Strain-Specific Infection of Phage AP1 to Rice Bacterial Brown Stripe Pathogen Acidovorax oryzae
Abstract
:1. Introduction
2. Results
2.1. Strain-Specific Infection of Phage
2.2. Receptors Contribute to Differential Infection
2.3. Biological Differences Between Phage-Sensitive and Resistant Strains
2.4. LPS Can Bind with Structural Proteins of Phage AP1
2.5. Host Proteins Interacting with Phage AP1 Structural Proteins
2.6. Genes Associated with Strain-Specific Infection of Phage
3. Discussion
4. Materials and Methods
4.1. Bacteria, Phage, and Plasmids
4.2. Infection of Phage to Host Bacteria
4.2.1. Double-Layer Agar Assay
4.2.2. Fluorescence Staining Assay
4.2.3. Phage Adsorption Efficiency Assay
4.3. Characterization of Resistant/Susceptible Strains
4.3.1. Bacterial Growth Assays
4.3.2. Biofilm Formation Assay
4.3.3. Motility Assay
4.3.4. Secretion of T6SS Effector Protein Hcp
4.3.5. Pathogenicity
4.4. Identification of Genes Involved in Phage Infection
4.4.1. Comparative Genomics Analysis
4.4.2. Mutation and Complementation of Unique Genes
4.5. Identification of LPS Receptor
4.6. LPS Binding of Phage Structural Proteins
4.7. Receptor Proteins Involved in Strain-Specific Infection
4.7.1. Determination by Protein Pull-Down
4.7.2. Determination by Bacterial Two-Hybrid Assay
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kakar, K.U.; Nawaz, Z.; Cui, Z.; Almoneafy, A.A.; Zhu, B.; Xie, G.L. Characterizing the Mode of Action of Brevibacillus laterosporus B4 for Control of Bacterial Brown Strip of Rice Caused by A. avenae subsp. avenae RS-1. World J. Microbiol. Biotechnol. 2014, 30, 469–478. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Liu, B.; Yu, R.; Tao, Z.; Wang, Y.; Xie, G.; Li, H.; Sun, G. Bacterial Brown Stripe of Rice in Soil-Less Culture System Caused by Acidovorax avenae subsp. avenae in China. J. Gen. Plant Pathol. 2011, 77, 64–67. [Google Scholar] [CrossRef]
- Liu, H.; Yang, C.L.; Ge, M.Y.; Ibrahim, M.; Li, B.; Zhao, W.J.; Chen, G.Y.; Zhu, B.; Xie, G.L. Regulatory Role of tetR Gene in a Novel Gene Cluster of Acidovorax avenae subsp. avenae RS-1 under Oxidative Stress. Front. Microbiol. 2014, 5, 289. [Google Scholar] [CrossRef]
- Wang, Y.; Zhou, Q.; Li, B.; Liu, B.; Wu, G.; Ibrahim, M.; Xie, G.; Li, H.; Sun, G. Differentiation in MALDI-TOF MS and FTIR Spectra between Two Closely Related Species Acidovorax oryzae and Acidovorax citrulli. BMC Microbiol. 2012, 12, 182. [Google Scholar] [CrossRef]
- Yang, C.; Li, B.; Ge, M.; Zhou, K.; Wang, Y.; Luo, J.; Ibrahim, M.; Xie, G.; Sun, G. Inhibitory Effect and Mode of Action of Chitosan Solution against Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae RS-1. Carbohydr. Res. 2014, 391, 48–54. [Google Scholar] [CrossRef]
- Miura, T.; Kusada, H.; Kamagata, Y.; Hanada, S.; Kimura, N. Genome Sequence of the Multiple-β-Lactam-Antibiotic-Resistant Bacterium Acidovorax sp. Strain MR-S7. Genome Announc. 2013, 1, e00412-13. [Google Scholar] [CrossRef]
- Jia, H.J.; Jia, P.P.; Yin, S.; Bu, L.K.; Yang, G.; Pei, D.-S. Engineering Bacteriophages for Enhanced Host Range and Efficacy: Insights from Bacteriophage-Bacteria Interactions. Front. Microbiol. 2023, 14, 1172635. [Google Scholar] [CrossRef]
- Rakhuba, D.V.; Kolomiets, E.I.; Dey, E.S.; Novik, G.I. Bacteriophage Receptors, Mechanisms of Phage Adsorption and Penetration into Host Cell. Pol. J. Microbiol. 2010, 59, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Stone, E.; Campbell, K.; Grant, I.; McAuliffe, O. Understanding and Exploiting Phage–Host Interactions. Viruses 2019, 11, 567. [Google Scholar] [CrossRef]
- Geller, B.L.; Ivey, R.G.; Trempy, J.E.; Hettinger-Smith, B. Cloning of a Chromosomal Gene Required for Phage Infection of Lactococcus lactis subsp. lactis C2. J. Bacteriol. 1993, 175, 5510–5519. [Google Scholar] [CrossRef]
- Vegge, C.S.; Vogensen, F.K.; Mc Grath, S.; Neve, H.; Van Sinderen, D.; Brøndsted, L. Identification of the Lower Baseplate Protein as the Antireceptor of the Temperate Lactococcal Bacteriophages TP901-1 and Tuc2009. J. Bacteriol. 2006, 188, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Andres, D.; Roske, Y.; Doering, C.; Heinemann, U.; Seckler, R.; Barbirz, S. Tail Morphology Controls DNA Release in Two Salmonella Phages with One Lipopolysaccharide Receptor Recognition System. Mol. Microbiol. 2012, 83, 1244–1253. [Google Scholar] [CrossRef] [PubMed]
- Barbirz, S.; Müller, J.J.; Uetrecht, C.; Clark, A.J.; Heinemann, U.; Seckler, R. Crystal Structure of Escherichia Coli Phage HK620 Tailspike: Podoviral Tailspike Endoglycosidase Modules are Evolutionarily Related. Mol. Microbiol. 2008, 69, 303–316. [Google Scholar] [CrossRef] [PubMed]
- Schwarzer, D.; Browning, C.; Stummeyer, K.; Oberbeck, A.; Mühlenhoff, M.; Gerardy-Schahn, R.; Leiman, P.G. Structure and Biochemical Characterization of Bacteriophage Phi92 Endosialidase. Virology 2015, 477, 133–143. [Google Scholar] [CrossRef]
- Stummeyer, K.; Dickmanns, A.; Mühlenhoff, M.; Gerardy-Schahn, R.; Ficner, R. Crystal Structure of the Polysialic Acid–Degrading Endosialidase of Bacteriophage K1F. Nat. Struct. Mol. Biol. 2005, 12, 90–96. [Google Scholar] [CrossRef]
- Subramanian, S.; Dover, J.A.; Parent, K.N.; Doore, S.M. Host Range Expansion of Shigella Phage Sf6 Evolves through Point Mutations in the Tailspike. J. Virol. 2022, 96, e00929-22. [Google Scholar] [CrossRef]
- Walter, M.; Fiedler, C.; Grassl, R.; Biebl, M.; Rachel, R.; Hermo-Parrado, X.L.; Llamas-Saiz, A.L.; Seckler, R.; Miller, S.; Van Raaij, M.J. Structure of the Receptor-Binding Protein of Bacteriophage Det7: A Podoviral Tail Spike in a Myovirus. J. Virol. 2008, 82, 2265–2273. [Google Scholar] [CrossRef]
- Witte, S.; Zinsli, L.V.; Gonzalez-Serrano, R.; Matter, C.I.; Loessner, M.J.; Van Mierlo, J.T.; Dunne, M. Structural and Functional Characterization of the Receptor Binding Proteins of Escherichia coli O157 Phages EP75 and EP335. Comput. Struct. Biotechnol. J. 2021, 19, 3416–3426. [Google Scholar] [CrossRef]
- Li, H.; Marceau, M.; Yang, T.; Liao, T.; Tang, X.; Hu, R.; Xie, Y.; Tang, H.; Tay, A.; Shi, Y.; et al. East-Asian Helicobacter pylori Strains Synthesize Heptan-Deficient Lipopolysaccharide. PLoS Genet. 2019, 15, e1008497. [Google Scholar] [CrossRef]
- Tang, X.; Wang, P.; Shen, Y.; Song, X.; Benghezal, M.; Marshall, B.J.; Tang, H.; Li, H. Lipopolysaccharide O-Antigen Profiles of Helicobacter pylori Strains from Southwest China. BMC Microbiol. 2023, 23, 360. [Google Scholar] [CrossRef]
- Gao, S.; Jin, W.; Quan, Y.; Li, Y.; Shen, Y.; Yuan, S.; Yi, L.; Wang, Y.; Wang, Y. Bacterial Capsules: Occurrence, Mechanism, and Function. npj Biofilms. Microbiomes. 2024, 10, 21. [Google Scholar] [CrossRef] [PubMed]
- Berry, M.C.; McGhee, G.C.; Zhao, Y.; Sundin, G.W. Effect of a waaL Mutation on Lipopolysaccharide Composition, Oxidative Stress Survival, and Virulence in Erwinia amylovora. FEMS Microbiol. Lett. 2009, 291, 80–87. [Google Scholar] [CrossRef] [PubMed]
- Clifford, J.C.; Rapicavoli, J.N.; Roper, M.C. A Rhamnose-Rich O-Antigen Mediates Adhesion, Virulence, and Host Colonization for the Xylem-Limited Phytopathogen Xylella fastidiosa. Mol. Plant Micobe 2013, 26, 676–685. [Google Scholar] [CrossRef] [PubMed]
- Li, C.H.; Wang, K.C.; Hong, Y.H.; Chu, T.H.; Chu, Y.J.; Chou, I.C.; Lu, D.K.; Chen, C.Y.; Yang, W.C.; Lin, Y.M.; et al. Roles of Different Forms of Lipopolysaccharides in Ralstonia solanacearum Pathogenesis. Mol. Plant Micobe. 2014, 27, 471–478. [Google Scholar] [CrossRef]
- Petrocelli, S.; Tondo, M.L.; Daurelio, L.D.; Orellano, E.G. Modifications of Xanthomonas axonopodis pv. citri Lipopolysaccharide Affect the Basal Response and the Virulence Process during Citrus Canker. PLoS ONE 2012, 7, e40051. [Google Scholar] [CrossRef]
- Dy, R.L.; Richter, C.; Salmond, G.P.C.; Fineran, P.C. Remarkable Mechanisms in Microbes to Resist Phage Infections. Annu. Rev. Virol. 2014, 1, 307–331. [Google Scholar] [CrossRef]
- Rostøl, J.T.; Marraffini, L. (Ph)Ighting Phages: How Bacteria Resist Their Parasites. Cell Host Microbe 2019, 25, 184–194. [Google Scholar] [CrossRef]
- Fortuna, M.A.; Barbour, M.A.; Zaman, L.; Hall, A.R.; Buckling, A.; Bascompte, J. Coevolutionary Dynamics Shape the Structure of Bacteria-phage Infection Networks. Evolution 2019, 73, 1001–1011. [Google Scholar] [CrossRef]
- Koskella, B.; Brockhurst, M.A. Bacteria–Phage Coevolution as a Driver of Ecological and Evolutionary Processes in Microbial Communities. FEMS Microbiol. Rev. 2014, 38, 916–931. [Google Scholar] [CrossRef]
- Liu, M.; Tian, Y.; Zaki, H.E.M.; Ahmed, T.; Yao, R.; Yan, C.; Leptihn, S.; Loh, B.; Shahid, M.S.; Wang, F.; et al. Phage Resistance Reduced the Pathogenicity of Xanthomonas oryzae pv. oryzae on Rice. Viruses 2022, 14, 1770. [Google Scholar] [CrossRef]
- Zhang, M.; Wang, Y.; Chen, J.; Hong, X.; Xu, X.; Wu, Z.; Ahmed, T.; Loh, B.; Leptihn, S.; Hassan, S.; et al. Identification and Characterization of a New Type of Holin-Endolysin Lysis Cassette in Acidovorax oryzae Phage AP1. Viruses 2022, 14, 167. [Google Scholar] [CrossRef] [PubMed]
- Frampton, R.A.; Taylor, C.; Holguín Moreno, A.V.; Visnovsky, S.B.; Petty, N.K.; Pitman, A.R.; Fineran, P.C. Identification of Bacteriophages for Biocontrol of the Kiwifruit Canker Phytopathogen Pseudomonas syringae pv. actinidiae. Appl. Environ. Microbiol. 2014, 80, 2216–2228. [Google Scholar] [CrossRef] [PubMed]
- Gill, J.J.; Svircev, A.M.; Smith, R.; Castle, A.J. Bacteriophages of Erwinia amylovora. Appl. Environ. Microbiol. 2003, 69, 2133–2138. [Google Scholar] [CrossRef] [PubMed]
- Bhunchoth, A.; Phironrit, N.; Leksomboon, C.; Chatchawankanphanich, O.; Kotera, S.; Narulita, E.; Kawasaki, T.; Fujie, M.; Yamada, T. Isolation of Ralstonia solanacearum-infecting Bacteriophages from Tomato Fields in Chiang Mai, Thailand, and Their Experimental Use as Biocontrol Agents. J. Appl. Microbiol. 2015, 118, 1023–1033. [Google Scholar] [CrossRef]
- Dunne, M.; Prokhorov, N.S.; Loessner, M.J.; Leiman, P.G. Reprogramming Bacteriophage Host Range: Design Principles and Strategies for Engineering Receptor Binding Proteins. Curr. Opin. Biotechnol. 2021, 68, 272–281. [Google Scholar] [CrossRef]
- Miller, E.S.; Kutter, E.; Mosig, G.; Arisaka, F.; Kunisawa, T.; Rüger, W. Bacteriophage T4 Genome. Microbiol. Mol. Biol. Rev. 2003, 67, 86–156. [Google Scholar] [CrossRef]
- Casjens, S.R.; Hendrix, R.W. Bacteriophage Lambda: Early Pioneer and Still Relevant. Virology 2015, 479–480, 310–330. [Google Scholar] [CrossRef]
- Maffei, E.; Shaidullina, A.; Burkolter, M.; Heyer, Y.; Estermann, F.; Druelle, V.; Sauer, P.; Willi, L.; Michaelis, S.; Hilbi, H.; et al. Systematic Exploration of Escherichia Coli Phage–Host Interactions with the BASEL Phage Collection. PLoS Biol. 2021, 19, e3001424. [Google Scholar] [CrossRef]
- De Jonge, P.A.; Nobrega, F.L.; Brouns, S.J.J.; Dutilh, B.E. Molecular and Evolutionary Determinants of Bacteriophage Host Range. Trends Microbiol. 2019, 27, 51–63. [Google Scholar] [CrossRef]
- Bertozzi Silva, J.; Storms, Z.; Sauvageau, D. Host Receptors for Bacteriophage Adsorption. FEMS Microbiol. Lett. 2016, 363, fnw002. [Google Scholar] [CrossRef]
- Ha, E.; Chun, J.; Kim, M.; Ryu, S. Capsular Polysaccharide Is a Receptor of a Clostridium perfringens Bacteriophage CPS1. Viruses 2019, 11, 1002. [Google Scholar] [CrossRef] [PubMed]
- Letarov, A.V.; Kulikov, E.E. Adsorption of Bacteriophages on Bacterial Cells. Biochemistry 2017, 82, 1632–1658. [Google Scholar] [CrossRef] [PubMed]
- Lindberg, A.A. Bacteriophage Receptors. Annu. Rev. Microbiol. 1973, 27, 205–241. [Google Scholar] [CrossRef] [PubMed]
- Kiljunen, S.; Hakala, K.; Pinta, E.; Huttunen, S.; Pluta, P.; Gador, A.; Lönnberg, H.; Skurnik, M. Yersiniophage ϕR1-37 Is a Tailed Bacteriophage Having a 270 Kb DNA Genome with Thymidine Replaced by Deoxyuridine. Microbiology 2005, 151, 4093–4102. [Google Scholar] [CrossRef]
- Pinta, E.; Duda, K.A.; Hanuszkiewicz, A.; Salminen, T.A.; Bengoechea, J.A.; Hyytiäinen, H.; Lindner, B.; Radziejewska-Lebrecht, J.; Holst, O.; Skurnik, M. Characterization of the Six Glycosyltransferases Involved in the Biosynthesis of Yersinia enterocolitica Serotype O:3 Lipopolysaccharide Outer Core. J. Biol. Chem. 2010, 285, 28333–28342. [Google Scholar] [CrossRef]
- Zhang, M.; Qian, J.; Xu, X.; Ahmed, T.; Yang, Y.; Yan, C.; Elsharkawy, M.M.; Hassan, M.M.; Alorabi, J.A.; Chen, J.; et al. Resistance of Xanthomonas oryzae pv. oryzae to Lytic Phage X2 by Spontaneous Mutation of Lipopolysaccharide Synthesis-Related Glycosyltransferase. Viruses 2022, 14, 1088. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, J.; Lu, X.; Liang, W.; Zhang, L.; Kan, B. O Antigen is the Receptor of Vibrio cholerae Serogroup O1 El Tor Typing Phage VP4. J. Bacteriol. 2013, 195, 798–806. [Google Scholar] [CrossRef]
- Burrows, L.L.; Pigeon, K.E.; Lam, J.S. Pseudomonas aeruginosa B-Band Lipopolysaccharide Genes wbpA and wbpI and Their Escherichia coli Homologues wecC and wecB are Not Functionally Interchangeable. FEMS Microbiol. Lett. 2000, 189, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Wenzel, C.Q.; Daniels, C.; Keates, R.A.B.; Brewer, D.; Lam, J.S. Evidence that WbpD is an N-acetyltransferase Belonging to the Hexapeptide Acyltransferase Superfamily and an Important Protein for O-antigen Biosynthesis in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 2005, 57, 1288–1303. [Google Scholar] [CrossRef]
- Westman, E.L.; Preston, A.; Field, R.A.; Lam, J.S. Biosynthesis of a Rare Di-N-Acetylated Sugar in the Lipopolysaccharides of Both Pseudomonas aeruginosa and Bordetella pertussis Occurs via an Identical Scheme despite Different Gene Clusters. J. Bacteriol. 2008, 190, 6060–6069. [Google Scholar] [CrossRef]
- Capotosti, F.; Guernier, S.; Lammers, F.; Waridel, P.; Cai, Y.; Jin, J.; Conaway, J.W.; Conaway, R.C.; Herr, W. O-GlcNAc Transferase Catalyzes Site-Specific Proteolysis of HCF-1. Cell 2011, 144, 376–388. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Fleites, C.; Macauley, M.S.; He, Y.; Shen, D.L.; Vocadlo, D.J.; Davies, G.J. Structure of an O-GlcNAc Transferase Homolog Provides Insight into Intracellular Glycosylation. Nat. Struct. Mol. Biol. 2008, 15, 764–765. [Google Scholar] [CrossRef] [PubMed]
- Pei, T.; Yan, M.; Li, T.; Li, X.; Yin, Y.; Cui, M.; Fang, Y.; Liu, J.; Kong, Y.; Xu, P.; et al. Characterization of UDP-Glycosyltransferase Family Members Reveals How Major Flavonoid Glycoside Accumulates in the Roots of Scutellaria baicalensis. BMC Genom. 2022, 23, 169. [Google Scholar] [CrossRef] [PubMed]
- Thoden, J.B.; Holden, H.M. Biochemical and Structural Characterization of WlbA from Bordetella pertussis and Chromobacterium violaceum: Enzymes Required for the Biosynthesis of 2,3-Diacetamido-2,3-Dideoxy-d-Mannuronic Acid. Biochemistry 2011, 50, 1483–1491. [Google Scholar] [CrossRef]
- Ge, X.; Wang, J. Structural Mechanism of Bacteriophage Lambda Tail’s Interaction with the Bacterial Receptor. Nat. Commun. 2024, 15, 4185. [Google Scholar] [CrossRef]
- Xie, G.L.; Zhang, G.Q.; Liu, H.; Lou, M.M.; Tian, W.X.; Li, B.; Zhou, X.P.; Zhu, B.; Jin, G.L. Genome Sequence of the Rice-Pathogenic Bacterium Acidovorax avenae subsp. avenae RS-1. J. Bacteriol. 2011, 193, 5013–5014. [Google Scholar] [CrossRef]
- Simon, R.; Priefer, U.; Pühler, A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat. Biotechnol. 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Chen, Y.; Chai, Y.; Guo, J.; Losick, R. Evidence for Cyclic Di-GMP-Mediated Signaling in Bacillus subtilis. J. Bacteriol. 2012, 194, 5080–5090. [Google Scholar] [CrossRef]
- Ogunyemi, S.O.; Chen, J.; Zhang, M.; Wang, L.; Masum, M.M.I.; Yan, C.; An, Q.; Li, B.; Chen, J. Identification and Characterization of Five New OP2-Related Myoviridae Bacteriophages Infecting Different Strains of Xanthomonas oryzae pv. oryzae. J. Plant Pathol. 2019, 101, 263–273. [Google Scholar] [CrossRef]
- Springer, K.; Reuter, S.; Knüpfer, M.; Schmauder, L.; Sänger, P.-A.; Felsl, A.; Fuchs, T.M. Activity of a Holin-Endolysin System in the Insecticidal Pathogenicity Island of Yersinia enterocolitica. J. Bacteriol. 2018, 200, e00180-18. [Google Scholar] [CrossRef]
- Zhao, X.; Cui, Y.; Yan, Y.; Du, Z.; Tan, Y.; Yang, H.; Bi, Y.; Zhang, P.; Zhou, L.; Zhou, D.; et al. Outer Membrane Proteins Ail and OmpF of Yersinia pestis are Involved in the Adsorption of T7-Related Bacteriophage Yep-Phi. J. Virol. 2013, 87, 12260–12269. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Qiu, W.; Chen, L.; Anjum, S.; Yu, M.; Shan, C.; Ilyas, M.; Li, B.; Wang, Y.; Sun, G. Identification of Pathogenicity-Related Genes in Biofilm-Defective Acidovorax citrulli by Transposon Tn5 Mutagenesis. Int. J. Mol. Sci. 2015, 16, 28050–28062. [Google Scholar] [CrossRef]
- Coenye, T.; Peeters, E.; Nelis, H.J. Biofilm Formation by Propionibacterium Acnes is Associated with Increased Resistance to Antimicrobial Agents and Increased Production of Putative Virulence Factors. Res. Microbiol. 2007, 158, 386–392. [Google Scholar] [CrossRef]
- Bahar, O.; Goffer, T.; Burdman, S. Type IV Pili are Required for Virulence, Twitching Motility, and Biofilm Formation of Acidovorax avenae subsp. citrulli. Mol. Plant. Micobe. 2009, 22, 909–920. [Google Scholar] [CrossRef]
- Masum, M.; Yang, Y.; Li, B.; Olaitan, O.; Chen, J.; Zhang, Y.; Fang, Y.; Qiu, W.; Wang, Y.; Sun, G. Role of the Genes of Type VI Secretion System in Virulence of Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae Strain RS-2. Int. J. Mol. Sci. 2017, 18, 2024. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Tian, W.X.; Ibrahim, M.; Li, B.; Zhang, G.Q.; Zhu, B.; Xie, G.L. Characterization of pilP, a Gene Required for Twitching Motility, Pathogenicity, and Biofilm Formation of Acidovorax avenae subsp. avenae RS-1. Eur. J. Plant Pathol. 2012, 134, 551–560. [Google Scholar] [CrossRef]
- Kiljunen, S.; Datta, N.; Dentovskaya, S.V.; Anisimov, A.P.; Knirel, Y.A.; Bengoechea, J.A.; Holst, O.; Skurnik, M. Identification of the Lipopolysaccharide Core of Yersinia pestis and Yersinia pseudotuberculosis as the Receptor for Bacteriophage φA1122. J. Bacteriol. 2011, 193, 4963–4972. [Google Scholar] [CrossRef]
Protein | PSMs | Function |
---|---|---|
Orf2086 | 7 | Glycosyl transferase |
Orf1561 | 6 | Transmembrane protein RcnB |
Orf2292 | 3 | T6SS ClpB |
Orf2286 | 3 | T6SS ImpB |
Attribute | RS-1 | RS-2 | ||
---|---|---|---|---|
Value | % of Total | Value | % of Total | |
Genome size (bp) | 5,580,732 | 100 | 5,757,931 | 100 |
DNA coding (bp) | 4,978,677 | 89.21 | 5,138,955 | 89.25 |
DNA G + C (bp) | 3,830,703 | 68.64 | 3,949,796 | 68.60 |
DNA scaffolds | 1 | 100 | 1 | 100 |
Total genes | 5070 | 100 | 5230 | 100 |
Protein-coding genes | 4992 | 98.46 | 5155 | 98.57 |
RNA genes | 78 | 1.54 | 75 | 1.43 |
Genes with function prediction | 3966 | 79.45 | 4054 | 78.64 |
Genes assigned to COGs | 3439 | 67.83 | 3496 | 66.85 |
Genes with Pfam domains | 4039 | 79.66 | 4152 | 79.39 |
Genes with signal peptides | 452 | 8.92 | 462 | 8.83 |
Genes with transmembrane helices | 1120 | 22.09 | 1149 | 21.97 |
Genes with genome islands | 185 | 3.65 | 195 | 3.73 |
Genes with virulence | 1686 | 33.25 | 1728 | 33.04 |
Genes with secondary metabolism | 1069 | 21.08 | 1113 | 21.28 |
Genes with antibiotic resistance | 280 | 5.52 | 288 | 5.51 |
Name | Relevant Characteristics | Reference |
---|---|---|
Acidovorax oryzae | ||
RS-1 | AmpR; the pathogen of bacterial brown stripe of rice, isolated from diseased rice from Zhejiang province in China. AP1-resistant strain. | Lab collection |
RS-2 | AmpR; the pathogen of bacterial brown stripe of rice, isolated from diseased rice from Zhejiang province in China. AP1-sensitive strain. | Lab collection |
Unique gene mutants | AmpR, KmR; the unique gene mutants of Acidovorax oryzae RS-2. | This study |
Unique gene complementary mutants | AmpR, KmR, ChlR; the unique gene complementary mutants of Acidovorax oryzae RS-2. | This study |
Escherichia coli | ||
DH5α | F-Φ80d lacZΔM15Δ (lacZYA-argF) U169 recA1 endA1, hsdR17(rk–, mk+) phoAsupE44 λ-thi-1 gyrA96 relA1. | Invitrogen |
S17-1 λ pir | λ Lysogenic S17-1 derivative producing π protein for replication of plasmids carrying oriR6K; recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 λ–pir. | [56] |
BTH101 | Host for overexpressing proteins in bacterial two-hybrid test. | [57] |
BL21(DE3) | Host for overexpressing proteins driven by T7 promoter. | Invitrogen |
Plasmids | ||
pJP5603 | KmR; R6K-based suicide vector; requires the pir-encoded π protein for replication. | [56] |
pGEX-6p-1 | AmpR; expression vector with GST label. | Promega |
pGEX-6p-1-gp47 | AmpR; recombinant expression vector with GST label with a gp47. | This study |
pGEX-6p-1-gp48 | AmpR; recombinant expression vector with GST label with a gp48. | This study |
pGEX-6p-1-gp65 | AmpR; recombinant expression vector with GST label with a gp65. | This study |
pGEX-6p-1-gp66 | AmpR; recombinant expression vector with GST label with a gp66. | This study |
pGEX-6p-1-gp67 | AmpR; recombinant expression vector with GST label with a gp67. | This study |
pGEX-6p-1-gp69 | AmpR; recombinant expression vector with GST label with a gp69. | This study |
pCH363 | AmpR; expression vector for bacterial two-hybrid test. | [58] |
pKNT25 | KmR; expression vector for bacterial two-hybrid test. | [58] |
pCH-66 | AmpR; recombinant expression vector for bacterial two-hybrid test. | This study |
pKNT-GT | KmR; recombinant expression vector for bacterial two-hybrid test. | This study |
pKNT-RcnB | KmR; recombinant expression vector for bacterial two-hybrid test. | This study |
pKNT-ClpB | KmR; recombinant expression vector for bacterial two-hybrid test. | This study |
Name | Sequence (5′-3′) | Usage |
---|---|---|
Ao | GACCAGCCACACTGGGAC/CTGCCGTACTCCAGCGAT | A. oryzae screen |
16S rRNA | AGAGTTTGATCCTGGCTCAG/GGCTACCTTGTTACGACTTC | 16S rDNA |
gp47 | ATATAGGATCCATGGCCCTGCGCAAGAACTCCTC/TGTCAGTCGACTCAGCCTTGCGCGAAGGCG | Prokaryotic expression of the corresponding proteins |
gp48 | ATAGGATCCATGAAGTTCTACGCCCCCACCG/TGTCAGTCGACTCAGCCGTTCACGTCTTCGAAG | |
gp65 | ATATAGGATCCGTGCCGGGCAAAGTGCTCG/TGTCAGTCGACTCATGGTCCACGCGTCACCT | |
gp66 | CGGGATCCGTGGACCATGACGTGCTTTTCG/TGTCAGTCGACCTATGCGAGGTTGATGGGTGGTTG | |
gp67 | CGGGATCCATGGCCGCAAAATCTTTCATTCGC/TGTCAGTCGACTTATGCCAGTACCACCGGCAG | |
gp69 | CGGGATCCATGAGCCTTCGCTACCAACTGAC/TGTCAGTCGACTCAGTCCCTATGCACGGTGGAC | |
gp66 B2H | CGGGATCCGTGGACCATGACGTGCTTTTCG/CGGAATTCCTATGCGAGGTTGATGGGTGGTTG | Full sequence of the corresponding proteins for B2H |
GT B2H | CGGGATCCGTGAACCGCGCCCGCATCT/CGGAATTCCTACAGCCCGAAGAAGGGGCG | |
RcnB B2H | CGGGATCCATGATCCGTACAGACTCCTCTTGCG/CGGAATTCCTACTGGAAGACGATCTGCGCG | |
ClpB B2H | GCTCTAGAATGTCTGAAATCAGCCGGCAAGC/CGGAATTCTCAGGCCTCCTCGTACTCGATG | |
ImpB B2H | CGGGATCCATGGTGACCTTAAGCAAGACCGG/CGGAATTCTCACTGAGCGTCGTCGGTCTT | |
1713 | CGCGGATCCGCAGGGCGGCAAAGAT/CCGGAATTCCGTTCACCAGGGCGATA | Primers used for the creation of mutants |
1714 | CGGGATCCTGGGCTGCGATGTGA/GGAATTCGCTTCTTGCCTTTGACG | |
1715 | CGGGATCCCAGTGCCGTATTCACCAA/CCGGAATTCCTTCGCCATTTCCAGTC | |
1716 | CGCGGATCCCGAAATCGCAGCACG/CCGGAATTCTGAGGAACGCAATGACC | |
1717 | CGGGATCCCAACACTACGATGCGAACA/CCGGAATTCAAGCAGGCTGGAAACC | |
1717.1 | CGGGATCCCCAGTAAAGGCGGTTCT/CGGAATTCGGGCATCCCGATAAAG | |
1718 | CGCGGATCCCGCTCCTGGACGATGT/CCGGAATTCCCGCAGATGCACCTATT | |
1718.1 | CGGGATCCCAAGATGCGTGGCGTGAA/CGGAATTCGCTCGTCGGAAGGAACCC | |
1718.2 | CGGGATCCGGGGTATGAGTGGGAGTTGC/CGGAATTCATTTATTGCTGCCTGGGTTTT | |
1718.3 | CGGGATCCATTGCCGTTCCGTATCGC/CGGAATTCAACTGACATTGCCTGGTATGCT | |
1719 | CGGGATCCGGACCTGATGGAGACGG/CCGGAATTCCGGGCACAGAACACCT | |
1720 | CGCGGATCCAGGTTCCTCACGGTTTCT/CCGGAATTCCGCTCGCAGATTTCG | |
1721 | CGGGATCCATGTCCTTCCTCGTCTCG/CCGGAATTCCAATCGCACGCTGTCC | |
1722 | CGCGGATCCTTCTCAGCACCCAATCAT/CCGGAATTCAGGTCCGTGGCAAATC | |
1723 | CGCGGATCCGCATTACCTGCTCTATGACTT/CCGGAATTCGGCGGATACACCACTTCT | |
pRADK-1714 | TGCCATGGTACCCGGGAGCTCGGGAGTTCGAATCCTGGGG/CGCGTCTGCATGTGGAAGCTTTCAACGAACGAAGGGATGCC | Primers used for the creation of complementary strains |
pRADK-1715 | TGCCATGGTACCCGGGAGCTCCCCGACGACGTCAAAGGC/CGCGTCTGCATGTGGAAGCTTTCAAATACGTTGGACCCGGC | |
pRADK-1716 | TGCCATGGTACCCGGGAGCTCCGCCGGACCGTCGTCCGC/CGCGTCTGCATGTGGAAGCTTTCATTTTTCCAATGCCATTGC | |
pRADK-1717 | TGCCATGGTACCCGGGAGCTCTCCCGAAGTCGTTCGGCC/CGCGTCTGCATGTGGAAGCTTTCAGTCAGCACCCATGATTTCC | |
pRADK-1718 | TGCCATGGTACCCGGGAGCTCGGTCACAGACCCGTTGCCA/CGCGTCTGCATGTGGAAGCTTTCAAATAGTCCATTCCACGGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Zhang, Y.; Gu, C.; Luo, J.; Shen, Y.; Huang, X.; Xu, X.; Ahmed, T.; Alodaini, H.A.; Hatamleh, A.A.; et al. Strain-Specific Infection of Phage AP1 to Rice Bacterial Brown Stripe Pathogen Acidovorax oryzae. Plants 2024, 13, 3182. https://doi.org/10.3390/plants13223182
Liu M, Zhang Y, Gu C, Luo J, Shen Y, Huang X, Xu X, Ahmed T, Alodaini HA, Hatamleh AA, et al. Strain-Specific Infection of Phage AP1 to Rice Bacterial Brown Stripe Pathogen Acidovorax oryzae. Plants. 2024; 13(22):3182. https://doi.org/10.3390/plants13223182
Chicago/Turabian StyleLiu, Mengju, Yang Zhang, Chunyan Gu, Jinyan Luo, Ying Shen, Xuefang Huang, Xinyan Xu, Temoor Ahmed, Hissah Abdulrahman Alodaini, Ashraf Atef Hatamleh, and et al. 2024. "Strain-Specific Infection of Phage AP1 to Rice Bacterial Brown Stripe Pathogen Acidovorax oryzae" Plants 13, no. 22: 3182. https://doi.org/10.3390/plants13223182
APA StyleLiu, M., Zhang, Y., Gu, C., Luo, J., Shen, Y., Huang, X., Xu, X., Ahmed, T., Alodaini, H. A., Hatamleh, A. A., Wang, Y., & Li, B. (2024). Strain-Specific Infection of Phage AP1 to Rice Bacterial Brown Stripe Pathogen Acidovorax oryzae. Plants, 13(22), 3182. https://doi.org/10.3390/plants13223182