the ethephon treatment, while they were up-regulated in the 1-MCP treatment, consistent with the proposed expression responses to ethylene signaling (Figure 5D–G).

2.4. SbEIL7 Is Functionally Associated with Protein Degradation during Internode Maturation

Our expression analysis indicated important roles of SbEIL3 and 7 during internode development. Considering that the tandemly duplicated OsEIL6/7 (as known as OsEIL1, LOC_Os03g20780) has been reported to be a major ethylene signaling component and functions in rice root growth and development, we sought to address whether SbEIL3 and 7 could be related to ethylene signaling and the regulation of downstream genes. For this, we established a comparative transcriptome analysis scheme: (1) first, we used ethylene-related differentially expressed gene sets to analyze the SbEIL-containing co-expression modules; and (2) second, we used SbEIL-containing co-expression modules and functional enrichment analysis to gain insights into potential roles of SbEIL3 and 7 (Figure 6A). It has been demonstrated that the gene regulatory patterns between syntenic orthologous genes in closely related species could be comparable. Maize and sorghum represent such a pair of species with a close evolutionary relationship, and a set of 15,231 syntenic orthologous gene pairs was conserved between maize subgenome 1 and sorghum, and 9553 syntenic orthologous gene pairs were conserved between the maize subgenome 2 and sorghum [35,51]. We, therefore, searched the literature to identify RNA-seq expression data related to ethylene signaling in maize and sorghum, allowing us to find the data set about ethylene-related transcriptome reprogramming due to the overexpression of ZmACS7 in maize [52]. ACS7 is a well-studied ethylene biosynthetic gene in Arabidopsis thaliana involved in root growth and vascular meristem activity [53,54]. ZmACS7 overexpression enhanced ethylene release and led to accelerated leaf senescence at the low-nitrogen condition [52]. The differentially expressed genes (DEGs) between the wildtype and ZmACS7 overexpression lines (14,146 DEGs) were separated into nineteen clusters, and six gene clusters (designated as C2, C3, C9, C10, C12, and C18) revealed differential expression patterns between the WT and ZmACS7-OE lines under normal or low-nitrogen conditions, thereby reflecting ethylene-related transcriptome changes (Table S2). The expression patterns of these six ethylene-related clusters are shown in Figure 6B. According to the established syntenic orthologous relationship between maize and sorghum, we translated the six ethylene-related gene clusters from maize into sorghum geneIDs [35]. In the Rio/BTx406/R9188 co-expression data, clusters C9, C12, and C18 were significantly overlapped with the SbEIL7-containing module BTx406M2 (Phypergeometric < 0.05), leading to the gene sets potentially regulated by ethylene (namely BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18) (Figure 6C). Similarly, clusters C2, C3, C9, and C10 were significantly overlapped with SbEIL3-containing modules RioM1, producing the four gene sets potentially regulated by ethylene (namely, RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10). The C18 cluster also overlapped with the R9188M9 module that contains SbEIL3, yielding the overlapped gene set R9188M9-eth (“eth” stands for ethylene). Further, a comparison of the four gene sets RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10 demonstrated that they have few overlapped genes and could be merged into one gene set (namely RioM1-eth) to represent the genes potentially regulated by ethylene signaling and co-expressed with SbEIL3 (Figure 6D). Similarly, the gene sets BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18 were merged to be the BTx406M2-eth gene set (Figure 6E). Comparison between the gene sets of RioM1-eth (144 genes co-expressed with SbEIL3), BTx406M2-eth (215 genes co-expressed with SbEIL7), and the R9188M9-eth allows us to obtain a deeper understanding of ethylene-related transcriptome changes in sorghum internodes (Figure 6F; Table S3). The BTx406M2-eth gene set was significantly up-regulated after flowering in the internodes of BTx406 and R9188 but remained stable in Rio. The R9188M9-eth gene set was first down-regulated from the pre-anthesis to the anthesis stage, and then up-regulated during the post-anthesis stages in R9188, but remained relatively stable in the internodes from BTx406 and Rio. By contrast, the expression levels of the RioM1-eth gene set were dramatically decreased in Rio and R9188 after the T1 stage (Figure 6G).
To gain a deeper understanding of representative functions in the SbEIL-co-expressed genes, potentially ethylene-regulated gene sets, gene set enrichment analysis (GSEA) was performed (see Section 3.4 in Methods), and, interestingly, we found that these gene sets were highly enriched by protein processing- and degradation-related functions (such as “protein processing in endoplasmic reticulum”, and several gene families annotated as “ubiquitin family, RING subfamily”). Particularly, the SbEIL7 co-expressed genes (BTx406M2-eth) include a set of ubiquitin family genes (e.g., the U-box subfamily, the F-box subfamily, and the ubiquitin-conjugating enzyme (UBC) subfamily) (Figure 6H). We further plotted the expression patterns of these genes annotated as the ubiquitin-related genes and identified their Arabidopsis best BLAST hits [34] (Figure 6I). The identified ubiquitin-related genes cover a lot of gene functions in protein degradation and protein turnover, which all exhibited up-regulated expression patterns in BTx406 and R9188 but remained relatively stable in sweet sorghum Rio [55]. In particular, the autophagy gene 18 (ATG18b) was among the identified gene list, which is required for autophagy regulation during nutrient stress and senescence in Arabidopsis [56]. Additionally, the sorghum homolog of the SnRK1 subunit AKINbeta1 (AT5G21170) showed a similar expression profile as mentioned above, which is one of the key regulatory subunits of the energy regulation kinase SnRK1 [57]. Collectively, a detailed analysis of the representative functions of SbEIL-co-expressed genes implies that SbEIL7 might be involved in ethylene-mediated regulation during internode maturation stages and supports that SbEIL7 might be functionally linked with protein processing and degradation and autophagy.
Generally, our research work provides three interesting findings: (1) the SbEIL family has been expanded driven by WGD; (2) WGD-duplicated SbEIL pairs may become divergent because of the distinct expression profiles; and (3) co-expression analyses of sorghum developmental expression atlas and maize ethylene-related DEGs suggest that SbEIL7 might be functionally linked with protein processing and degradation and internode maturation. The EIL transcription factors serve as a key component of ethylene signaling conserved among higher plants and the encoding gene family has been characterized genome-wide in major cereal crops, such as rice and maize [25,26]. Notably, the previous OsEILs’ characterization provided detailed expression data, well supporting divergence between the WGD-duplicated OsEIL pairs (i.e., OsEIL3-OsEIL6/7 and OsEIL1-OsEIL9) [26]. For instance, OsEIL1 was preferentially expressed in the anther, pistil, and endosperm tissues, while OsEIL9 was highly expressed in the leaf blade, root, panicle, and embryo tissues. OsEIL3 was highly expressed in stems, panicles, and leaf blades, whereas OsEIL6 had the highest expression levels in the root, followed by leaf sheath and endosperm. Unlike SbEIL7, the rice Nipponbare genome has a tandemly duplicated EIL pair (OsEIL6 (LOC_Os03g20780) and OsEIL7 (LOC_Os03g20790)). According to public expression data of rice, OsEIL6 and 7 have likely become divergent as their expression profiles varied across different organs and developmental stages [26]. Even though the expression profiles across developmental stages and organs could not be directly compared between rice and sorghum, it appears that the two pairs of WGD-duplicated EILs might become divergent in different ways between rice and sorghum, which deserves further detailed comparisons.
It is interesting that we discovered a potential link between SbEIL7 and protein degradation-related genes, such as several components in the ubiquitin–proteasome system (UPS, Figure 6H,I). It is noteworthy that whether SbEIL7 or ethylene signaling has a functional relationship with ubiquitin-mediated protein degradation remains to be experimentally investigated, as co-expression analysis was only employed here, which is one limitation of the present study. The UPS requires three types of enzymes, including ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin ligases (usually known as the E1, E2, and E3 enzymes, respectively) [58]. The ubiquitin E3 enzyme, as the UPS component with the most members, can be further divided into single-subunit subfamilies (including the HECT (homology to E6-AP C-terminus) group and the RING (really interesting new gene) group) and multi-subunit subfamilies, with the latter including the SKP1-Cullin 1-F-box (SCF) group, the VHL-ELONGIN-CUL2/5 group, the BTB-CUL3 group, the UV-damaged DNA-binding protein 1-Cullin 4 (DDB-CUL4) group, and the anaphase-promoting complex (APC) group. Among the SbEIL7-co-expressing genes related to protein degradation, we found two genes encoding E2 enzymes (homologs of AT1G64230 and AT3G15355), and several genes encoding F-box E3 enzymes (the homologs of AT3G26922, AT5G27920, and AT1G21760) and RING-type E3 enzymes (the homologs of AT5G10650; Figure 6I). The SCF complex requires both F-box proteins and RING box1 proteins, among which the F-box proteins determine the target specificity of UPS [59,60]. Particular F-box-encoding genes were identified to be co-expressed with SbEIL7 which implies that the SbEIL7-associated protein degradation might target certain proteins. Our speculation emphasizes the necessity to obtain genetic materials of sorghum in which SbEIL7 was silenced by RNAi or knocked out by the CRISPR-Cas editing technology. In addition, the treatments of ethylene and ethylene inhibitors to sorghum internodes might help validate the relationship between ethylene signaling, protein degradation, and internode maturation. The ubiquitination-mediated protein degradation process also serves as an important step to regulate ethylene signaling, as EIN3 BINDING F-BOX1/2 (EBF1/2) are the two F-box proteins specifically targeting EIN3/EIL1 and mediate EIN3/EIL1 proteolytic cleavage [12]. Our search for gene functions with the TAIR database and in the literature failed to identify any links between EBF1/2 and the Arabidopsis protein degradation-related homologs identified herein, thus leaving us to speculate that the F-box proteins here highly expressed in sorghum internodes might have targets yet to be discovered. In addition, we noted that these protein degradation-related genes were highly expressed in BTx406 and R9188, two sorghum cultivars that could not accumulate high contents of sugars (Figure 6I). Previous comparative transcriptomic studies suggest that sweet sorghum cultivars (such as Rio) have active cell metabolic status and the internodes become one of the sink organs, while in non-sweet cultivars, the internodes have inactive metabolic status and are subject to controlled senescence, and the filling seeds, but not the internodes, are the sink organ [50]. This allows us to imagine that during the late stages (e.g., 15 days after anthesis), internodes of BTx406 or R9188 may begin to become senescent, in which protein degradation to facilitate nitrogen remobilization is an important step [61]. In line with the protein degradation and senescence process, ethylene is a known phytohormone to positively regulate senescence of leaves and other organs (e.g., flowers) [62,63]. To summarize, this work leads us to the future research direction regarding the roles of ethylene signaling in internode maturation and senescence in non-sweet sorghum internodes.

3. Materials and Methods

3.1. Genome-Wide Identification and Sequence Analysis of Sorghum EILs

To identify SbEIL genes in a genome-wide manner, a combination of both the BLAST-based method and protein domain searching method was employed. The reference genome of sorghum cultivar BTx623 v3.1.1 was downloaded from Phytozome v13 [64], while the maize genome B73 v4 was used from the maizeGDB database [65]. The rice (Oryza sativa ssp. japonica) reference genome of Nipponbare was obtained from EnsemblPlants, and the Arabidopsis genome was from the TAIR 10.0 database [66]. For BLAST-based identification, the protein sequences of AtEILs and OsEILs were determined according to previous studies and used for BLAST [15,18,26,38]. For protein domain searching, the hidden Markov model (HMM) of the EIN3 domain (PF04873) was downloaded and used for gene identification with the Simple HMM Search function (E-value < 10−10) of the TBtools II package [67]. After combining the identified proteins from both methods, the SbEIL proteins were further validated by confirming whether they contain a complete EIN3 domain with the InterPro website (http://www.ebi.ac.uk/interpro/; accessed on 30 May 2024). The pI, molecular weight, instability index, and aliphatic index of SbEIL proteins were predicted with the ProtParam tool (https://web.expasy.org/protparam/; accessed on 30 May 2024). Subcellular localization was predicted with the WOLF PSORT tool (https://wolfpsort.hgc.jp; accessed by 30 May 2024).

3.2. Phylogenetic Analysis Sorghum EILs

The protein sequences of OsEILs, AtEILs, and ZmEILs were used for phylogenetic analysis, while all predicted protein sequences of SbEIL transcripts were used. The protein sequences were aligned with the MUSCLE method [68]. The phylogenetic tree was constructed for the EIL family proteins with the maximum-likelihood method with 1000 bootstrap replicates by using the MEGA-X software [69]. An iTOL tree was used to help with the visualization of the phylogenetic tree [70]. To interpret the phylogenetic clades from evolutionary perspectives, the information regarding the ancient whole-genome duplication of Poaceae grasses, paleo-tetraploidization of maize, and maize–sorghum comparative genomics were used based on previous studies [28,29,30,31,35].

3.3. Expression Analysis of Sorghum EIL

The expression profiles of SbEILs were investigated from two aspects: one is the global expression across multiple tissues, organs, and developmental stages, while the other one focuses on the time-series internode expression and identifies SbEIL members involved in internode elongation and/or maturation.
First, the BTx623 expression atlas including several tissues/organs and stages was investigated, which includes five types of tissues and organs (i.e., leaf, stem/internode, panicle, seed, and root) as well as the shoots and roots under various nitrogen treatments (e.g., water without nitrogen, urea, nitrate, and ammonium) [34]. Developmental stages, such as juvenile, vegetative, floral initiation, anthesis, and grain maturity stages, were also included in the analysis. Second, time-series RNA-seq data of the sweet sorghum cultivar Della’s internodes were analyzed, ranging from floral induction (the A-29 stage) to post maturity (the A+43 and A+68 stages) [47]. For the Della internode RNA-seq data, “A” stands for anthesis, while the stages are named relative to the days before or after anthesis. In addition, two sets of comparative RNA-seq data were used. Rio, BTx406, and R9188 are three genetically related and phenotypically contrasting accessions. Rio is a representative sweet sorghum accumulating high contents of soluble sugars in the stem [71,72], while BTx406 is a juicy stem dwarf grain sorghum, with R9188 being the introgression line with most parts of the genetic background from Rio [49]. The expression profiles at four time points were analyzed, including the flag leaf stage, flowering, and 10 and 15 days after flowering, namely T1, T2, T3, and T4, respectively. Another comparative RNA-seq data set is the leaf, panicle, and internode tissue from the Japanese sweet sorghum SIL-05 sampled at 1 day, 17 days, and 36 days after heading [48]. In short, the Della, Rio/BTx406/R9188, and SIL-05 data sets make up an effective resource for identifying genes involved in the cessation of internode elongation, maturation, and carbohydrate metabolism from independent cultivars [50].

3.4. Co-Expression Networks and Functional Enrichment Analysis

Co-expression modules represent groups of genes with highly interconnected expression patterns across multiple samples and often include representative gene sets with similar biological functions [73]. Thus, co-expression networks of sorghum internode RNA-seq data serve as additional resources to further identify candidate genes related to certain biological functions in the internode. The co-expression modules of the internodes of Rio, BTx406, and R9188 have been constructed with the weighted gene expression network analysis (available as supplemental files in the corresponding reference) [49]. The co-expression modules containing SbEIL3 and SbEIL7 were analyzed for their enriched functions with gene ontology (GO) annotations. Functional enrichment analysis was performed with the gene set enrichment analysis (GSEA) function of the SorghumFDB (with the hypergeometric test and significance determined by using the Hochberg-adjusted FDR < 0.05) [74,75].
In addition, to identify the sorghum genes potentially regulated by the ethylene signaling pathway in the internode, RNA-seq data sets related to ethylene signaling were searched for in the literature. The ethylene-regulated gene sets in maize were obtained by comparing ZmACS7 overexpression lines and their corresponding wildtype, and further transferred to sorghum geneIDs by using the established gene orthologous relationships between sorghum and maize considering the fact that the split of the progenitors of sorghum and maize was ~12 million years ago (MYAs) and a large portion of the orthologs could be conserved and comparable between sorghum and maize [35,52,76].

3.5. Quantitative Polymerase Chain Reaction (qPCR) Analysis

Seeds of sorghum cultivar BTx623 were germinated in Petri dishes with the treatment of ethephon (50 μM), 200 mg/L 1-MCP (ethylene inhibitor), or water (control), respectively. The germinated shoots were sampled at 48 h or 72 h after the treatment for RNA extraction, with the experiments carried out in triplicates. Total RNA was extracted by using an RNA Extraction Kit (Zomanbio, Beijing, China) and reversely transcribed into cDNA for qRT-PCR as described previously [50]. qPCR reactions were conducted by using SYBR Green Master Mix with the CFX96 real-time System (Bio-RAD, Hercules, CA, USA). Relative expression levels were calculated using the ΔΔCT method with the sorghum ubiquitin gene used as the internal reference for qPCR analysis [51]. For the quantification of Sobic.002G422300, the forward primer is “GAGACGATGGCGATGACCTTCC” (from 5′ to 3′), while the reverse primer is “GGTCACTGATCTGCTGCTGCTG”. For the quantification of Sobic.001G387600, the forward and reverse primers are “TCCAAGTGCCTCCAGGACAAGA” (from 5′ to 3′) and “GCGATGCCACCAGTAGATGCT” (from 5′ to 3′), respectively.

4. Conclusions

In conclusion, our work identified eight SbEIL-encoding genes in sorghum and revealed their evolution trajectory, highlighting the values of combining genome-wide analysis and duplication information and the WGD-driven expansion of SbEILs. Comprehensive expression analyses demonstrated the divergence of the potential functions between WGD-duplicated SbEIL pairs could be due to differentiated expression profiles. Moreover, we characterized SbEIL3 and 7 to be the EIL members involved in internode development and maturation. Specifically, SbEIL7, the syntenic ortholog of duplicated OsEIL6/7 (the master transcription factors for the ethylene signaling in rice), might be linked to biological functions during internode maturation, such as protein processing and degradation. These results lay a foundation for functional studies for ethylene signaling-mediated gene regulation and deepen our understanding of the physiological and molecular differences in internode development between sweet and grain sorghum cultivars.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants13182615/s1: Figure S1: The similarity matrix between SbEIL and OsEIL proteins. The protein similarity matrix reflecting the sequence identity between each pair of OsEILs and SbEILs was calculated with the Clustal-Omega program on the EMBL website. OsEILs and SbEILs were aligned with the Clustal-Omega method. The sequence similarity percentages (ranging from 0% to 100%) are shown in the heatmap with blue and red indicating the lowest and highest sequence similarity percentages, respectively. OsEILs and SbEILs belonging to the same phylogenetic clades (Figure 1) are indicated with black boxes, and the gene names of OsEILs are given in green backgrounds; Table S1: Expression profiles of the SbEILs in the BTx623 expression atlas (expression values are given as FPKM) (provided in a separate EXCEL file); Table S2: The geneIDs translated from maize ethylene-regulated gene sets (i.e., C2, C3, C9, C10, C12, and C18) (provided in a separate EXCEL file); Table S3. The gene sets overlapped between SbEIL-containing co-expression modules of Rio/BTx406/R9188 and those potentially regulated by ethylene (C2, C3, C9, C10, C12, and C18), yielding an overlap (provided in a separate EXCEL file).

Author Contributions

Conceptualization, methodology, resources, supervision, project administration, writing—original draft preparation, writing—review and editing, funding acquisition, M.T.; methodology, investigation, writing—original draft preparation, writing—review and editing, Y.H. (Yuqing Hua); methodology, investigation, T.S., S.Z., Z.X., M.Y., G.W. and Z.L.; project administration, resources, Y.H. (Yun He) and L.Y.; conceptualization, methodology, resources, supervision, project administration, writing—original draft preparation, writing—review and editing, funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Natural Science Foundation of Hubei Province of China (2024AFB955, to Min Tu), the Start-Up Research Funding of Wuhan Polytechnic University (2021RZ100 and 53210052172), the Research Project of Wuhan Polytechnic University (2023Y24), the Opening Fund of Hubei Key Laboratory of Bioinorganic Chemistry & Materia Medica (BCMM202205), and the “Chong, Bu, Qiang” Higher Education Promotion Project of Guangdong Province (Shaoguan University, to Y.L. and M.T.). This work was also supported by the National Natural Science Foundation of China (32272126) and the Fundamental Research Funds for Central Universities, HUST, to Yin Li (2021XXJS070 and 3004170157).

Data Availability Statement

The data presented in this study are available in the article and the Supplementary Materials. For further inquiries, you can contact the corresponding author directly.

Acknowledgments

We acknowledge the Core Facility of Life Sciences, HUST, for providing instrumental service.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abeles, F.B.; Morgan, P.W.; Saltveit, J.M.E. Ethylene in Plant Biology; Academic Press: San Diego, CA, USA, 1992. [Google Scholar]
  2. Johnson, P.R.; Ecker, J.R. The ethylene gas signal transduction pathway: A molecular perspective. Annu. Rev. Genet. 1998, 32, 227–254. [Google Scholar] [CrossRef] [PubMed]
  3. Guo, H.; Ecker, J.R. The ethylene signaling pathway: New insights. Curr. Opin. Plant Biol. 2004, 7, 40–49. [Google Scholar] [CrossRef] [PubMed]
  4. Ma, B.; Yin, C.C.; He, S.J.; Lu, X.; Zhang, W.K.; Lu, T.G.; Chen, S.-Y.; Zhang, J.S. Ethylene-induced inhibition of root growth requires abscisic acid function in rice (Oryza sativa L.) seedlings. PLoS Genet. 2014, 10, e1004701. [Google Scholar] [CrossRef] [PubMed]
  5. Kieber, J.J.; Rothenberg, M.; Roman, G.; Feldmann, K.A.; Ecker, J.R. CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 1993, 72, 427–441. [Google Scholar] [CrossRef] [PubMed]
  6. Guo, H.W.; Ecker, J.R. Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. Cell 2003, 115, 667–677. [Google Scholar] [CrossRef]
  7. Huang, Y.; Li, H.; Hutchison, C.E.; Laskey, J.; Kieber, J.J. Biochemical and functional analysis of CTR1, a protein kinase that negatively regulates ethylene signaling in Arabidopsis. Plant J. 2003, 33, 221–233. [Google Scholar] [CrossRef]
  8. Ju, C.; Yoon, G.M.; Shemansky, J.M.; Lin, D.Y.; Ying, Z.I.; Chang, J.; Garrett, W.M.; Kessenbrock, M.; Groth, G.; Tucker, M.L.; et al. CTR1 phosphorylates the central regulator EIN2 to control ethylene hormone signaling from the ER membrane to the nucleus in Arabidopsis. Proc. Natl. Acad. Sci. USA 2012, 109, 19486–19491. [Google Scholar] [CrossRef]
  9. Qiao, H.; Shen, Z.; Huang, S.S.; Schmitz, R.J.; Urich, M.A.; Briggs, S.P.; Ecker, J.R. Processing and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science 2012, 338, 390–393. [Google Scholar] [CrossRef]
  10. Chao, Q.; Rothenberg, M.; Solano, R.; Roman, G.; Terzaghi, W.; Ecker, J.R. Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ethylene insensive3 and related proteins. Cell 1997, 89, 1133–1144. [Google Scholar] [CrossRef]
  11. Alonso, J.M.; Stepanova, A.N.; Solano, R.; Wisman, E.; Ferrari, S.; Ausubel, F.M.; Ecker, J.R. Five components of the ethylene response pathway identified in a screen for weak ethylene- insensitive mutants in Arabidopsis. Proc. Natl. Acad. Sci. USA 2003, 100, 2992–2997. [Google Scholar] [CrossRef]
  12. Potuschak, T.; Lechner, E.; Parmentier, Y.; Yanagisawa, S.; Grava, S.; Koncz, C.; Genschik, P. EIN3-dependent regulation of plant ethylene hormone signaling by two Arabidopsis F-box proteins: EBF1 and EBF2. Cell 2003, 115, 679–689. [Google Scholar] [CrossRef] [PubMed]
  13. Gagne, J.M.; Smalle, J.; Gingerich, D.J.; Walker, J.M.; Yoo, S.D.; Yanagisawa, S.; Vierstra, R.D. Arabidopsis EIN3- binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. Proc. Natl. Acad. Sci. USA 2004, 101, 6803–6808. [Google Scholar] [CrossRef] [PubMed]
  14. An, F.; Zhao, Q.; Ji, Y.; Li, W.; Jiang, Z.; Yu, X.; Zhang, C.; Han, Y.; He, W.; Liu, Y.; et al. Ethylene induced stabilization of ethylene insensive3 and EIN3-LIKE1 is mediated by proteasomal degradation of EIN3 binding F-box 1 and 2 that requires EIN2 in Arabidopsis. Plant Cell 2010, 22, 2384–2401. [Google Scholar] [CrossRef] [PubMed]
  15. Maruyama-Nakashita, Y.; Nakamura, T.; Tohge, K.; Saito, H.T. Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism. Plant Cell 2006, 18, 3235–3251. [Google Scholar] [CrossRef]
  16. Zhu, X.; Qi, L.; Liu, X.; Cai, S.; Xu, H.; Huang, R.; Li, J.; Wei, X.; Zhang, Z. The wheat ethylene response factor transcription factor pathogen-induced ERF1 mediates host responses to both the necrotrophic pathogen Rhizoctonia cerealis and freezing stresses. Plant Physiol. 2014, 164, 1499–1514. [Google Scholar] [CrossRef]
  17. Qin, F.; Sakuma, Y.; Li, J.; Liu, Q.; Shinozaki, K.; Yamagushi- Shinozaki, K. Cloning and functional analysis of a novel DREB1/CBF transcription factor involved in cold-responsive gene expression in Zea mays L. Plant Cell Physiol. 2004, 45, 1042–1052. [Google Scholar] [CrossRef]
  18. Hiraga, S.; Sasaki, K.; Hibi, T.; Yoshida, H.; Uchida, E.; Kosugi, S.; Kato, T.; Mie, T.; Ito, H.; Katou, S.; et al. Involvement of two rice ethylene insensive3-like genes in wound signaling. Mol. Genet. Genom. 2009, 282, 517–529. [Google Scholar] [CrossRef]
  19. Yang, C.; Ma, B.; He, S.; Xiong, Q.; Duan, K.; Yin, C.; Chen, H.; Lu, X.; Chen, S.; Zhang, J. Maohuzi6/ethylene insensive3-like1 and ethylene insensive3-like2 regulate ethylene response of roots and coleoptiles and negatively affect salt tolerance in rice. Plant Physiol. 2015, 169, 148–165. [Google Scholar] [CrossRef]
  20. Ma, F.; Yang, X.; Shi, Z.; Miao, X. Novel crosstalk between ethylene- and jasmonic acid-pathway responses to a piercing–sucking insect in rice. New Physiologist. 2020, 225, 474–487. [Google Scholar] [CrossRef]
  21. Liu, C.; Ma, T.; Yuan, T.; Zhou, Y.; Long, Y.; Li, Z.; Dong, Z.; Duan, M.; Yuan, D.; Wan, X. The OsEIL1-OsERF115-target gene regulatory module controls grain size and weight in rice. Plant Biotechnol. J. 2022, 20, 1470–1486. [Google Scholar] [CrossRef]
  22. Zhou, Y.; Ma, B.; Tao, J.; Yin, C.; Hu, Y.; Huang, Y.; Wei, W.; Xin, P.; Zhang, J.S. Rice EIL1 interacts with OsIAAs to regulate auxin biosynthesis mediated by the tryptophan aminotransferase MHZ10/OsTAR2 during root ethylene responses. Plant Cell 2022, 34, 4366–4387. [Google Scholar] [CrossRef] [PubMed]
  23. Mao, C.; Wang, S.; Jia, Q.; Wu, P. OsEIL1, a rice homolog of the Arabidopsis EIN3 regulates the ethylene response as a positive component. Plant Mol. Biol. 2006, 61, 141–152. [Google Scholar] [CrossRef] [PubMed]
  24. Huang, J.; Qiu, Z.; He, J.; Xu, H.; Wang, K.; Du, H.; Gao, D.; Wan, J. Phytochrome B mediates dim-light-reduced insect resistance by promoting the ethylene pathway in rice. Plant Physiol. 2023, 191, 1272–1287. [Google Scholar] [CrossRef] [PubMed]
  25. Jyoti, S.D.; Azim, J.B.; Robin, A.H.K. Genome-wide characterization and expression profiling of EIN3/EIL family genes in Zea mays. Plant Gene 2021, 25, 100270. [Google Scholar] [CrossRef]
  26. Aluko, O.; Ninkuu, V.; Ziemah, J.; Yan, J.; Taiwo, E.; Ninkuu, S.; Sabuli, N.; Adetunde, L.A.; Imoro, A.W.M.; Ozavize, S.F.; et al. Genome-wide identification and expression analysis of EIN3/EIL gene family in rice (Oryza sativa). Plant Stress 2024, 12, 100437. [Google Scholar] [CrossRef]
  27. He, Y.; Huang, W.; Yang, L.; Li, Y.; Lu, C.; Zhu, Y.; Ma, D.; Yin, J. Genome-wide analysis of ethylene-insensitive3 (EIN3/EIL) in Triticum aestivum. Crop Sci. 2020, 60, 2019–2037. [Google Scholar] [CrossRef]
  28. Paterson, A.H.; Bowers, J.E.; Chapman, B.A. Ancient polyploidization predating divergence of the cereals, and its consequences for comparative genomics. Proc. Natl. Acad. Sci. USA 2004, 101, 9903–9908. [Google Scholar] [CrossRef]
  29. Salse, J.; Bolot, S.; Throude, M.; Jouffe, V.; Piegu, B.; Quraishi, U.M.; Calcagno, T.; Cooke, R.; Delseny, M.; Feuillet, C. Identification and characterization of shared duplications between rice and wheat provide new insight into grass genome evolution. Plant Cell 2008, 20, 11–24. [Google Scholar] [CrossRef]
  30. Wei, F.; Coe, E.; Nelson, W.; Bharti, A.K.; Engler, F.; Butler, E.; Wing, R. Physical and genetic structure of the maize genome reflects its complex evolutionary history. PLoS Genet. 2007, 3, e123. [Google Scholar] [CrossRef]
  31. Bruggmann, R.; Bharti, A.K.; Gundlach, H.; Lai, J.; Young, S.; Pontaroli, A.C.; Messing, J. Uneven chromosome contraction and expansion in the maize genome. Genome Res. 2006, 16, 1241–1251. [Google Scholar] [CrossRef]
  32. Wu, Y.; Feng, J.; Zhang, Q.; Wang, Y.; Guan, Y.; Wang, R.; Shi, F.; Zeng, F.; Wang, Y.; Chen, M.; et al. Integrative gene duplication and genome-wide analysis as an approach to facilitate wheat reverse genetics: An example in the TaCIPK family. J. Adv. Res. 2024, 61, 19–33. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, C.; Lu, X.; Ma, B.; Chen, S.-Y.; Zhang, J.-S. Ethylene Signaling in Rice and Arabidopsis: Conserved and Diverged Aspects. Mol. Plant. 2015, 8, 495–505. [Google Scholar] [CrossRef]
  34. McCormick, R.F.; Truong, F.K.; Sreedasyam, A.; Jenkins, J.; Shu, S.; Sims, D.; Kennedy, M.; Amirebrahimi, M.; Weers, B.D.; McKinley, B.; et al. The sorghum bicolor reference genome: Improved assembly, gene annotations, a transcriptome atlas, and signatures of genome organization. Plant J. 2018, 93, 338–354. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, Y.; Ngu, D.W.; Carvalho, D.; Liang, Z.; Qiu, Y.; Roston, R.L.; Schnable, J.C. Differentially regulated orthologs in sorghum and the subgenomes of maize. Plant Cell 2017, 29, 1938–1951. [Google Scholar] [CrossRef] [PubMed]
  36. Ikai, A. Thermostability and Aliphatic Index of Globular Proteins. J. Biochem. 1980, 88, 1895–1898. [Google Scholar] [CrossRef]
  37. Idicula-Thomas, S.; Balaji, P.V. Understanding the relationship between the primary structure of proteins and its propensity to be soluble on overexpression in Escherichia coli. Protein Sci. 2005, 14, 582–592. [Google Scholar] [CrossRef]
  38. Yamasaki, K.; Kigawa, T.; Inoue, M.; Yamasaki, T.; Yabuki, T.; Aoki, M.; Yokoyama, S. Solution structure of the major DNA-binding domain of Arabidopsis thaliana ethylene-insensitive3-like3. J. Mol. Biol. 2005, 348, 253–264. [Google Scholar] [CrossRef]
  39. Shi, Q.L.; Dong, Y.; Qiao, D.; Zhou, Q.; Zhang, L.; Ma, Z.; Li, Y. Characterization and functional analysis of transcription factor ZmEIL1 in maize. Biol. Plantarum. 2017, 61, 261–274. [Google Scholar] [CrossRef]
  40. Sang, J.; Zou, D.; Wang, Z.; Wang, F.; Zhang, Y.; Xia, L.; Li, Z.; Ma, L.; Li, M.; Xu, B.; et al. IC4R-2.0: Rice genome reannotation using massive RNA-seq data. Genom. Proteom. Bioinf. 2020, 18, 161–172. [Google Scholar] [CrossRef]
  41. Yu, Z.; Chen, Y.; Zhou, Y.; Zhang, Y.; Li, M.; Ouyang, Y.; Zhang, J. Rice Gene Index: A comprehensive pan-genome database for comparative and functional genomics of Asian rice. Mol. Plant. 2023, 16, 798–801. [Google Scholar] [CrossRef]
  42. Song, J.; Zhu, C.; Zhang, X.; Wen, X.; Liu, L.; Peng, J.; Guo, H.; Yi, C. Biochemical and Structural Insights into the Mechanism of DNA Recognition by Arabidopsis ETHYLENE INSENSITIVE3. PLoS ONE 2015, 10, e0137439. [Google Scholar] [CrossRef] [PubMed]
  43. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  44. Calvino, M.; Messing, J. Sweet sorghum as a model system for bioenergy crops. Curr. Opin. Biotechnol. 2012, 23, 323–329. [Google Scholar] [CrossRef] [PubMed]
  45. Mathur, S.; Umakanth, A.V.; Tonapi, V.A.; Sharma, R.; Sharma, M.K. Sweet sorghum as biofuel feedstock: Recent advances and available resources. Biotechnol. Biofuel. 2017, 10, 146. [Google Scholar] [CrossRef]
  46. Yang, L.; Zhou, Q.; Sheng, X.; Chen, X.; Hua, Y.; Lin, S.; Luo, Q.; Yu, B.; Shao, T.; Wu, Y.; et al. Harnessing the genetic basis of sorghum biomass-related traits to facilitate bioenergy applications. Int. J. Mol. Sci. 2023, 24, 14549. [Google Scholar] [CrossRef]
  47. McKinley, B.; Rooney, W.; Wilkerson, C.; Mullet, J. Dynamics of biomass partitioning, stem gene expression, cell wall biosynthesis, and sucrose accumulation during development of Sorghum bicolor. Plant J. 2016, 88, 662–680. [Google Scholar] [CrossRef]
  48. Mizuno, H.; Kasuga, S.; Kawahigashi, H. The sorghum SWEET gene family: Stem sucrose accumulation as revealed through transcriptome profiling. Biotechnol. Biofuels 2016, 9, 127. [Google Scholar] [CrossRef]
  49. Li, Y.; Wang, W.; Feng, Y.; Tu, M.; Wittich, P.E.; Bate, N.J.; Messing, J. Transcriptome and metabolome reveal distinct carbon allocation patterns during internode sugar accumulation in different Sorghum genotypes. Plant Biotechnol. J. 2019, 17, 472–487. [Google Scholar] [CrossRef]
  50. Li, Y.; Tu, M.; Feng, Y.; Wang, W.; Messing, J. Common metabolic networks contribute to carbon sink strength of Sorghum internodes: Implications for bioenergy improvement. Biotechnol. Biofuels 2019, 12, 274. [Google Scholar] [CrossRef]
  51. Swigonová, Z.; Lai, J.; Ma, J.; Ramakrishna, W.; Llaca, V.; Bennetzen, J.L.; Messing, J. Close split of sorghum and maize genome progenitors. Genome Res. 2004, 14, 1916–1923. [Google Scholar] [CrossRef]
  52. Xing, J.; Feng, Y.; Zhang, Y.; Wang, Y.; Li, Z.; Zhang, M. Ethylene accelerates maize leaf senescence in response to nitrogen deficiency by regulating chlorophyll metabolism and autophagy. Crop J. 2024; Epub ahead of print. [Google Scholar] [CrossRef]
  53. Huang, S.J.; Chang, C.L.; Wang, P.H.; Tsai, M.C.; Hsu, P.H.; Chang, I.F. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana. J. Exp. Bot. 2013, 64, 4343–4360. [Google Scholar] [CrossRef] [PubMed]
  54. Yang, S.; Wang, S.; Li, S.; Du, Q.; Qi, L.; Wang, W.; Chen, J.; Wang, H. Activation of ACS7 in Arabidopsis affects vascular development and demonstrates a link between ethylene synthesis and cambial activity. J. Exp. Bot. 2020, 71, 7160–7170. [Google Scholar] [CrossRef] [PubMed]
  55. Eckardt, N.A.; Avin-Wittenberg, T.; Bassham, D.C.; Chen, P.; Chen, Q.; Fang, J.; Zhang, H. The lowdown on breakdown: Open questions in plant proteolysis. Plant Cell 2024, 36, 2931–2975. [Google Scholar] [CrossRef] [PubMed]
  56. Xiong, Y.; Contento, A.L.; Bassham, D.C. AtATG18a is required for the formation of autophagosomes during nutrient stress and senescence in Arabidopsis thaliana. Plant J. 2005, 42, 535–546. [Google Scholar] [CrossRef] [PubMed]
  57. Figueroa, C.M.; Lunn, J.E. A tale of two sugars: Trehalose 6- phosphate and sucrose. Plant Physiol. 2016, 172, 7–27. [Google Scholar] [CrossRef]
  58. Sadanandom, A.; Bailey, M.; Ewan, R.; Lee, J.; Nelis, S. The ubiquitin-proteasome system: Central modifier of plant signalling. New Phytol. 2012, 196, 13–28. [Google Scholar] [CrossRef]
  59. Lechner, E.; Achard, P.; Vansiri, A.; Potuschak, T.; Genschik, P. F-box proteins everywhere. Curr. Opin. Plant Biol. 2006, 9, 631–638. [Google Scholar] [CrossRef]
  60. Zhang, X.; Gonzalez-Carranza, Z.H.; Zhang, S.; Miao, Y.; Liu, C.; Roberts, J.A. F-box proteins in plants. Annu. Plant Rev. 2019, 2, 307–328. [Google Scholar] [CrossRef]
  61. Have, M.; Marmagne, A.; Chardon, F.; Masclaux-Daubresse, C. Nitrogen remobilization during leaf senescence: Lessons from Arabidopsis to crops. J. Exp. Bot. 2017, 68, 2513–2529. [Google Scholar] [CrossRef]
  62. Mei, Y.; Wang, N. New insights into the regulation of ethylene biosynthesis during leaf senescence in Arabidopsis. New Phytol. 2024, 244, 5–6. [Google Scholar] [CrossRef]
  63. Dar, R.A.; Nisar, S.; Tahir, I. Ethylene: A key player in ethylene sensitive flower senescence: A review. Sci. Hortic. 2021, 290, 110491. [Google Scholar] [CrossRef]
  64. David, M.; Goodstein; Sheng, Q.S.; Russell, H.; Rochak, N.; Richard, D.; Hayes, J.F.; Therese, M.; William, D.; Uffe, H.; et al. Phytozome: A comparative platform for green plant genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef]
  65. John, L.P., II; Margaret, R.W.; Ethalinda, K.C.; Jack, M.G.; Lisa, C.H.; Mary, L.S.; Jesse, R.W.; Taner, Z.S.; Kyoung, T.C.; David, A.S.; et al. MaizeGDB 2018: The maize multi-genome genetics and genomics database. Nucleic Acids Res. 2018, 47, D1146–D1154. [Google Scholar] [CrossRef]
  66. Philippe, L.; Tanya, Z.B.; Donghui, L.; David, S.; Christopher, W.; Rajkumar, S.; Robert, M.; Kate, D.; Debbie, L.A.; Margarita, G.; et al. The Arabidopsis Information Resource (TAIR): Improved gene annotation and new tools. Nucleic Acids Res. 2012, 40, D1202–D1210. [Google Scholar] [CrossRef]
  67. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
  68. Madeira, F.; Madhusoodanan, N.; Lee, J.; Eusebi, A.; Niewielska, A.; Tivey, A.R.N.; Lopez, R.; Butcher, S. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acid Res. 2024, 52, W521–W525. [Google Scholar] [CrossRef]
  69. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  70. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
  71. Li, Y.; Mehta, S.; Messing, J. A new high-throughput assay for determining soluble sugar in Sorghum internode-extracted juice. Planta 2018, 248, 785–793. [Google Scholar] [CrossRef]
  72. Cooper, E.A.; Brenton, Z.W.; Flinn, B.S.; Jenkins, J.; Shu, S.; Flowers, D.; Kresovich, S. A new reference genome for Sorghum bicolor reveals high levels of sequence similarity between sweet and grain genotypes: Implications for the genetics of sugar metabolism. BMC Genom. 2019, 20, 420. [Google Scholar] [CrossRef]
  73. Gupta, C.; Pereira, A. Recent advances in gene function prediction using context-specific coexpression networks in plants. F1000Research 2019, 8, 153. [Google Scholar] [CrossRef] [PubMed]
  74. Yi, X.; Du, Z.; Su, Z. PlantGSEA: A Gene Set Enrichment Analysis toolkit for plant community. Nucleic Acids Res. 2013, 41, W98–W103. [Google Scholar] [CrossRef] [PubMed]
  75. Tian, T.; You, Q.; Zhang, L.; Yi, X.; Yan, H.; Xu, W.; Su, Z. SorghumFDB: Sorghum functional genomics database with multidimensional network analysis. Database 2016, 2016, baw099. [Google Scholar] [CrossRef] [PubMed]
  76. Xu, J.; Messing, J. Organization of the prolamin gene family provides insight into the evolution of the maize genome and gene duplications in grass species. Proc. Natl. Acad. Sci. USA 2008, 105, 14330–14335. [Google Scholar] [CrossRef]
Plants 13 02615 g001
Figure 1. Phylogenetic analysis of the SbEIL family. The protein sequences of SbEILs, OsEILs, ZmEILs, and AtEILs were used in the phylogenetic analysis, with the EIL protein sequences aligned with the MUSCLE method and the tree constructed with the maximum-likelihood method by using the MEGA-X software. A total of 1000 bootstrap replicates were applied, with the supporting values for each branch shown in the tree. The nomenclature of AtEILs is according to a previous study and labeled in blue font in the figure, while the OsEILs and SbEILs are named following Aluko et al. and labeled with black and red fonts, respectively [26]. EILs from the monocot species (i.e., rice, maize, and sorghum) are phylogenetically divided into three clades (A, B, and C, shown with the background color green, blue, and red, respectively). Red bars indicate tandem duplicated OsEIL genes, while the black bars indicate the whole-genome-duplicated ZmEILs during the paleo-tetraploidization process of the maize genome [35]. Gray arcs indicate the OsEILs generated by the ancient whole-genome duplication events of the Poaceae species [28,29]. SbEILs are highlighted with white dots. Predicted SbEIL proteins from multiple encoding transcripts were used in the phylogenetic analysis, whereas the longest OsEILs and ZmEILs produced from the same gene were used.
Figure 1. Phylogenetic analysis of the SbEIL family. The protein sequences of SbEILs, OsEILs, ZmEILs, and AtEILs were used in the phylogenetic analysis, with the EIL protein sequences aligned with the MUSCLE method and the tree constructed with the maximum-likelihood method by using the MEGA-X software. A total of 1000 bootstrap replicates were applied, with the supporting values for each branch shown in the tree. The nomenclature of AtEILs is according to a previous study and labeled in blue font in the figure, while the OsEILs and SbEILs are named following Aluko et al. and labeled with black and red fonts, respectively [26]. EILs from the monocot species (i.e., rice, maize, and sorghum) are phylogenetically divided into three clades (A, B, and C, shown with the background color green, blue, and red, respectively). Red bars indicate tandem duplicated OsEIL genes, while the black bars indicate the whole-genome-duplicated ZmEILs during the paleo-tetraploidization process of the maize genome [35]. Gray arcs indicate the OsEILs generated by the ancient whole-genome duplication events of the Poaceae species [28,29]. SbEILs are highlighted with white dots. Predicted SbEIL proteins from multiple encoding transcripts were used in the phylogenetic analysis, whereas the longest OsEILs and ZmEILs produced from the same gene were used.
Plants 13 02615 g001
Plants 13 02615 g005
Figure 5. Comparative expression analysis of SbEILs in the internode tissues between several sorghum cultivars. (A) The heat map showing the expression profiles of SbEILs in three genetically related but phenotypically contrasting sorghum cultivars (sweet sorghum Rio, grain sorghum BTx406, and introgression line R9188). (B) The heat map showing SbEILs’ expression profiles at the leaf, stem, and panicle tissues 1 day after heading (1 DAH), 17 DAHs, and 36 DAHs. (C) The heat map showing SbEILs’ time-series expression patterns at the 10th internode from 29 days before anthesis to 68 days after anthesis (abbreviated as A-29, A-16, A-7, A, A+11, A+25, A+43, and A+68). Only expressed SbEILs (averaged FPKM or RPKM values ≥ 1 per tissue and stage) are shown in the above heat maps. The colors of the heat map reflect the extent of the log2 fold change in gene expression levels relative to the flowering stage, while for Figure 5B, the gene expression fold changes were calculated to compare with those of the 1 day after heading (1 DAH). The absolute expression levels are labeled on the heat map. The flowering stages are indicated in red fonts (with “A” standing for anthesis). The red arrowhead indicates SbEIL7 for which a further co-expression analysis was performed. Two pairs of WGD-derived SbEILs (i.e., SbEIL1/9 and SbEIL3/7) are labeled, with the SbEIL phylogenetic clades indicated in green, blue, and red background colors, respectively. (D–G) Quantitative PCR analysis of the expression levels of SbEIL3 and 7 (Sobic.002G422300 and Sobic.001G387600, respectively) under the treatments of ethephon and 1-methylcyclopropene (1-MCP). The qPCR analysis of SbEIL3 expression in the germinated sorghum shoot (cv. BTx623) after a 48 h or 72 h treatment of ethephon (D) or 1-MCP (E). The qPCR analysis of SbEIL7 expression in the germinated sorghum shoot (cv. BTx623) after a 48 h or 72 h treatment of ethephon (F) or 1-MCP (G). Details about the treatments during sorghum seed germination are described in the Methods section. The qPCR analysis was performed with three biological replicates, and the statistical difference between the control and corresponding treatment was calculated with Student’s t-test (*, p < 0.05; ***, p < 0.005).
Figure 5. Comparative expression analysis of SbEILs in the internode tissues between several sorghum cultivars. (A) The heat map showing the expression profiles of SbEILs in three genetically related but phenotypically contrasting sorghum cultivars (sweet sorghum Rio, grain sorghum BTx406, and introgression line R9188). (B) The heat map showing SbEILs’ expression profiles at the leaf, stem, and panicle tissues 1 day after heading (1 DAH), 17 DAHs, and 36 DAHs. (C) The heat map showing SbEILs’ time-series expression patterns at the 10th internode from 29 days before anthesis to 68 days after anthesis (abbreviated as A-29, A-16, A-7, A, A+11, A+25, A+43, and A+68). Only expressed SbEILs (averaged FPKM or RPKM values ≥ 1 per tissue and stage) are shown in the above heat maps. The colors of the heat map reflect the extent of the log2 fold change in gene expression levels relative to the flowering stage, while for Figure 5B, the gene expression fold changes were calculated to compare with those of the 1 day after heading (1 DAH). The absolute expression levels are labeled on the heat map. The flowering stages are indicated in red fonts (with “A” standing for anthesis). The red arrowhead indicates SbEIL7 for which a further co-expression analysis was performed. Two pairs of WGD-derived SbEILs (i.e., SbEIL1/9 and SbEIL3/7) are labeled, with the SbEIL phylogenetic clades indicated in green, blue, and red background colors, respectively. (D–G) Quantitative PCR analysis of the expression levels of SbEIL3 and 7 (Sobic.002G422300 and Sobic.001G387600, respectively) under the treatments of ethephon and 1-methylcyclopropene (1-MCP). The qPCR analysis of SbEIL3 expression in the germinated sorghum shoot (cv. BTx623) after a 48 h or 72 h treatment of ethephon (D) or 1-MCP (E). The qPCR analysis of SbEIL7 expression in the germinated sorghum shoot (cv. BTx623) after a 48 h or 72 h treatment of ethephon (F) or 1-MCP (G). Details about the treatments during sorghum seed germination are described in the Methods section. The qPCR analysis was performed with three biological replicates, and the statistical difference between the control and corresponding treatment was calculated with Student’s t-test (*, p < 0.05; ***, p < 0.005).
Plants 13 02615 g005
Plants 13 02615 g006
Figure 6. Comparison of SbEIL co-expressed genes with ethylene-related gene sets implicates SbEIL’s role in protein degradation during internode maturation stages. (A) The flowchart showing the process of SbEIL co-expression analysis and the comparison with the gene sets potentially regulated by ethylene. A literature review identifies six gene sets in maize of which their expression patterns were regulated by the ethylene signaling pathway (namely C2, C3, C9, C10, C12, and C18). The sorghum orthologs of the six gene sets were compared with SbEIL-containing co-expression modules (namely RioM1, BTx406M2, and R9188M9) to generate the intersection gene sets (designated as RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10 and BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18) that were significantly enriched with ethylene regulated genes (Phypergeometric < 0.05). (B) The expression patterns of sets of genes that are regulated by the ethylene signaling pathway (due to ZmACS7 overexpression) under normal and low-nitrogen treatments [52]. In the bar plots, relative expression levels scaled from 0 to 1 were used. (C) The Venn diagram of the gene sets RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10 showing these gene sets have only a few overlapped genes; we, therefore, combine these gene sets into one set namely RioM1-eth. (D) The Venn diagram of the gene sets BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18 showing these gene sets have only a few overlapped genes; we, therefore, combine these gene sets into one set namely BTx406M2-eth. (E) The Venn diagram of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth. (F) Significant overlaps between the SbEIL-containing co-expression modules of sorghum internode RNA-seq data (i.e., BTx406M2, BTx406M4, RioM1, and R9188M9) and the gene sets potentially regulated by ethylene (i.e., C2, C3, C9, C10, C12, and C18) were detected (Phypergeometric < 0.05) and are shown in the heatmap. Green and purple colors reflect the log10 (p values) of the hypergeometric test, while purple stands for significantly over-enriched, and green means under-enriched. The significant overlaps between the gene sets were highlighted with red boxes. (G) The heat map showing the expression patterns of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth. Blue and red colors reflect the extent of log2 (fold change) relative to the anthesis stage (T2). (H) Functional enrichment analysis of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth calculated by hypergeometric tests highlights that protein degradation- and processing-related genes are enriched in the ethylene-regulated sorghum gene sets. The heatmap shows log10 (p values) with the numbers on the heatmap indicating the number of genes associated with the functional term. (I) The expression patterns of protein degradation-related genes in the internodes of Rio, BTx406, and R9188.
Figure 6. Comparison of SbEIL co-expressed genes with ethylene-related gene sets implicates SbEIL’s role in protein degradation during internode maturation stages. (A) The flowchart showing the process of SbEIL co-expression analysis and the comparison with the gene sets potentially regulated by ethylene. A literature review identifies six gene sets in maize of which their expression patterns were regulated by the ethylene signaling pathway (namely C2, C3, C9, C10, C12, and C18). The sorghum orthologs of the six gene sets were compared with SbEIL-containing co-expression modules (namely RioM1, BTx406M2, and R9188M9) to generate the intersection gene sets (designated as RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10 and BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18) that were significantly enriched with ethylene regulated genes (Phypergeometric < 0.05). (B) The expression patterns of sets of genes that are regulated by the ethylene signaling pathway (due to ZmACS7 overexpression) under normal and low-nitrogen treatments [52]. In the bar plots, relative expression levels scaled from 0 to 1 were used. (C) The Venn diagram of the gene sets RioM1-C2, RioM1-C3, RioM1-C9, and RioM1-C10 showing these gene sets have only a few overlapped genes; we, therefore, combine these gene sets into one set namely RioM1-eth. (D) The Venn diagram of the gene sets BTx406M2-C9, BTx406M2-C12, and BTx406M2-C18 showing these gene sets have only a few overlapped genes; we, therefore, combine these gene sets into one set namely BTx406M2-eth. (E) The Venn diagram of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth. (F) Significant overlaps between the SbEIL-containing co-expression modules of sorghum internode RNA-seq data (i.e., BTx406M2, BTx406M4, RioM1, and R9188M9) and the gene sets potentially regulated by ethylene (i.e., C2, C3, C9, C10, C12, and C18) were detected (Phypergeometric < 0.05) and are shown in the heatmap. Green and purple colors reflect the log10 (p values) of the hypergeometric test, while purple stands for significantly over-enriched, and green means under-enriched. The significant overlaps between the gene sets were highlighted with red boxes. (G) The heat map showing the expression patterns of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth. Blue and red colors reflect the extent of log2 (fold change) relative to the anthesis stage (T2). (H) Functional enrichment analysis of the gene sets RioM1-eth, BTx406M2-eth, and R9188M9-eth calculated by hypergeometric tests highlights that protein degradation- and processing-related genes are enriched in the ethylene-regulated sorghum gene sets. The heatmap shows log10 (p values) with the numbers on the heatmap indicating the number of genes associated with the functional term. (I) The expression patterns of protein degradation-related genes in the internodes of Rio, BTx406, and R9188.
Plants 13 02615 g006
Table 1. The information of the SbEIL family and the encoded proteins.
Table 1. The information of the SbEIL family and the encoded proteins.
Gene
Name		Gene IDPhylo.Gene LocationProtein Length (AA)Molecular Weight (Da)pIInstability IndexAliphatic IndexPredicted Subcellular LocalizationN-Terminal
Region		Five α-Helix RegionsBD
Regions		Proline-Rich Region
SbEIL3Sobic.002G422300AChr02:76992033-7699438759463,959.146.0555.0164.41nucleusPPPP
SbEIL7Sobic.001G387600AChr01:67472693-6747680364371,826.485.0255.1359.94nucleusPPPP
SbEIL1Sobic.007G210700BChr07:63959262-6396302661868,185.645.7239.1972.3nucleusPPPP
SbEIL9Sobic.002G247500BChr02:63544987-6355044960968,172.735.8453.8173.15nucleusPPPP
SbEIL4Sobic.003G068700BChr03:5809983-581470232233,714.915.9843.8580.31nucleusX2, 3XP
SbEIL5Sobic.002G078850BChr02:8204439-820618151152,199.575.0354.4177.28nucleusP2, 3XP
SbEIL2Sobic.006G104000CChr06:47392162-4739476247051,819.715.252.6264nucleusPPPP
SbEIL8Sobic.004G189100CChr04:54101320-5410377047852,6934.9459.5270.63nucleusPPPP
Note: For gene locations, the chromosome number and start and end position of the gene are provided; for the predicted subcellular localization, the information is predicted by the WOLFPSORT website and provided (https://wolfpsort.hgc.jp/aboutWoLF_PSORT.html.en; accessed by 31 July 2024). For the N-terminal region, the first approximately 100 amino acid residues including the BD I and BD II regions were compared; for the five α-helix regions important for the EIL protein structure, “P” means it contains all of the five α-helix regions, while “2, 3” means it only contains the second and third α-helix regions. The column “Phylo.” shows the phylogenetic clades each SbEIL belongs to.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tu, M.; Hua, Y.; Shao, T.; Zhang, S.; Xiang, Z.; Yu, M.; Wang, G.; Li, Z.; He, Y.; Yang, L.; et al. Characterization and Transcriptomic Analysis of Sorghum EIN/EIL Family and Identification of Their Roles in Internode Maturation. Plants 2024, 13, 2615. https://doi.org/10.3390/plants13182615

AMA Style

Tu M, Hua Y, Shao T, Zhang S, Xiang Z, Yu M, Wang G, Li Z, He Y, Yang L, et al. Characterization and Transcriptomic Analysis of Sorghum EIN/EIL Family and Identification of Their Roles in Internode Maturation. Plants. 2024; 13(18):2615. https://doi.org/10.3390/plants13182615

Chicago/Turabian Style

Tu, Min, Yuqing Hua, Ti Shao, Siyu Zhang, Zihan Xiang, Manting Yu, Guoli Wang, Zhuang Li, Yun He, Lin Yang, and et al. 2024. "Characterization and Transcriptomic Analysis of Sorghum EIN/EIL Family and Identification of Their Roles in Internode Maturation" Plants 13, no. 18: 2615. https://doi.org/10.3390/plants13182615

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop