Next Article in Journal
Application Techniques and Concentrations of Ascorbic Acid to Reduce Saline Stress in Passion Fruit
Previous Article in Journal
Enhancing Antibiotic Efficacy with Natural Compounds: Synergistic Activity of Tannic Acid and Nerol with Commercial Antibiotics against Pathogenic Bacteria
Previous Article in Special Issue
Optimal Planting Density Increases the Seed Yield by Improving Biomass Accumulation and Regulating the Canopy Structure in Rapeseed
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 19
10.3390/plants13192716
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Characterization of a Drought-Induced Betaine Aldehyde Dehydrogenase Gene SgBADH from Suaeda glauca

by
Hangxia Jin
1,
Min Tang
2,
Longmin Zhu
1,
Xiaomin Yu
1,
Qinghua Yang
1 and
Xujun Fu
1,*
1
Key Laboratory of Digital Upland Crops of Zhejiang Province, Institute of Crops and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Science, Hangzhou 310021, China
2
Hangzhou Institute for Food and Drug Control, Hangzhou 310022, China
*
Author to whom correspondence should be addressed.
Plants 2024, 13(19), 2716; https://doi.org/10.3390/plants13192716
Submission received: 9 August 2024 / Revised: 26 September 2024 / Accepted: 27 September 2024 / Published: 28 September 2024
(This article belongs to the Special Issue Environmental and Genetic Factors in Field Crop Production and Improvement: Mechanisms and Regulation)
Browse Figures
Review Reports Versions Notes

Abstract

:
Betaine aldehyde dehydrogenases (BADHs) are key enzymes in the biosynthesis of glycine betaine, which is an important organic osmolyte that maintains cell structure and improves plant tolerance to abiotic stresses, especially in halotolerant plants. Improving the drought tolerance of crops will greatly increase their yield. In this study, a novel BADH gene named SgBADH from Suaeda glauca was induced by drought stress or abscisic acid. To explore the biological function of SgBADH, the SgBADH gene was transformed into Arabidopsis. Then, we found SgBADH-overexpressing Arabidopsis seedlings showed enhanced tolerance to drought stress. SgBADH transgenic Arabidopsis seedlings also had longer roots compared with controls under drought stress, while SgBADH-overexpressing Arabidopsis exhibited increased glycine betaine accumulation and decreased malondialdehyde (MDA) under drought stress. Our results suggest that SgBADH might be a positive regulator in plants during the response to drought.

1. Introduction

Plant growth and productivity are strongly influenced by an array of abiotic stresses including drought and salinity. The drought resistance and salinity of crops greatly affects the yield. Glycine betaine (GB), which is one kind of important organic osmolyte, can maintain cell structure and improve plant tolerance to abiotic stresses [1,2,3]. There are also a few non-GB-accumulator plants which do not accumulate glycine betaine, such as rice and Arabidopsis. GB is synthesized through the two-step oxidation of choline catalyzed by choline monooxygenase (CMO) and betaine aldehyde dehydrogenase (BADH) [4,5,6]. As an important enzyme in the second step, BADH catalyzes the oxygenation of betaine aldehyde to GB under stress conditions. Different plant BADHs may exert their effects through different pathways, such as not only acting on this pathway, and BADH catalyzes the production of dimethylsulfoniopropionate by the oxidation of 3-dimethylsulfoniopropionaldehyde [7,8]. These pathways indicate that BADH proteins have conservation, diversity, and complexity in different plants.
BADH belongs to subfamily 10 of the aldehyde dehydrogenase superfamily (ALDH10) [7,8]. Since the BADH gene was first isolated and cloned from Spinacia oleracea in higher plants [9], a series of BADH genes have been identified from barley [10], spinach [11], Avena sativa [12], oilseed rape [13], rice [14,15], Arabidopsis [16], Halocnermum strobilaceum [17], and hazelnut [18]. Evidence in the literature demonstrates that BADH in a number of plant species is involved in abiotic stresses, such as spinach, Avena sativa, oilseed rape, barley, and sorghum [11,12,13,19,20]. Overexpression of the BADH gene is an important strategy to genetically engineer crops to produce GB and increase abiotic stress tolerance. A Spinacia oleracea BADH gene (SoBADH) was introduced into sweet potato, and then the transgenic sweet potato improved its tolerance to abiotic stresses including salt, oxidative stress, and low temperature [21]. Interestingly, the loss of function of BADH in non-GB-accumulator plants, Arabidopsis and rice, reduced salt stress tolerance or drought stress in transgenic plants [22,23]. These indicate that BADH not only regulates plant stress tolerance through GB but also through other pathways.
Suaeda glauca, a succulent halophyte of the Amaranthaceae family, is widely distributed in coastal areas of China [24,25]. Suaeda glauca exhibits a high resistance to salt and drought stress and it may provide a valuable source to validate salinity and drought tolerance-related genes to increase crop yield [26]. Two plants of the Suaeda genus have been cloned with BADH genes [27,28], which respond to stress such as drought and significantly improve plant salt or drought tolerance, fully demonstrating the high potential of Suaeda genes to enhance crop growth. However, few genes have been isolated from Suaeda glauca, and few reports have explored the molecular regulation in response to abiotic stress in Suaeda glauca. Here, a new member of the BADH gene family, named SgBADH (GenBank: PQ356478), was our first aldehyde dehydrogenase gene identified in Suaeda glauca. The BADH protein sequences of Suaeda salsa (ABG23669.1), Suaeda maritime (AFW04226.1), and Suaeda liaotungensis (AAL33906.1) are fully 100% identified, but the identity between the BADH protein of Suaeda glauca in this study and Suaeda liaotungensis is only 79.4%. Thus, SgBADH is a new BADH gene in the Suaeda genus. In this study, to explore the biological function of SgBADH, the sequence analyses, evolutionary analysis, and expression pattern of the SgBADH gene were investigated in Suaeda glauca. The SgBADH gene was transformed into Arabidopsis, and the effect of SgBADH overexpression in the transgenic Arabidopsis plants when exposed to drought stress was significant.

2. Results

2.1. Evolutionary Analysis of SgBADH

We cloned BADH cDNAs by PCR using degenerate primers, which were designed on the basis of the highly conserved amino acid sequences from several plants’ BADH as described in the Methods section. The nucleotide sequence was named SgBADH. The SgBADH cDNA contains an open reading frame of 1503 bp encoding 500 amino acids (https://www.ncbi.nlm.nih.gov/nuccore/PQ356478, accessed on 10 September 2024).
The evolutionary relationships of the BADH proteins were analyzed by the multiple alignments of the amino acid sequences from some viruses, archaea, fungi, bacteria, animals, eudicots, and monocots using the neighbor-joining method (Figure 1). The phylogenetic analysis clustered the BADH proteins of the selected species into five major groups. Species from the same realm or class were roughly classified together (same color), but there were also some species belonging to different realms or classes classified together. All BADH proteins of eudicots were located in the same group, while those of monocots were clustered into another group (Figure 1). According to the phylogenetic analysis, the BADH of Amaranthus tricolor, Amaranthus hypochondriacus, and SgBADH were more similar to each other than to the other BADH proteins of the same Suaeda species.

2.2. Analysis of the SgBADH Protein Interaction Network Collaborator

The utilization of protein–protein interaction networks to link unknown functional proteins aids in understanding the regulatory networks between biomolecules and predicting the function of unknown proteins. In this study, potential interactions among the SgBADH proteins were explored using the STRING program based on the Spinacia oleracea association model (Figure 2). The potential proteins were annotated by Gene Ontology (GO) classification analysis. GO enrichment analysis showed that these interaction network collaborators were mainly enriched in the organonitrogen compound metabolic process, organophosphate metabolic process, lipid metabolic process, glycerophospholipid biosynthetic process, phosphatidylethanolamine biosynthetic process, glycine betaine biosynthetic process from choline, arachidonic acid secretion, and proline metabolic process.

2.3. SgBADH Gene Is Stress-Responsive in Suaeda glauca

Mannitol is often used as an osmotic regulator, and its properties can create different degrees of drought for plants. Based on this, this experiment simulated drought stress using a concentration of 200 mM mannitol [29,30]. ABA is an important hormone in plant growth and development, as well as a plant stress hormone accumulated under osmotic imbalance caused by abiotic stress. When plants are subjected to drought stress, they synthesize a large amount of ABA, which leads to the expression of downstream related resistance genes, thereby improving plant drought resistance [31,32]. To examine whether SgBADH was induced by abiotic stress in Suaeda glauca, Suaeda glauca seedlings were exposed to mannitol and abscisic acid (ABA). The gene expression was monitored by qRT-PCR. SgBADH was induced by drought stress after 3 days in Suaeda glauca, then the transcript level of SgBADH decreased after 6 days of drought treatment (Figure 3A). Because SgBADH was induced by drought stress, it was of interest to examine whether SgBADH was an ABA-dependent stress-responsive gene. The results show that ABA treatment significantly induced the expression of SgBADH (Figure 3A). These results indicate up-regulation of SgBADH by drought stress might be dependent on ABA in Suaeda glauca. Consistent with this trend, the GB content showed a peak after 3 days of drought or ABA treatment and slightly decreased after 6 days.

2.4. Expression of SgBADH in Transgenic Arabidopsis

SgBADH was overexpressed in Arabidopsis under the control of the Cauliflower mosaic virus (CaMV) 35S promoter. The overexpressing SgBADH Arabidopsis plant strains were named B1, B2, and B3. Then, the control named CK was an Arabidopsis plant transfected with an empty plasmid. To examine the expression of the SgBADH gene, the total RNA isolated from transgenic Arabidopsis leaves was analyzed by qRT-PCR using gene-specific primers. High levels of SgBADH transcripts were detected in SgBADH transformants, whereas no SgBADH transcripts were detected in the control (CK) (Figure 3C). The EGFP transcripts were detected in all of the Arabidopsis transformants, which were transfected with an empty plasmid (CK) or a plasmid containing the SgBADH gene (B1, B2, and B3). Based on these data, three lines (B1, B2, and B3) were selected for further analyses.

2.5. Overexpression of SgBADH Enhances Drought Tolerance in Transgenic Arabidopsis Seedlings

Seven-day-old seedlings of B1, B2, B3, and the CK Arabidopsis lines were subjected to drought stress (MS + 200 mM D-mannitol) and a normal condition (MS + 0 mM D-mannitol). After two weeks on MS plates with 0 mM D-mannitol, the seedling growth of B1, B2, and B3 was similar with that of the CK seedlings. However, on MS plates with 200 mM D-mannitol, B1, B2, and B3 seedlings grew better than the CK seedlings (Figure 4A). SgBADH transgenic Arabidopsis seedlings (B1, B2, and B3) had longer roots compared with CK under drought stress (Figure 4B). These results indicated SgBADH-overexpressing Arabidopsis seedlings showed enhanced tolerance to drought stress.

2.6. SgBADH-Overexpressing Arabidopsis Exhibits Increased GB Accumulation and Decreased MDA under Drought Stress

SgBADH-overexpressing Arabidopsis lines subjected to drought stress (200 mM D-mannitol) for two weeks showed higher GB contents in the leaves and decreased MDA compared with CK plants (Figure 5). This result indicated SgBADH-overexpressing Arabidopsis plants show enhanced tolerance to drought stress because of the increase in GB contents.

3. Discussion

The phylogenetic analysis of BADH proteins showed that the species from the same realm or class were roughly classified together (same color, Figure 1), but there were also some species belonging to different realms or classes classified together. This means that BADH has relative conservation but also diversity and complexity, which is consistent with other research results [21,33,34,35]. The BADH of Amaranthus tricolor, Amaranthus hypochondriacus, and SgBADH were more similar to each other than (Figure 1) to the other BADH proteins of the same Suaeda species (Suaeda salsa, Suaeda maritime, Suaeda liaotungensis). The BADH protein sequences of Suaeda salsa (ABG23669.1), Suaeda maritime (AFW04226.1), and Suaeda liaotungensis (AAL33906.1) are fully 100% identified, so they cluster together in Figure 1. The similarity in identity of the BADH protein in Suaeda glauca in this study and Suaeda liaotungensis (AAL33906.1) is 79.4%, while the similarity in identity of the BADH protein in Suaeda glauca (SgBADH) and Amaranthus tricolor (AUC64503.1) is 89.2%. Though overexpression of SlBADH (from Suaeda liaotungensis) improved tolerance to salinity in transgenic tobacco, this result suggests that SgBADH might have a different mechanism of GB production than other Suaeda plants.
The predicted SgBADH protein interaction collaborators (Figure 2) were mainly enriched in the glycerophospholipid biosynthetic process, phosphatidylethanolamine biosynthetic process, glycine betaine biosynthetic process from choline, arachidonic acid secretion, and proline metabolic process, which were related to drought stress [36,37,38,39,40,41,42,43]. This is consistent with SgBADH expression patterns under drought stress and the drought tolerance of SgBADH-overexpressing Arabidopsis plants.
In previous studies on the expression characteristics of the BADH gene, it was found that the BADH gene in different plants was either constitutively expressed or induced, which may be related to the specific function of the gene in different plants. In plants such as rice, spinach, and barley, two BADH genes were found, some of which have different expression patterns [2,5,44]. For example, in response to salt treatments of increasing concentrations, the level of the OsBADH1 (LOC4336081) transcript increased significantly in rice, while no consistent relationship between OsBADH2 (coding BAC76608.1 in Figure 1) transcript levels and salt treatment was observed, suggesting that OsBADH1 but not OsBADH2 has a role in the response of rice to salt stress [44]. The two BADH genes BBD1 and BBD2 in barley were induced by salt, drought, and ABA treatment with different levels [45,46]. This may imply that the two BADH homologous genes in the same plant have different roles in the abiotic stress response. Limited by the absence of a reference genome for Suaeda glauca, we used degenerate primers designed based on homologous sequences to clone only one BADH gene from Suaeda glauca. Compared with OsBADH2 (percent identity: 72.3%), SgBADH has a higher similarity to OsBADH1 (percent identity: 80.2%) in terms of nucleotide sequence alignment, and we found that the expression pattern of SgBADH is similar to that of one of the BADH genes in the aforementioned plants (OsBADH1), which means that SgBADH might be the BADH gene that responds to adversity, if there are two BADH genes in Suaeda glauca.
As an organic osmolyte, GB has been shown to increase the tolerance to abiotic stresses in transgenic plants [1,21,47]. In this study, the overexpression of SgBADH in Arabidopsis increases BADH expression and GB accumulation in vivo and, consequently, leads to an enhanced tolerance of the transgenic Arabidopsis to drought stress (Figure 4 and Figure 5). Under drought stress, the SgBADH transgenic Arabidopsis lines (B1–B3) accumulated approximately 2–3 times more GB content than that of the control (Figure 5A). The MDA content was reduced in SgBADH transgenic Arabidopsis lines (B1–B3) under drought stress (Figure 5B), which suggests that cell membrane homeostasis was improved in the SgBADH transgenic Arabidopsis lines. Therefore, this indicates that GB protects the cell membrane from stress-induced injury and maintains the osmotic balance [1,2,48].
The present study suggests that the expression of the SgBADH gene and the accumulation of glycine betaine might be two of the molecular mechanisms that indicate how SgBADH copes with drought stress. This study indicates the potential of the SgBADH gene for application to the genetic engineering of crops for the improvement in drought tolerance.

4. Materials and Methods

4.1. Plant Materials and Salt Stress Treatment

Suaeda glauca plants were grown in a greenhouse under a 16:8 h light–dark cycle at Zhejiang Academy of Agricultural Science, Hangzhou, China. One-month-old seedlings were treated with 200 mM mannitol or 100 µM ABA for three days or six days. The shoots of the treated seedlings and three untreated seedlings were immediately frozen and stored in liquid nitrogen for RNA extraction.
Seven-day-old seedlings of transgenic Arabidopsis lines were subjected to drought stress (MS + 200 mM D-mannitol) and a normal condition (MS + 0 mM D-mannitol) for two weeks.

4.2. RNA Extraction, cDNA Synthesis, and Cloning of SgBADH cDNAs

The total RNA was extracted from the roots of plant samples. First-strand cDNA was synthesized using oligo (dT) primers (TOYOBO, Osaka, Japan). The fragment of SgBADH cDNA was amplified by PCR from cDNA of Suaeda glauca using specific primers designed on the basis of the highly conserved amino acid sequences from several plant BADH cDNAs of AAB41696.1 (Spinacia oleracea), AAG51938.1 (Arabidopsis thaliana), and a cDNA library of the leaves of salt-treated Suaeda glauca. The primers used in this study are listed in Table 1 (SgBADHF/SgBADHR). Then, cDNA was sequenced in Beijing Tsingke Biotech Co., Ltd., Beijing, China.

4.3. qRT-PCR Analysis

The SgBADH gene and the internal reference actin gene were subjected to real-time quantitative PCR (qRT-PCR) with specific primers, which were designed in Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 22 September 2016). qRT-PCR analysis of the two genes was conducted in triplicate with the SYBR Green Real-time PCR Master Mix (TOYOBO, Osaka, Japan) on the LightCycler® 480 Real-Time PCR System (Roche Diagnostics GmbH, Mannheim, Germany). The primers used in this study are listed in Table 1.

4.4. Phylogenetic Tree and Protein–Protein Interaction Analysis

A phylogenetic analysis based on 93 full-length amino acid sequences (search in https://www.ncbi.nlm.nih.gov/protein/, accessed on 5 June 2024) including SgBADH was run with MEGA7.0. The analysis was subjected to the neighbor-joining method, and the bootstrap method supported by 1000 replicates to test phylogeny. The functional relationships of the SgBADH protein were predicted using the STRING protein interaction database (https://string-db.org/, accessed on 5 June 2024) (STRING11.5). The STRING database integrates protein interactions from experimental data, the literature, and predictions. Gene Ontology (GO) classification analysis was performed based on the protein analysis by STRING11.5.

4.5. Plasmid Construction, Arabidopsis Transformation

The coding region of SgBADH was obtained using RT-PCR from SgBADH with specific primers SgBADH-F/SgBADH-R (Table 1). The PCR product was cloned into a linearized pCAM35S::EGFP expression vector (containing the HTP gene for selection and the EGFP gene) using the In-Fusion HD Kit (Clontech, Mountain View, CA, USA). The recombinant plasmid vector was named pCAM35S::SgBADH::EGFP. The pCAM35S::SgBADH:: EGFP and pCAM35S::EGFP (empty plasmid as the control) vector were introduced into Agrobacterium tumefaciens strain EHA105 via the freeze–thaw method, respectively. The expression vectors were then transformed into Arabidopsis (Columbia) using the floral dip method [49].

4.6. Verification of SgBADH-Overexpressing Transgenic Arabidopsis

SgBADH-overexpressing transgenic lines were selected on MS with 50 mg/L Hygromycin B. T2 generation plants of the transgenic lines B1, B2, and B3 were used in subsequent experiments. The Arabidopsis plants were grown in a climate chamber with 16:8 h light–dark cycle at 23 °C. RNAs isolated from transgenic Arabidopsis lines were used as templates for qRT-PCR and amplified using specific primers of the SgBADH gene: SgBADH192-F/SgBADH192-R. (Table 1), which was designed in Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 22 September 2016). Another pair of specific primers EGFP-F/EGFP-R (Table 1) were used to amplify the 145 bp fragment of an EGFP gene.

4.7. Analysis of the Drought Tolerance in SgBADH-Overexpressing Transgenic Arabidopsis

Seeds of T2 transgenic Arabidopsis lines and the control (transgenic empty plasmid Arabidopsis line) were surface-sterilized and then sown on solid MS medium with 50 mg/L Hygromycin B. After 7 days, the seedlings with equivalent growth vigor were selected and transplanted onto solid MS medium supplemented with 0 and 200 mM D-mannitol. After 2 weeks, the root growth was measured. The root lengths were determined in 20 plants of each line of transgenic and control Arabidopsis. The plants grew at 25 °C under a 16 h light/8 h dark photoperiod.

4.8. Lipid Peroxidation Assay

The levels of lipid peroxidation were determined by the amounts of malondialdehyde (MDA) as the end product of lipid peroxidation in plant cells. The MDA content was measured using the thiobarbituric acid method [50,51,52]. Thus, 1 g of fresh tissue was homogenized in 10 mL of 10% (W/V) trichloroacetic acid and centrifuged at 4000× g. The supernatant was mixed with an equal volume of 2-thiobarbituric acid (0.67% in 10% [w/v] trichloroacetic acid) and then the mixture was boiled for 15 min and centrifuged to clarify the solution. Absorbance of the supernatant was measured at 532 nm and corrected for interference by subtracting the A600 and A450. The MDA content was calculated using the formula: MDA (μmol/L)= 6.45 × (A532 − A600) − 0.56 × A450.

4.9. Measurement of GB Content

The GB contents were measured according to the protocols described by Martinez [53] with some modifications. Fresh leaves (1 g) of the plants were ground in water and incubated for 5 h at 70 °C and then centrifuged for 10 min at 4000× g. The supernatants were divided into two portions; one portion was adjusted to a pH 1.0 to determine the amount of GB contents and choline contents (V3), and the other was adjusted to a pH 8.0 to determine the choline contents (V2). Under acidic conditions, choline and betaine reineckate are precipitated, and at an alkaline pH, only choline reineckate precipitates. The supernatants were mixed with 5 mL 3% Reinecke’s salt (pH 1.0 or pH 8.0), centrifuged, and the supernatants were discarded. Then, the residues were washed with ether and dissolved in 70% acetone. The absorbance was measured at 525 nm (HITACHI J-2800, Hitachi, Tokyo, Japan), and V3 and V2 were determined using a standard curve, respectively. Three replicate biological experiments were conducted. GB content (V1) = Amount (V3) − choline content (V2).

Author Contributions

Conceptualization, H.J. and X.F.; software, M.T. and L.Z.; validation, X.Y. and Q.Y.; writing—original draft preparation, H.J.; writing—review and editing, X.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Major projects in agricultural biological breeding, grant number 2023ZD0403403, the China Agriculture Research System, grant number CARS-04-CES26, and the National Natural Science Foundation of China, grant number 31801382.

Data Availability Statement

Date are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yang, C.; Zhou, Y.; Fan, J.; Fu, Y.; Shen, L.; Yao, Y.; Li, R.; Fu, S.; Duan, R.; Hu, X.; et al. SpBADH of the halophyte Sesuvium portulacastrum strongly confers drought tolerance through ROS scavenging in transgenic Arabidopsis. Plant Physiol. Biochem. 2015, 96, 377–387. [Google Scholar] [CrossRef] [PubMed]
  2. Mitsuya, S.; Tsuchiya, A.; Kono-Ozaki, K.; Fujiwara, T.; Takabe, T.; Takabe, T. Functional and expression analyses of two kinds of betaine aldehyde dehydrogenases in a glycinebetaine-hyperaccumulating graminaceous halophyte, Leymus chinensis. SpringerPlus 2015, 4, 202. [Google Scholar] [CrossRef] [PubMed]
  3. Delgado-Gaytan, M.F.; Hernandez-Palomares, M.L.; Sonanez-Organis, J.G.; Muhlia-Almazan, A.; Sanchez-Paz, A.; Stephens-Camacho, N.A.; Valenzuela-Soto, E.M.; Rosas-Rodriguez, J.A. Molecular characterization and organ-specific expression of the gene that encodes betaine aldehyde dehydrogenase from the white shrimp Litopenaeus vannamei in response to osmotic stress. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2015, 189, 40–46. [Google Scholar] [CrossRef] [PubMed]
  4. Yu, H.Q.; Wang, Y.G.; Yong, T.M.; She, Y.H.; Fu, F.L.; Li, W.C. Heterologous expression of betaine aldehyde dehydrogenase gene from Ammopiptanthus nanus confers high salt and heat tolerance to Escherichia coli. Gene 2014, 549, 77–84. [Google Scholar] [CrossRef]
  5. Munoz-Clares, R.A.; Riveros-Rosas, H.; Garza-Ramos, G.; Gonzalez-Segura, L.; Mujica-Jimenez, C.; Julian-Sanchez, A. Exploring the evolutionary route of the acquisition of betaine aldehyde dehydrogenase activity by plant ALDH10 enzymes: Implications for the synthesis of the osmoprotectant glycine betaine. BMC Plant Biol. 2014, 14, 149. [Google Scholar] [CrossRef]
  6. Lambou, K.; Pennati, A.; Valsecchi, I.; Tada, R.; Sherman, S.; Sato, H.; Beau, R.; Gadda, G.; Latge, J.P. Pathway of glycine betaine biosynthesis in Aspergillus fumigatus. Eukaryot. Cell 2013, 12, 853–863. [Google Scholar] [CrossRef]
  7. Brocker, C.; Vasiliou, M.; Carpenter, S.; Carpenter, C.; Zhang, Y.; Wang, X.; Kotchoni, S.O.; Wood, A.J.; Kirch, H.H.; Kopecny, D.; et al. Aldehyde dehydrogenase (ALDH) superfamily in plants: Gene nomenclature and comparative genomics. Planta 2013, 237, 189–210. [Google Scholar] [CrossRef]
  8. Jackson, B.; Brocker, C.; Thompson, D.C.; Black, W.; Vasiliou, K.; Nebert, D.W.; Vasiliou, V. Update on the aldehyde dehydrogenase gene (ALDH) superfamily. Hum. Genom. 2011, 5, 283–303. [Google Scholar] [CrossRef]
  9. Weretilnyk, E.A.; Hanson, A.D. Molecular cloning of a plant betaine-aldehyde dehydrogenase, an enzyme implicated in adaptation to salinity and drought. Proc. Natl. Acad. Sci. USA 1990, 87, 2745–2749. [Google Scholar] [CrossRef]
  10. Ishitani, M.; Nakamura, T.; Han, S.Y.; Takabe, T. Expression of the betaine aldehyde dehydrogenase gene in barley in response to osmotic stress and abscisic acid. Plant Mol. Biol. 1995, 27, 307–315. [Google Scholar] [CrossRef]
  11. Shu, W. Genomic cloning and sequencing of betaine aldehyde dehydrogenase gene in spinach. Chin. Sci. Bull. 1998, 4, 325–330. [Google Scholar]
  12. Livingstone, J.R.; Maruo, T.; Yoshida, I.; Tarui, Y.; Hirooka, K.; Yamamoto, Y.; Tsutui, N.; Hirasawa, E. Purification and properties of betaine aldehyde dehydrogenase from Avena sativa. J. Plant Res. 2003, 116, 133–140. [Google Scholar] [CrossRef]
  13. Ye, C.; Wu, S.; Yang, Q.; Ma, C.; Yang, G.; Wang, B. Cloning, sequencing and salt induced expression of PEAMT and BADH in oilseed rape (Brassica napus). DNA Seq. J. DNA Seq. Mapp. 2005, 16, 364–371. [Google Scholar] [CrossRef] [PubMed]
  14. Bradbury, L.M.; Gillies, S.A.; Brushett, D.J.; Waters, D.L.; Henry, R.J. Inactivation of an aminoaldehyde dehydrogenase is responsible for fragrance in rice. Plant Mol. Biol. 2008, 68, 439–449. [Google Scholar] [CrossRef]
  15. Nakamura, T.; Yokota, S.; Muramoto, Y.; Tsutsui, K.; Oguri, Y.; Fukui, K.; Takabe, T. Expression of a betaine aldehyde dehydrogenase gene in rice, a glycinebetaine nonaccumulator, and possible localization of its protein in peroxisomes. Plant J. Cell Mol. Biol. 1997, 11, 1115–1120. [Google Scholar] [CrossRef]
  16. Missihoun, T.D.; Schmitz, J.; Klug, R.; Kirch, H.H.; Bartels, D. Betaine aldehyde dehydrogenase genes from Arabidopsis with different sub-cellular localization affect stress responses. Planta 2011, 233, 369–382. [Google Scholar] [CrossRef]
  17. Gao, T.P.; Wang, C.Y.; Xu, H.W.; Sun, H.L.; Zhang, M.; Zhang, Q.; Shi, X.N. Molecular Cloning and Expression Analysis of Betaine Aldehyde Dehydrogenase Gene from the Halophyte Halocnermum strobilaceum(Pall.)(Chenopodiaceae). Bull. Bot. Res. 2013, 33, 317–324. [Google Scholar]
  18. Chen, X.; Wang, G.; Xu, L.; Zhang, L.; Liu, Q.; Cui, H.; Zhang, X. Cloning and Expression Analysis of Betaine Aldehyde Dehydrogenase BADH Gene from Hazelnut (Corylus heterophylla Fisch.) during Overwintering Period. Shandong Agric. Sci. 2013, 45, 6–12. [Google Scholar]
  19. Wood, A.J.; Saneoka, H.; Rhodes, D.; Joly, R.J.; Goldsbrough, P.B. Betaine aldehyde dehydrogenase in sorghum. Plant Physiol. 1996, 110, 1301–1308. [Google Scholar] [CrossRef]
  20. Guo, P.; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R.; von Korff, M.; Varshney, R.K.; Graner, A.; Valkoun, J. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. J. Exp. Bot. 2009, 60, 3531–3544. [Google Scholar] [CrossRef]
  21. Fan, W.; Zhang, M.; Zhang, H.; Zhang, P. Improved tolerance to various abiotic stresses in transgenic sweet potato (Ipomoea batatas) expressing spinach betaine aldehyde dehydrogenase. PLoS ONE 2012, 7, e37344. [Google Scholar] [CrossRef] [PubMed]
  22. Jacques, F.; Zhao, Y.; Kopecna, M.; Koncitikova, R.; Kopecny, D.; Rippa, S.; Perrin, Y. Roles for ALDH10 enzymes in gamma-butyrobetaine synthesis, seed development, germination, and salt tolerance in Arabidopsis. J. Exp. Bot. 2020, 71, 7088–7102. [Google Scholar] [CrossRef] [PubMed]
  23. Tang, W.; Sun, J.; Liu, J.; Liu, F.; Yan, J.; Gou, X.; Lu, B.R.; Liu, Y. RNAi-directed downregulation of betaine aldehyde dehydrogenase 1 (OsBADH1) results in decreased stress tolerance and increased oxidative markers without affecting glycine betaine biosynthesis in rice (Oryza sativa). Plant Mol. Biol. 2014, 86, 443–454. [Google Scholar] [CrossRef] [PubMed]
  24. An, R.B.; Sohn, D.H.; Jeong, G.S.; Kim, Y.C. In vitro hepatoprotective compounds from Suaeda glauca. Arch. Pharm. Res. 2008, 31, 594–597. [Google Scholar] [CrossRef] [PubMed]
  25. Sun, H.X.; Zhong, R.Z.; Liu, H.W.; Wang, M.L.; Sun, J.Y.; Zhou, D.W. Meat quality, fatty acid composition of tissue and gastrointestinal content, and antioxidant status of lamb fed seed of a halophyte (Suaeda glauca). Meat Sci. 2015, 100, 10–16. [Google Scholar] [CrossRef]
  26. Yang, C.; Shi, D.; Wang, D. Comparative effects of salt and alkali stresses on growth, osmotic adjustment and ionic balance of an alkali-resistant halophyte Suaeda glauca (Bge.). Plant Growth Reg. 2008, 56, 179–190. [Google Scholar] [CrossRef]
  27. Wang, F.W.; Wang, M.L.; Guo, C.; Wang, N.; Li, X.W.; Chen, H.; Dong, Y.Y.; Chen, X.F.; Wang, Z.M.; Li, H.Y. Cloning and characterization of a novel betaine aldehyde dehydrogenase gene from Suaeda corniculata. Genet. Mol. Res. 2016, 15, 15027848. [Google Scholar] [CrossRef]
  28. Li, Q.L.; Gao, X.R.; Yu, X.H.; Wang, X.Z.; An, L.J. Molecular cloning and characterization of betaine aldehyde dehydrogenase gene from Suaeda liaotungensis and its use in improved tolerance to salinity in transgenic tobacco. Biotechnol. Lett. 2003, 25, 1431. [Google Scholar]
  29. Hare, P.D.; Cress, W.A.; Van Staden, J. Dissecting the roles of osmolyte accumulation during stress. Plant Cell Environ. 2010, 21, 535–553. [Google Scholar] [CrossRef]
  30. Valliyodan, B.; Nguyen, H.T. Understanding regulatory networks and engineering for enhanced drought tolerance in plants. Curr. Opin. Plant Biol. 2006, 9, 189–195. [Google Scholar] [CrossRef]
  31. Sah, S.K.; Reddy, K.R.; Jiaxu, L. Abscisic Acid and Abiotic Stress Tolerance in Crop Plants. Front. Plant Sci. 2016, 7, 571. [Google Scholar] [CrossRef] [PubMed]
  32. Tuteja, N. Abscisic Acid and Abiotic Stress Signaling. Plant Signal. Behav. 2007, 2, 135–138. [Google Scholar] [CrossRef] [PubMed]
  33. Shen, Y.G.; Du, B.X.; Zhang, W.K.; Zhang, J.S.; Chen, S.Y. AhCMO, regulated by stresses in Atriplex hortensis, can improve drought tolerance in transgenic tobacco. Theor. Appl. Genet. 2002, 105, 815–821. [Google Scholar] [CrossRef] [PubMed]
  34. Bao, Y.; Zhao, R.; Li, F.; Tang, W.; Han, L. Simultaneous Expression of Spinacia oleracea Chloroplast Choline Monooxygenase (CMO) and Betaine Aldehyde Dehydrogenase (BADH) Genes Contribute to Dwarfism in Transgenic Lolium perenne. Plant Mol. Biol. Report. 2010, 29, 379–388. [Google Scholar] [CrossRef]
  35. Weretilnyk, E.A.; Hanson, A.D. Betaine aldehyde dehydrogenase polymorphism in spinach: Genetic and biochemical characterization. Biochem. Genet. 1988, 26, 143–151. [Google Scholar] [CrossRef]
  36. Ling, P.; Zhongfu, Y.; Jianping, W.; Pengxi, W.; Xiao, M.; Meiliang, Z.; Ji, L.; Nie, G.; Guangyan, F.; Junming, Z. Comparative proteomic analyses reveal the proteome response to short-term drought in Italian ryegrass (Lolium multiflorum). PLoS ONE 2017, 12, e0184289. [Google Scholar]
  37. Parida, A.K.; Dagaonkar, V.S.; Phalak, M.S.; Aurangabadkar, L.P. Differential responses of the enzymes involved in proline biosynthesis and degradation in drought tolerant and sensitive cotton genotypes during drought stress and recovery. Acta Physiol. Plant. 2008, 30, 619–627. [Google Scholar] [CrossRef]
  38. Quan, R.; Shang, M.; Zhang, H.; Zhao, Y.; Zhang, J. Engineering of enhanced glycine betaine synthesis improves drought tolerance in maize. Plant Biotechnol. J. 2004, 2, 477–486. [Google Scholar] [CrossRef]
  39. Yuan, X.; Li, Y.; Liu, S.; Xia, F.; Li, X.; Qi, B. Accumulation of eicosapolyenoic acids enhances sensitivity to abscisic acid and mitigates the effects of drought in transgenic Arabidopsis thaliana. J. Exp. Bot. 2014, 65, 1637–1649. [Google Scholar] [CrossRef]
  40. Hong-Bo, S.; Xiao-Yan, C.; Li-Ye, C.; Xi-Ning, Z.; Gang, W.; Yong-Bing, Y.; Chang-Xing, Z.; Zan-Min, H. Investigation on the relationship of proline with wheat anti-drought under soil water deficits. Colloids Surf. B Biointerfaces 2006, 53, 113–119. [Google Scholar] [CrossRef]
  41. Li, M.; Li, Y.; Zhang, W.; Li, S.; Gao, Y.; Ai, X.; Zhang, D.; Liu, B.; Li, Q. Metabolomics analysis reveals that elevated atmospheric CO2 alleviates drought stress in cucumber seedling leaves. Anal. Biochem. 2018, 559, 71–85. [Google Scholar] [CrossRef] [PubMed]
  42. Wu, S.; Hu, C.; Yang, X.; Tan, Q.; Yao, S.; Zhou, Y.; Wang, X.; Sun, X. Molybdenum induces alterations in the glycerolipidome that confer drought tolerance in wheat. J. Exp. Bot. 2020, 71, 5074–5086. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, G.P.; Zhang, X.Y.; Li, F.; Luo, Y.; Wang, W. Overaccumulation of glycine betaine enhances tolerance of the photosynthetic apparatus to drought and heat stress in wheat. Photosynthetica 2010, 48, 117–126. [Google Scholar] [CrossRef]
  44. He, Q.; Yu, J.; Kim, T.S.; Cho, Y.H.; Lee, Y.S.; Park, Y.J. Resequencing Reveals Different Domestication Rate for BADH1 and BADH2 in Rice (Oryza sativa). PLoS ONE 2015, 10, e0134801. [Google Scholar] [CrossRef] [PubMed]
  45. Fujiwara, T.; Hori, K.; Ozaki, K.; Yokota, Y.; Mitsuya, S.; Ichiyanagi, T.; Hattori, T.; Takabe, T. Enzymatic characterization of peroxisomal and cytosolic betaine aldehyde dehydrogenases in barley. Physiol. Plant. 2010, 134, 22–30. [Google Scholar] [CrossRef]
  46. Nakamura, T.; Nomura, M.; Mori, H.; Jagendorf, A.T.; Ueda, A.; Takabe, T. An Isozyme of Betaine Aldehyde Dehydrogenase in Barley. Plant Cell Physiol. 2001, 42, 1088–1092. [Google Scholar] [CrossRef]
  47. Hasthanasombut, S.; Supaibulwatana, K.; Mii, M.; Nakamura, I. Genetic manipulation of Japonica rice using the OsBADH1 gene from Indica rice to improve salinity tolerance. Plant Cell Tiss. Organ. Cult. 2011, 104, 79–89. [Google Scholar] [CrossRef]
  48. Li, M.; Guo, S.; Xu, Y.; Meng, Q.; Li, G.; Yang, X. Glycine betaine-mediated potentiation of HSP gene expression involves calcium signaling pathways in tobacco exposed to NaCl stress. Physiol. Plant. 2014, 150, 63–75. [Google Scholar] [CrossRef]
  49. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. Cell Mol. Biol. 1998, 16, 735–743. [Google Scholar] [CrossRef]
  50. Chen, C.; Chen, T.; Lo, K.; Chiu, C. Effects of proline on copper transport in rice seedlings under excess copper stress. Plant Sci. 2004, 166, 103–111. [Google Scholar] [CrossRef]
  51. Dhindsa, R.; Matowe, W. Drought tolerance in two mosses correlated with enzymatic defence against lipid peroxidation. J. Exp. Bot. 1981, 32, 79–91. [Google Scholar] [CrossRef]
  52. Hong, Z.; Lakkineni, K.; Zhang, Z.; Verma, D. Removal of feedback inhibition of Delta 1-pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. Plant Physiol. 2000, 122, 1129–1136. [Google Scholar] [CrossRef] [PubMed]
  53. Martinez, S.E.V. Simultaneous determination of choline and betaine in some fish materials. Analyst 1983, 108, 1114–1119. [Google Scholar] [CrossRef]
Plants 13 02716 g001
Figure 1. Phylogenetic tree of BADH proteins. The neighbor-joining (NJ) phylogenetic tree was constructed using the MEGA7 with 1000 bootstrap replicates. The red symbol is SgBADH protein.
Figure 1. Phylogenetic tree of BADH proteins. The neighbor-joining (NJ) phylogenetic tree was constructed using the MEGA7 with 1000 bootstrap replicates. The red symbol is SgBADH protein.
Plants 13 02716 g001
Plants 13 02716 g002
Figure 2. Protein–protein interaction network of SgBADH protein based on its ortholog in Spinacia oleracea. Red node (SOVF_114700) is the ortholog of SgBADH. Nodes represent proteins. Connections between nodes represent interactions between proteins, with edge thickness indicating the confidence level of the interaction.
Figure 2. Protein–protein interaction network of SgBADH protein based on its ortholog in Spinacia oleracea. Red node (SOVF_114700) is the ortholog of SgBADH. Nodes represent proteins. Connections between nodes represent interactions between proteins, with edge thickness indicating the confidence level of the interaction.
Plants 13 02716 g002
Plants 13 02716 g003
Figure 3. qRT-PCR analysis and GB levels of Suaeda glauca. (A) SgBADH induction by drought and ABA treatments in Suaeda glauca. Suaeda glauca seedlings were treated with 200 mM mannitol or 100 µM abscisic acid (ABA) for three days and six days. (B) GB levels were measured during treatment with 200 mM mannitol or 100 µM ABA treatment for three days and six days in Suaeda glauca. (C) SgBADH and EGFP expression levels in transgenic Arabidopsis (B1–B3) and CK which was transfected with an empty plasmid. Three replicates of each reaction were performed. The expression values were calculated using the 2−ΔΔCt method and the actin gene as an endogenous control. The bars represent the standard error of the mean.
Figure 3. qRT-PCR analysis and GB levels of Suaeda glauca. (A) SgBADH induction by drought and ABA treatments in Suaeda glauca. Suaeda glauca seedlings were treated with 200 mM mannitol or 100 µM abscisic acid (ABA) for three days and six days. (B) GB levels were measured during treatment with 200 mM mannitol or 100 µM ABA treatment for three days and six days in Suaeda glauca. (C) SgBADH and EGFP expression levels in transgenic Arabidopsis (B1–B3) and CK which was transfected with an empty plasmid. Three replicates of each reaction were performed. The expression values were calculated using the 2−ΔΔCt method and the actin gene as an endogenous control. The bars represent the standard error of the mean.
Plants 13 02716 g003
Plants 13 02716 g004
Figure 4. SgBADH transgenic and control Arabidopsis grown on MS media containing 200 mM mannitol. Morphology (A) and root length (B) of SgBADH-overexpressing Arabidopsis seedlings grown for two weeks on MS medium containing 0 mM and 200 mM D-mannitol. ** indicates significant differences from the control at p < 0.01.
Figure 4. SgBADH transgenic and control Arabidopsis grown on MS media containing 200 mM mannitol. Morphology (A) and root length (B) of SgBADH-overexpressing Arabidopsis seedlings grown for two weeks on MS medium containing 0 mM and 200 mM D-mannitol. ** indicates significant differences from the control at p < 0.01.
Plants 13 02716 g004
Plants 13 02716 g005
Figure 5. GB (A) and MDA (B) content in Arabidopsis plants under drought stress. GB and MDA were extracted from the tissues of the 14-day drought treatment. ** indicates significant differences from the control at p < 0.01.
Figure 5. GB (A) and MDA (B) content in Arabidopsis plants under drought stress. GB and MDA were extracted from the tissues of the 14-day drought treatment. ** indicates significant differences from the control at p < 0.01.
Plants 13 02716 g005
Table 1. Sequences of primers used in this study.
Table 1. Sequences of primers used in this study.
GenePrimer Sequences
SgBADHFATGKCGWTCCCWATWCCTKCTCG
SgBADHRTYAAGGAGACTTGTACCAYCCC
SgBADH-FATGGCGTTCCCAATTCCTGC
SgBADH-RTCAAGGCGACTTGTACCATC
SgBADH192-FAAATATGGAAGGAGGAAGT
SgBADH192-RGTTGTGAGCAATTAACCC
AtActin124-FATCGCTGACCGTATGAG
AtActin124-RTGAGGGAAGCAAGAATG
SgActin-FCCGCAAAGATTACATACC
SgActin-RTCACCGAAAGTGCTTCTA
EGFP-FACCCTCGTGACCACCCTGAC
EGFP-RTGTAGTTGCCGTCGTCCTTGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jin, H.; Tang, M.; Zhu, L.; Yu, X.; Yang, Q.; Fu, X. Characterization of a Drought-Induced Betaine Aldehyde Dehydrogenase Gene SgBADH from Suaeda glauca. Plants 2024, 13, 2716. https://doi.org/10.3390/plants13192716

AMA Style

Jin H, Tang M, Zhu L, Yu X, Yang Q, Fu X. Characterization of a Drought-Induced Betaine Aldehyde Dehydrogenase Gene SgBADH from Suaeda glauca. Plants. 2024; 13(19):2716. https://doi.org/10.3390/plants13192716

Chicago/Turabian Style

Jin, Hangxia, Min Tang, Longmin Zhu, Xiaomin Yu, Qinghua Yang, and Xujun Fu. 2024. "Characterization of a Drought-Induced Betaine Aldehyde Dehydrogenase Gene SgBADH from Suaeda glauca" Plants 13, no. 19: 2716. https://doi.org/10.3390/plants13192716

APA Style

Jin, H., Tang, M., Zhu, L., Yu, X., Yang, Q., & Fu, X. (2024). Characterization of a Drought-Induced Betaine Aldehyde Dehydrogenase Gene SgBADH from Suaeda glauca. Plants, 13(19), 2716. https://doi.org/10.3390/plants13192716

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop