Next Article in Journal
Echinacea purpurea and Onopordum acanthium Combined Extracts Cause Immunomodulatory Effects in Lipopolysaccharide-Challenged Rats
Previous Article in Journal
Unlocking the Hidden Potential of Rosemary (Salvia rosmarinus Spenn.): New Insights into Phenolics, Terpenes, and Antioxidants of Mediterranean Cultivars
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H

by
Qiyu Yang
,
Youwei Fan
,
Shuwen Luo
,
Chun Liu
* and
Suxia Yuan
*
State Key Laboratory of Vegetable Biobreeding, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2024, 13(23), 3396; https://doi.org/10.3390/plants13233396
Submission received: 9 October 2024 / Revised: 10 November 2024 / Accepted: 2 December 2024 / Published: 3 December 2024
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

:
Hydrangea macrophylla, renowned for its large inflorescences and a diverse range of colors, highlights a significant limitation in current gene function research, which is the lack of effective molecular genetic tools. This study utilized a tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) system to investigate gene function through posttranscriptional gene silencing in H. macrophylla for the first time. The ortholog of phytoene desaturase (PDS) in H. macrophylla, termed HmPDS, was identified. Infection of tissue-cultured seedlings with TRV-HmPDS led to photobleaching of the leaves. Additionally, infection with TRV containing the HmCHS1 fragment in the flowers resulted in decreased anthocyanin production in sepals and a lightening of sepal coloration in the infected flowers. The phenomena and RT-qPCR results proved that the PDS and CHS genes of hydrangea were successfully silenced via the vacuum infiltration method. Furthermore, the introduction of TRV-HmF3′5′H revealed a decrease in delphinidin-3-glucoside content in sepals and caused a color change in the sepals from blue to pink. This study demonstrated that the TRV-VIGS system was successfully established in H. macrophylla and effectively applied to the function analysis of HmF3′5′H.

1. Introduction

Hydrangea macrophylla is an important ornamental plant with significant commercial value as potted, cut, and dried flowers. Additionally, it is highly favored by consumers for its huge flower clusters, vibrant flower colors, diverse varieties, and extended blooming duration. Furthermore, H. macrophylla is commonly cultivated in gardens due to its strong adaptability, resistance to diseases and pests, and tolerance to cold and shade. Additionally, research has indicated that H. macrophylla possesses various medicinal properties [1,2,3]. Nevertheless, functional genomic research remains constrained due to the absence of efficient molecular genetic tools. Therefore, it is imperative to develop tools for elucidating gene functions within H. macrophylla.
Virus-induced gene silencing (VIGS) technology harnesses a recombinant viral vector that includes a fragment of a target plant gene to activate RNA-mediated post-transcriptional gene silencing, resulting in the suppression of transcripts of homologous genes [4,5]. Comparison to gene silencing techniques that utilize inverted repeat sequences, VIGS presents several benefits, such as simpler plasmid construction, a brief operational period, and the ability to identify embryo-lethal genes [6]. Recently, a Tobacco rattle virus (TRV)-based VIGS technology has been applied to various ornamental plants to verify gene function, such as Paeonia ostia [7], Rosa sp. [8], and Lily [9]. VIGS is increasingly acknowledged as a highly valuable tool for exploring gene function. A key advantage of VIGS is its ability to produce rapid phenotypes without requiring stable plant transformation [10]. In comparison to other methods, including T-DNA, transposon insertion techniques, chemical and physical mutagenesis, and functional genome editing approaches like CRISPR-Cas, VIGS is a cost-effective option [11]. However, no reports have yet documented the successful use of TRV in H. macrophylla for gene silencing.
In this study, we aim to establish a VIGS system in H. macrophylla and use it for the functional validation of the HmF3′5′H gene. This VIGS system will be employed for the functional characterization of hydrangea genes in future studies.

2. Results

2.1. Identification of HmPDS

The ORF nucleotide sequence of phytoene desaturase (PDS) from H. macrophylla, referred to as HmPDS, was amplified by PCR and annotated based on transcriptome data. HmPDS was predicted to encode a protein comprising 581 amino acids with three motifs, including a dinucleotide binding motif, a putative substrate carrier motif, and a carotenoid binding domain. The sequence of HmPDS was submitted to the NCBI database under accession number GenBank: PQ285401. Multiple sequence alignments revealed the amino acid sequence of HmPDS exhibited identities that varied from 82.4% to 85.9% with homologous sequences identified from six other plant species (Figure 1).

2.2. Silencing of the PDS Gene in Plantlets of H. macrophylla

The TRV-HmPDS recombinant was designed to target the endogenous PDS gene in leaves of H. macrophylla via vacuum infiltration. Thirty days post-infection, 60% of the TRV-HmPDS-infected seedlings displayed a photo-bleached phenotype (Figure 2A), whereas control plantlets infected with TRV retained green coloration. The presence of TRV in hydrangea was confirmed by RT-qPCR with primers specific to the TRV2 coat protein. The expression of PDS was significantly reduced in TRV-HmPDS-infected plantlets compared to the TRV-infected controls (Figure 2B). Furthermore, the levels of chlorophyll a, chlorophyll b, and total chlorophyll were all decreased in plantlets with HmPDS silencing (Figure 2C). These results demonstrate that HmPDS in plantlets of H. macrophylla can be effectively silenced using the VIGS system.

2.3. Evaluation of a VIGS System in H. macrophylla Flowes

To assess the efficacy of VIGS in flowers of H. macrophylla, the chalcone synthase (CHS) gene HmCHS1 was targeted for silencing in stage 2 flowers of ‘Bailmer’ flowers. Phenotypic observations were conducted 15 days post-infection (Figure 3A). Sepals, rather than petals, are the primary ornamental structures of hydrangea flowers. In the TRV-infected flowers, the pink sepals and blue sepals both exhibited darker coloration, while TRV-HmCHS1-infected flowers displayed lighter-colored sepals (Figure 3A,B).
RT-qPCR was conducted to confirm the presence of TRV and validate the suppression of HmCHS1 expression. In the flowers infected with TRV-HmCHS1, the expression level of HmCHS1 was significantly reduced compared to uninfected and TRV-infected flowers (Figure 3C). Furthermore, the total anthocyanin content was notably diminished in the HmCHS1-silenced flowers (Figure 3D). These results confirmed the applicability of the VIGS method for functional studies of genes related to flower coloration in H. macrophylla.

2.4. Functional Validation of the F3′5′H Gene in H. macrophylla

To evaluate the function of the F3′5′H gene in anthocyanin synthesis, the TRV-HmF3′5′H construct was introduced into stage 2 sepals of ‘Bailmer’ flowers via vacuum infiltration. Phenotypic observations were conducted at 15 days post-infection (Figure 4A). In the TRV-infected flowers, the sepals exhibited blue coloration, whereas in the TRV-F3′5′H-infected flowers, the sepals turned pink due to the silencing of HmF3′5′H (Figure 4A,B).
RT-qPCR was employed to validate the suppression of HmF3′5′H expression. In flowers infected with TRV-HmF3′5′H, the expression level of HmF3′5′H was significantly decreased compared to the flowers infected with TRV alone (Figure 4B). Furthermore, the content of delphinidin-3-glucoside and total anthocyanidin decreased in F3′5′H-silenced flowers (Figure 4C). Delphinidin-3-glucoside was no longer the dominant anthocyanin component in HmF3′5′H-silenced flowers.

3. Discussion

VIGS technology has been widely employed as a rapid, convenient, and efficient tool for gene functional verification across a variety of plant species [12,13,14,15,16,17,18]. To elucidate significant agricultural traits in H. macrophylla, an increasing number of gene sequences associated with various biological processes have been identified, including high-aluminum stress response [19,20], flower induction [21,22], embryo development [23], anthocyanin biosynthesis [20], and blue flower formation [24,25]. Given the challenges associated with stable genetic transformation in hydrangea, developing new techniques to characterize the functions of identified genes has become a pressing issue. In this study, we evaluated the applicability of the VIGS-based silencing system via vacuum infiltration in tissue-cultured seedlings and cut flowers of H. macrophylla. Furthermore, the system was successfully employed to validate the functions of the HmCHS1 and HmF3′5′H genes. All data indicate that the TRV-based VIGS protocol was effective for characterizing gene function in H. macrophylla.
In order to improve the infection efficiency in tissue-cultured seedlings, vacuum infiltration and syringe injection methods were compared. We found that the traditional syringe injection method was time-consuming and insufficiently effective compared to the vacuum infiltration method. The physiological structure of hydrangea leaves likely affects the entry of the agrobacterial mixture. The injection of TRV constructs effectively only a limited area of leaves. Additionally, the syringe injection method was prone to causing mechanical damage to the leaves. Previous studies have demonstrated that the vacuum infiltration method was more efficient compared to other infiltration techniques [26,27]. Consequently, vacuum infiltration of the entire tissue-cultured seedlings was a suitable approach in H. macrophylla.
Targeted TRV-induced silencing of the HmPDS gene using the vacuum infiltration method in tissue-cultured seedlings resulted in a photobleached phenotype of leaves (Figure 2A), with an infection rate of 60% that was relatively higher than the 34% reported for TRV-RhPDS in Rosa sp. [8]. Notably, nearly all photobleached leaves exhibited patchy phenotypes, such as white spots or areas of incomplete whitening. We were unable to observe a silencing phenotype in mature leaves, possibly because chlorophyll synthesis in these leaves had ceased. Additionally, the phenotype of PDS silencing was particularly pronounced around the leaf veins (Figure 2A). This observation was consistent with previous reports indicating that viral colonization or systemic silencing predominantly occurs in the vascular system [28].
The length of the insert fragment in the viral vector was closely associated with the efficiency of gene silencing. In TRV-infected tobacco, varying lengths of PDS insert fragments result in different patterns and extents of photobleaching, and the effective gene lengths of the insert should be in the range of ~200 bp to ~1300 bp [27,29]. In this study, we inserted 300 bp to 400 bp gene fragments into the TRV2 vector, followed by successful silencing of the three genes. Additionally, some factors, including growth temperature and light, also significantly influenced the efficiency of VIGS [9]. In the study, the TRV-HmPDS infected plants were shaded for three days and maintained at a slightly lower temperature to facilitate plantlet recovery and the Tobacco rattle virus survival.
Flavonoids are crucial metabolites in flowering plants. They are modified to produce various anthocyanins, which confer different colors to flowers. The flavonoid biosynthetic pathway involves the conversion of three molecules of malonyl CoA to chalcone and one molecule of ρ-coumaroyl CoA, catalyzed by chalcone synthase (CHS). Chalcone serves as a precursor for anthocyanin synthesis, undergoing isomerization, hydroxylation, glycosylation, and acetylation to produce various types of anthocyanins [30]. To establish a VIGS system in flowers, sepals were used as the site of infection, and the HmCHS1 gene related to flower coloration that was identified in our previous study [20] was employed. This experiment confirmed that the HmCHS1 gene was successfully silenced in hydrangea flowers via the VIGS system.
In the anthocyanin synthesis pathway, F3′5′H and F3′H play essential roles in the production of cyanidin and delphinidin, respectively [31]. Previous studies have shown that delphinidin-3-glucoside in H. macrophylla forms blue complexes with Al3+ and copigments, imparting a blue color to the sepals [32,33,34,35,36]. Therefore, F3′5′H is a key structural gene regulating the formation of blue flowers. In this research, the blue sepals at stage 2 were used for verifying the function of the F3′5′H gene. Silencing of the F3′5′H gene previously identified [20] led to a decrease in delphinidin-3-glucoside levels; moreover, delphinidin-3-glucoside was no longer the predominant anthocyanin component (Figure 4). Our previous research indicated that the ratio of delphinidin-3-glucoside to total anthocyanins in the sepals was a crucial determinant of the sepal color bluing potential in H. macrophylla [36]. Thus, the sepal color in the HmF3′5′H-silenced group shifted from blue to pink. Therefore, we conclude that HmF3′5′H was a critical gene involved in the synthesis of delphinidin-3-glucoside.

4. Materials and Methods

4.1. Plant Materials

The cultivar ‘Bailmer’ of H. macrophylla was used in this study. Tissue-cultured seedlings were maintained at 25 °C under a light intensity of 2000 lx and a 16 h light/8 h dark cycle. The rooted, tissue-cultured seedlings, which grew to a height of 5–8 cm, were removed from the bottle and precultured in water for one week at 60–80% humidity without altering the culture conditions prior to infection. Cut flowers with the majority of sepals at stage 2 were selected for infection [20].

4.2. RNA Extraction

Total RNA was extracted from the upper leaves and sepals of ‘Bailmer’ following the manufacturer’s protocol of the E.Z.N.A® Plant RNA Kit (OMEGA Bio-tek Inc., Doraville, GA, USA). RNA integrity was confirmed via 1.0% agarose gel electrophoresis. Vazyme HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech Co., Ltd., Nanjing, China) was used to synthesize first-strand cDNA following the manufacturer’s protocol.

4.3. Isolation and Cloning of HmPDS, HmF3′5′H, and HmCHS1

Phytoene desaturase (PDS) protein sequences from other species were used to screen for homologous sequences in hydrangea using BlasTp based on full-length transcriptome data [20]. The primers used for cloning the open reading frame (ORF) of the HmPDS, HmCHS1 (ON375346.1), and HmF3′5′H (ON375346.1) genes are listed in Table 1. PCR was conducted in a 50 μL reaction volume containing 3 μL of cDNA, 25 μL of KOD OneTM PCR Master Mix (Toyobo, Osaka, Japan), 18 μL of ddH2O, and 2 μL of each forward and reverse primer. The conditions for PCR amplification included an initial denaturation at 98 °C for 2 min, followed by 33 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 5 s, and extension at 72 °C for 30 s, concluding with a final extension at 72 °C for 2 min. The purified PCR products were ligated into the cloning vector using the pCloneEZ-Blunt/TA TOPO Cloning Kit (Taihegene, Beijing, China). All cloning plasmids were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).

4.4. Multiple Sequence Alignment

Six PDS homologous protein sequences, which have been identified from grape, tobacco, petunia, tea, and Arabidopsis, were obtained from the NCBI database [14,37,38,39,40,41]. Multiple sequence alignment of HmPDS with homologous proteins was conducted with Clustal X 1.81 and BioEdit 7.0 software.

4.5. Construction of TRV Plasmids and Agrobacterium Transformation

To generate pTRV2-HmPDS, pTRV2-HmCHS1, and pTRV2-HmF3′5′H, the restriction enzymes EcoRI and KpnI (Thermo Fisher Scientific Inc., Waltham, MA, USA) were used to digest the pTRV2 vector. The 382 bp, 332 bp, and 340 bp consensus fragments of HmPDS, HmCHS1, and HmF3′5′H were PCR-amplified, respectively, using KOD OneTM PCR Master Mix (TOYOBO, Shanghai, China) with the primers listed in Table 2. The recombination of the inserted fragments was performed using the ClonExpress® II One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China), and the resulting constructs were then transformed into E. coli TOP10 (Zhuangmeng, Beijing, China). After overnight cultivation at 37 °C, the presence of inserts was sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). The construction of pTRV2-HmPDS, pTRV2-HmCHS1, and pTRV2-HmF3′5′H vectors is shown in Figure 5. Finally, the successfully constructed vectors were transformed into the Agrobacterium tumefaciens strain GV3101 (Zhuangmeng, Beijing, China) using the heat shock method. After overnight cultivation at 28 °C, PCR was performed to identify positive clones.

4.6. Virus-Induced Gene Silencing

Positive monoclonal Agrobacterium strains containing pTRV1, pTRV2, pTRV2-HmPDS, pTRV2-HmCHS1, and pTRV2-HmF3′5′H plasmids were separately selected and cultured in liquid LB medium with antibiotics (50 mg·L−1 kanamycin, 25 mg·L−1 rifampicin). The solutions were shaken at 28 °C, 180 rpm, for 16 h, until the optical density (OD600) was between 0.8 and 1.2. The Agrobacterium cells were harvested by centrifugation (5000× g, 6 min) and resuspended to an OD600 of approximately 1.5 using the infestation solution (pH 5.6) containing 10 mM MgCl2, 10 mM MES, and 200 μM acetosyringone. Agrobacterium cultures containing pTRV1 and pTRV2-target gene constructs were mixed in a 1:1 (v/v) ratio. The culture mixtures were incubated in the dark at 25 °C for 3 to 5 h before treatment.
For VIGS in cut hydrangea flowers, the flowering branches were cut to approximately 5 cm in length in clean water and placed in distilled water for at least 2 h to acclimate to the indoor environment. The plantlets from tissue culture were precultured in deionized water for 7 days. The cut flowers and plantlets were immersed in culture mixtures and then exposed twice to 1 min durations of vacuum (−25 kPa). After the release of the vacuum, the plant materials were cleaned with deionized water and cultured in the dark at 8 to 12 °C for 3 days. After incubation, the cut flowers and plantlets were cultured with a 16 h light/8 h dark cycle at 25 °C for 15 days.

4.7. Quantitative Real-Time Fluorescent PCR (RT-qPCR) Analysis

RT-qPCR was used to investigate the expression levels of the target genes in silenced samples. Primers for qRT-PCR were designed using Primer Premier v5.0 software (Premier Biosoft Int., Palo Alto, CA, USA) (Table 3). The specificity and efficiency of the primers were confirmed using 1.5% agarose gel electrophoresis. All reactions were conducted in 96-well plates using the CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA). RT-qPCR analyses were conducted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) according to the manufacturer’s instructions. Each PCR reaction (20 μL) contained 5 μL of cDNA (100–200 ng/μL), 0.4 μL of each primer (10 pmol/μL), 10 μL of 2 × Taq Pro Universal SYBR qPCR Master Mix, and 4.2 μL of ddH2O. Amplification reactions referred to previous studies performed [42]. The coat protein gene was detected to verify whether TRV had successfully infected the flowers or seedlings [43]. HmEF1-β was used as the internal reference gene [44]. The relative expression levels of the target genes were calculated using the 2−ΔΔCT method [45] relative to the internal control.

4.8. The Extraction and Measurement of Chlorophyll

Chlorophyll content was measured using a previously established method with some modifications [46]. The upper leaves of the uninfected and TRV-infected plantlets were collected, and each 0.2 g sample was placed in 80% acetone for 24 h to extract chlorophyll. Absorbance values of the extracts at 663 nm and 645 nm were measured using a spectrophotometer (Model 752, Shanghai, China). Three biological replicates were performed for each sample.

4.9. The Extraction and Measurement of Total Anthocyanins

Anthocyanins were extracted and quantified using the Plant Anthocyanin Content Assay Kit (BOXBIO, Beijing, China) according to the manufacturer’s protocol. Briefly, 0.1 g of infected sepal samples from the upper flower of the inflorescence were selected, and 1 mL of extraction solution was added. The samples were then ground thoroughly with a mortar and pestle until a homogeneous slurry was obtained. After extraction at 60 °C for 30 min, the mixture was centrifuged at 12,000 rpm for 10 min at room temperature, and the supernatant was collected for measurement. Absorbance was measured at 530 nm and 700 nm using a Multiskan FC enzyme reader (Thermo Fisher Scientific, Waltham, MA, USA). The anthocyanin content was calculated according to the formula provided for 96-well plate determination in the manufacturer’s protocol.

4.10. UPLC-PAD Analysis of Anthocyanins in Sepals

Analysis and identification of anthocyanins were performed according to the methods described by Yuan et al. [36]. Sepal samples from upper flowers of inflorescence were ground into a powder in liquid nitrogen. Subsequently, 0.5 g of the sepal powder was extracted for anthocyanin identification. Data were analyzed using Masslynx software version 4.1 (Waters, Milford, MA, USA).

4.11. Statistical Analysis

Statistical analyses were performed using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA). All experimental data were tested by a one-way ANOVA or Student’s t-test. Figures were generated by GraphPad Prism 8.0.1 software (GraphPad, San Diego, CA, USA).

5. Conclusions

In this study, an effective VIGS system based on TRV-HmPDS and TRV-HmCHS1 was established in plantlets and flowers, respectively. The vacuum-infiltration method was successfully employed to silence PDS and CHS using the TRV vector. Additionally, the function of HmF3′5′H in the anthocyanin synthesis pathway in sepals was validated using this technique. Silencing HmF3′5′H decreased the contents of delphinidin-3-glucoside, which resulted in a color change in the sepals from blue to pink. The VIGS system developed for H. macrophylla will facilitate reverse genetics analyses and exploring genetic resources for molecular breeding.

Author Contributions

Conceptualization, Y.F.; methodology, Y.F.; validation, Y.F.; formal analysis, S.L.; investigation, Q.Y.; resources, C.L.; data curation, Q.Y.; writing—original draft preparation, Q.Y.; writing—review and editing, S.Y.; visualization, S.L.; supervision, C.L.; project administration, S.Y.; funding acquisition, S.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (2023YFD1200105) and the Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2022-IVFCAAS and CAAS-ASTIP-2023-IVFCAAS).

Data Availability Statement

Data will be made available upon request.

Acknowledgments

We thank the National Flower Improvement Center. We also thank the Key Laboratory of Biology and Genetic Improvement of Flower Crops (North China), Ministry of Agriculture and Rural Affairs, China.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Geum, N.G.; Eo, H.J.; Kim, H.J.; Park, G.H.; Son, H.J.; Jeong, J.B. Immune-enhancing activity of Hydrangea macrophylla subsp. serrata leaves through TLR4/ROS-dependent activation of JNK and NF-κB in RAW264.7 cells and immunosuppressed mice. J. Funct. Foods 2020, 73, 104139. [Google Scholar] [CrossRef]
  2. Lee, J.; Kwon, H.; Cho, E.; Jeon, J.; Lee, I.-K.; Cho, W.-S.; Park, S.J.; Lee, S.; Kim, D.H.; Jung, J.W. Hydrangea macrophylla and Thunberginol C Attenuate Stress-Induced Anxiety in Mice. Antioxidants 2022, 11, 234. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, H.; Matsuda, H.; Yamashita, C.; Nakamura, S.; Yoshikawa, M. Hydrangeic acid from the processed leaves of Hydrangea macrophylla var. thunbergii as a new type of anti-diabetic compound. Eur. J. Pharmacol. 2009, 606, 255–261. [Google Scholar] [CrossRef] [PubMed]
  4. Lange, M.; Yellina, A.L.; Orashakova, S.; Becker, A. Virus-Induced Gene Silencing (VIGS) in Plants: An Overview of Target Species and the Virus-Derived Vector Systems. In Virus-Induced Gene Silencing: Methods and Protocols; Becker, A., Ed.; Humana Press: Totowa, NJ, USA, 2013; pp. 1–14. [Google Scholar]
  5. Purkayastha, A.; Dasgupta, I. Virus-induced gene silencing: A versatile tool for discovery of gene functions in plants. Plant Physiol. Biochem. 2009, 47, 967–976. [Google Scholar] [CrossRef]
  6. Reid, M.; Chen, J.-C.; Jiang, C.-Z. Virus-Induced Gene Silencing for Functional Characterization of Genes in Petunia. In Petunia: Evolutionary, Developmental and Physiological Genetics; Gerats, T., Strommer, J., Eds.; Springer: New York, NY, USA, 2009; pp. 381–394. [Google Scholar]
  7. Xie, L.; Zhang, Q.; Sun, D.; Yang, W.; Hu, J.; Niu, L.; Zhang, Y. Virus-induced gene silencing in the perennial woody Paeonia ostii. PeerJ 2019, 7, e7001. [Google Scholar] [CrossRef]
  8. Tian, J.; Pei, H.; Zhang, S.; Chen, J.; Chen, W.; Yang, R.; Meng, Y.; You, J.; Gao, J.; Ma, N. TRV–GFP: A modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function. J. Exp. Bot. 2014, 65, 311–322. [Google Scholar] [CrossRef]
  9. Xu, H.; Xu, L.; Yang, P.; Cao, Y.; Tang, Y.; He, G.; Yuan, S.; Lei, J.; Ming, J. Virus-induced Phytoene Desaturase (PDS) Gene Silencing Using Tobacco Rattle Virus in Lilium × formolongi. Hortic. Plant J. 2019, 5, 31–38. [Google Scholar] [CrossRef]
  10. Zulfiqar, S.; Farooq, M.A.; Zhao, T.; Wang, P.; Tabusam, J.; Wang, Y.; Xuan, S.; Zhao, J.; Chen, X.; Shen, S.; et al. Virus-Induced Gene Silencing (VIGS): A Powerful Tool for Crop Improvement and Its Advancement towards Epigenetics. Int. J. Mol. Sci. 2023, 24, 5608. [Google Scholar] [CrossRef]
  11. Liu, N.; Xie, K.; Jia, Q.; Zhao, J.; Chen, T.; Li, H.; Wei, X.; Diao, X.; Hong, Y.; Liu, Y. Foxtail Mosaic Virus-Induced Gene Silencing in Monocot Plants. Plant Physiol. 2016, 171, 1801–1807. [Google Scholar] [CrossRef]
  12. Murai, H.; Mochizuki, T. Virus-Induced Gene Silencing in Chrysanthemum seticuspe Using the Tomato Aspermy Virus Vector. Plants 2022, 11, 430. [Google Scholar] [CrossRef]
  13. Cheng, G.; Shu, X.; Wang, Z.; Wang, N.; Zhang, F. Establishing a Virus-Induced Gene Silencing System in Lycoris chinensis. Plants 2023, 12, 2458. [Google Scholar] [CrossRef] [PubMed]
  14. Yang, W.; Chen, X.; Chen, J.; Zheng, P.; Liu, S.; Tan, X.; Sun, B. Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis). Plants 2023, 12, 3162. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, Y.; Niu, N.; Li, S.; Liu, Y.; Xue, C.; Wang, H.; Liu, M.; Zhao, J. Virus-Induced Gene Silencing (VIGS) in Chinese Jujube. Plants 2023, 12, 2115. [Google Scholar] [CrossRef] [PubMed]
  16. Peng, K.; Xue, C.; Huang, X. Enhancing virus-induced gene silencing efficiency in tea plants (Camellia sinensis L.) and the functional analysis of CsPDS. Sci. Hortic.-Amst. 2024, 337, 113585. [Google Scholar] [CrossRef]
  17. Melgar, A.E.; Palacios, M.B.; Tosar, L.J.M.; Zelada, A.M. A novel and efficient Apple latent spherical virus-based gene silencing method for functional genomic studies in Chenopodium quinoa. Sci. Hortic. 2024, 333, 113258. [Google Scholar] [CrossRef]
  18. Chen, G.; Song, J.; Zhang, Y.; Guo, X.; Shen, X. Development and application of virus-induced gene silencing (VIGS) for studying ApTT8 gene function in Agapanthus praecox ssp. orientalis. Sci. Hortic. 2024, 324, 112595. [Google Scholar] [CrossRef]
  19. Chen, H.; Wang, X.; Xu, L.F. Identification and Bioinformatics Analysis of ABC Transporter Gene Family in Hydrangea Under Aluminum Stress. Mol. Plant Breed. 2022, 13. [Google Scholar] [CrossRef]
  20. Qi, H.; Zhang, G.; Chu, Z.; Liu, C.; Yuan, S. Identification of Seven Key Structural Genes in the Anthocyanin Biosynthesis Pathway in Sepals of Hydrangea macrophylla. Curr. Issues Mol. Biol. 2022, 44, 4167–4180. [Google Scholar] [CrossRef]
  21. Li, Z.; Lyu, T.; Lyu, Y. The Molecular Biology Analysis for the Growing and Development of Hydrangea macrophylla ‘Endless Summer’ Under Different Light and Temperature Conditions. Horticulturae 2024, 10, 586. [Google Scholar] [CrossRef]
  22. Liu, Y.; Lyu, T.; Lyu, Y. Study on the Flower Induction Mechanism of Hydrangea macrophylla. Int. J. Mol. Sci. 2023, 24, 7691. [Google Scholar] [CrossRef]
  23. Zhu, Y.; Zeng, X.; Zhu, T.; Jiang, H.; Lei, P.; Zhang, H.; Chen, H. Plant Hormone Pathway Is Involved in Regulating the Embryo Development Mechanism of the Hydrangea macrophylla Hybrid. Int. J. Mol. Sci. 2024, 25, 7812. [Google Scholar] [CrossRef] [PubMed]
  24. Gong, J.; Wang, Y.; Xue, C.; Wu, L.; Sheng, S.; Wang, M.; Peng, J.; Cao, S. Regulation of blue infertile flower pigmentation by WD40 transcription factor HmWDR68 in Hydrangea macrophylla ‘forever summer’. Mol. Biol. Rep. 2024, 51, 328. [Google Scholar] [CrossRef] [PubMed]
  25. Peng, J.; Dong, X.; Xue, C.; Liu, Z.; Cao, F. Exploring the Molecular Mechanism of Blue Flower Color Formation in Hydrangea macrophylla cv. Forever Summer. Front. Plant Sci. 2021, 12, 585665. [Google Scholar] [CrossRef] [PubMed]
  26. Liu, Y.; Sun, W.; Zeng, S.; Huang, W.; Liu, D.; Hu, W.; Shen, X.; Wang, Y. Virus-induced gene silencing in two novel functional plants, Lycium barbarum L. and Lycium ruthenicum Murr. Sci. Hortic. 2014, 170, 267–274. [Google Scholar] [CrossRef]
  27. Ye, J.; Qu, J.; Bui, H.T.; Chua, N.H. Rapid analysis of Jatropha curcas gene functions by virus-induced gene silencing. Plant Biotechnol. J. 2009, 7, 964–976. [Google Scholar] [CrossRef]
  28. Wege, S.; Scholz, A.; Gleissberg, S.; Becker, A. Highly Efficient Virus-induced Gene Silencing (VIGS) in California Poppy (Eschscholzia californica): An Evaluation of VIGS as a Strategy to Obtain Functional Data from Non-model Plants. Ann. Bot. 2007, 100, 641–649. [Google Scholar] [CrossRef]
  29. Liu, E.; Page, J.E. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods 2008, 4, 5. [Google Scholar] [CrossRef]
  30. Rammohan, A.; Reddy, J.S.; Sravya, G.; Rao, C.N.; Zyryanov, G.V. Chalcone synthesis, properties and medicinal applications: A review. Environ. Chem. Lett. 2020, 18, 433–458. [Google Scholar] [CrossRef]
  31. Tanaka, Y.; Brugliera, F. Flower colour and cytochromes P450. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2013, 368, 20120432. [Google Scholar] [CrossRef]
  32. Ito, D.; Shinkai, Y.; Kato, Y.; Kondo, T.; Yoshida, K. Chemical Studies on Different Color Development in Blue- and Red-Colored Sepal Cells of Hydrangea macrophylla. Biosci. Biotechnol. Biochem. 2009, 73, 1054–1059. [Google Scholar] [CrossRef]
  33. Ito, T.; Oyama, K.-i.; Yoshida, K. Direct Observation of Hydrangea Blue-Complex Composed of 3-O-Glucosyldelphinidin, Al3+ and 5-O-Acylquinic Acid by ESI-Mass Spectrometry. Molecules 2018, 23, 1424. [Google Scholar] [CrossRef] [PubMed]
  34. Schreiber, H.D.; Jones, A.H.; Lariviere, C.M.; Mayhew, K.M.; Cain, J.B. Role of aluminum in red-to-blue color changes in Hydrangea macrophylla sepals. BioMetals 2011, 24, 1005–1015. [Google Scholar] [CrossRef] [PubMed]
  35. Schreiber, H.D.; Swink, A.M.; Godsey, T.D. The chemical mechanism for Al3+ complexing with delphinidin: A model for the bluing of hydrangea sepals. J. Inorg. Biochem. 2010, 104, 732–739. [Google Scholar] [CrossRef] [PubMed]
  36. Yuan, S.; Qi, H.; Yang, S.; Chu, Z.; Zhang, G.; Liu, C. Role of delphinidin-3-glucoside in the sepal blue color change among Hydrangea macrophylla cultivars. Sci. Hortic. 2023, 313, 111902. [Google Scholar] [CrossRef]
  37. Broderick, S.R.; Jones, M.L. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia. Plant Mol. Biol. Report. 2014, 32, 219–233. [Google Scholar] [CrossRef]
  38. Muruganantham, M.; Moskovitz, Y.; Haviv, S.; Horesh, T.; Fenigstein, A.; Preez, J.; Stephan, D.; Burger, J.T.; Mawassi, M. Grapevine virusA-mediated gene silencing in Nicotiana benthamiana and Vitis vinifera. J. Virol. Methods 2009, 155, 167–174. [Google Scholar] [CrossRef]
  39. Bélanger, S.; Kramer, M.C.; Payne, H.A.; Hui, A.Y.; Slotkin, R.K.; Meyers, B.C.; Staub, J.M. Plastid dsRNA transgenes trigger phased small RNA-based gene silencing of nuclear-encoded genes. Plant Cell 2023, 35, 3398–3412. [Google Scholar] [CrossRef]
  40. Li, X.; Tao, N.; Xu, B.; Xu, J.; Yang, Z.; Jiang, C.; Zhou, Y.; Deng, M.; Lv, J.; Zhao, K. Establishment and application of a root wounding-immersion method for efficient virus-induced gene silencing in plants. Front. Plant Sci. 2024, 15, 1336726. [Google Scholar] [CrossRef]
  41. Ren, C.; Liu, Y.; Guo, Y.; Duan, W.; Fan, P.; Li, S.; Liang, Z. Optimizing the CRISPR/Cas9 system for genome editing in grape by using grape promoters. Hortic. Res. 2021, 8, 52. [Google Scholar] [CrossRef]
  42. Luo, S.; Li, Y.; Wan, Y.; Fan, Y.; Liu, C.; Yuan, S. Identification of Key Candidate Genes Involved in Aluminum Accumulation in the Sepals of Hydrangea macrophylla. Horticulturae 2024, 10, 1180. [Google Scholar] [CrossRef]
  43. Ramegowda, V.; Senthil-kumar, M.; Udayakumar, M.; Mysore, K.S. A high-throughput virus-induced gene silencing protocol identifies genes involved in multi-stress tolerance. BMC Plant Biol. 2013, 13, 193. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, G.; Yuan, S.; Qi, H.; Chu, Z.; Liu, C. Identification of Reliable Reference Genes for the Expression of Hydrangea macrophylla ‘Bailmer’ and ‘Duro’ Sepal Color. Horticulturae 2022, 8, 835. [Google Scholar] [CrossRef]
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  46. Arnon, D.I. Copper Enzymes in Isolated Chloroplasts. Polyphenoloxidase in Beta Vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef]
Figure 1. Multiple sequence alignment of deduced amino acids of HmPDS with other homologies. Colored boxes on amino acids indicate the position of motifs and domains. The asterisk means that the residue is the same, and the dot means that the residue is conserved. Homologous sequences from other plant species included VrPDS (KAJ9691772.1) in Vitis riparis, VvPDS (AFP28796.1) in Vitis vinifera, NtPDS (BCG50296.1) in Nicotiana tabacum, PhPDS (AOG29531.1) in Petunia hybrida, CsPDS (KAF5947778.1) in Camellia sinensis, and AtPDS (AAL15300.1) in Arabidopsis thaliana.
Figure 1. Multiple sequence alignment of deduced amino acids of HmPDS with other homologies. Colored boxes on amino acids indicate the position of motifs and domains. The asterisk means that the residue is the same, and the dot means that the residue is conserved. Homologous sequences from other plant species included VrPDS (KAJ9691772.1) in Vitis riparis, VvPDS (AFP28796.1) in Vitis vinifera, NtPDS (BCG50296.1) in Nicotiana tabacum, PhPDS (AOG29531.1) in Petunia hybrida, CsPDS (KAF5947778.1) in Camellia sinensis, and AtPDS (AAL15300.1) in Arabidopsis thaliana.
Plants 13 03396 g001
Figure 2. TRV-induced PDS silencing in H. macrophylla. (A) Morphological comparison of wild-type plantlet (left), plantlets infected with TRV (middle), and TRV-HmPDS (right). The photos were taken on day 30 after infiltration. White scale bar equals 1 cm. (B) RT-qPCR analysis to detect transcripts of TRV and HmPDS in leaves under various treatments. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. (C) Comparison of the content of chlorophyll a, chlorophyll b, and total chlorophyll between PDS-silenced and TRV-infected plantlets. Samples were harvested on day 30 after the infiltration. Asterisks indicate statistically significant differences between TRV-HmPDS and TRV control (Student’s t-test, * p < 0.05, ** p < 0.01). Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3).
Figure 2. TRV-induced PDS silencing in H. macrophylla. (A) Morphological comparison of wild-type plantlet (left), plantlets infected with TRV (middle), and TRV-HmPDS (right). The photos were taken on day 30 after infiltration. White scale bar equals 1 cm. (B) RT-qPCR analysis to detect transcripts of TRV and HmPDS in leaves under various treatments. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. (C) Comparison of the content of chlorophyll a, chlorophyll b, and total chlorophyll between PDS-silenced and TRV-infected plantlets. Samples were harvested on day 30 after the infiltration. Asterisks indicate statistically significant differences between TRV-HmPDS and TRV control (Student’s t-test, * p < 0.05, ** p < 0.01). Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3).
Plants 13 03396 g002
Figure 3. TRV-induced CHS silencing in H. macrophylla. Morphological comparison of (A) pink flowers and (B) blue flowers infected with TRV and TRV-HmCHS1. Photos were taken on day 15 after infiltration. White scale bar equals 1 cm. (C) RT-qPCR analysis to detect transcripts of TRV and HmCHS1 in flowers under various treatments. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. (D) Comparison of the content of total anthocyanidin between HmCHS1-silenced flowers and TRV control. Asterisks indicate statistically significant differences between TRV-HmCHS1 and TRV control (Student’s t-test, ** p < 0.01). Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3).
Figure 3. TRV-induced CHS silencing in H. macrophylla. Morphological comparison of (A) pink flowers and (B) blue flowers infected with TRV and TRV-HmCHS1. Photos were taken on day 15 after infiltration. White scale bar equals 1 cm. (C) RT-qPCR analysis to detect transcripts of TRV and HmCHS1 in flowers under various treatments. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. (D) Comparison of the content of total anthocyanidin between HmCHS1-silenced flowers and TRV control. Asterisks indicate statistically significant differences between TRV-HmCHS1 and TRV control (Student’s t-test, ** p < 0.01). Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3).
Plants 13 03396 g003
Figure 4. TRV-induced F3′5′H silencing in H. macrophylla. (A) Morphological comparison of TRV-infected and TRV-HmF3′5′H-infected flowers at day 15 after infiltration. White scale bar equals 1 cm. (B) RT-qPCR analysis to detect relative expression of TRV and HmF3′5′H in flowers under various treatments. (C) Comparison of the contents of anthocyanidin between HmF3′5′H-silenced and TRV-infected flowers. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3). (D) Comparison of the relative abundance of anthocyanidin between HmF3′5′H-silenced and TRV-infected flowers. The abundance was the proportion of the certain anthocyanin content in total anthocyanins.
Figure 4. TRV-induced F3′5′H silencing in H. macrophylla. (A) Morphological comparison of TRV-infected and TRV-HmF3′5′H-infected flowers at day 15 after infiltration. White scale bar equals 1 cm. (B) RT-qPCR analysis to detect relative expression of TRV and HmF3′5′H in flowers under various treatments. (C) Comparison of the contents of anthocyanidin between HmF3′5′H-silenced and TRV-infected flowers. Different lowercase letters indicate significant differences at p < 0.05 as determined by Duncan’s test. Values were the means ± standard deviation (SD) of three independent biological replicates (n = 3). (D) Comparison of the relative abundance of anthocyanidin between HmF3′5′H-silenced and TRV-infected flowers. The abundance was the proportion of the certain anthocyanin content in total anthocyanins.
Plants 13 03396 g004
Figure 5. Schematics of pTRV1, pTRV2, pTRV2-HmPDS, pTRV2-HmCHS1, and pTRV2-HmF3′5′H. LB, left border; RB, right border; RdRp, RNA-dependent RNA polymerase; MP, movement protein; 16k, 16 kD protein; R, self-cleaving ribozyme; N, NOS terminator; CP, coat protein; MCS, multiple cloning site.
Figure 5. Schematics of pTRV1, pTRV2, pTRV2-HmPDS, pTRV2-HmCHS1, and pTRV2-HmF3′5′H. LB, left border; RB, right border; RdRp, RNA-dependent RNA polymerase; MP, movement protein; 16k, 16 kD protein; R, self-cleaving ribozyme; N, NOS terminator; CP, coat protein; MCS, multiple cloning site.
Plants 13 03396 g005
Table 1. Primer sequences for gene cloning.
Table 1. Primer sequences for gene cloning.
GenePrimer Sequence (5′-3′)Product Size (bp)
HmPDSF:GTGGCAGGGTCAGTATTGCTGG
R:CAGACAACGCTTGCCTCAACTAG
1829
HmCHS1F:GGGCACGTGATTCTTAGCTACCAC
R:AAGGGACGGAATGCCTCAACTAGACTCG
849
HmF3′5′HF:CACATGTACATACACACAACACTTGCAC
R:TCGTGGACGTGGTTGAATGG
1594
Table 2. Primer sequences for pTRV2 vector construction.
Table 2. Primer sequences for pTRV2 vector construction.
GenePrimer Sequence (5′-3′)Product Size (bp)
HmPDSF: CTGTGAGTAAGGTTACCGGCTATGCCAAACAAGC
R: GAGACGCGTGAGCTCGCGGAGGATTACCATCTAA
382
HmCHS1F: CTGTGAGTAAGGTTACCGATGGTGACCGTCGAGG
R: TCGAGACGCGTGAGCTCGGTGGCTGCTTCTTTGCCTAG
332
HmF3′5′HF: CTGTGAGTAAGGTTACCGCCGAGACCCGGATGTTTG
R: TCGAGACGCGTGAGCTCGCGTGGACGTGGTTGAATG
340
Table 3. Primer sequences for RT-qPCR.
Table 3. Primer sequences for RT-qPCR.
GeneForward Primers (5′-3′)Reverse Primers (5′-3′)
HmEF1-βCGCAGCTGTTTTAGGGAAGCCGCGAGCTGCGAAGACACAGA
Coat ProteinTTACGACGAACCAAGGGAGTACTACGGTGCAGATGAACTAGCAGCTG
HmPDSGCCAATGCAATGCAATGAGCTGGGCAGACATCCATCCTTGGTCTTG
HmCHS1AATTTCAGCGCATGTGTGACAATTCCACCACCATGTCTTGTCTAGC
HmF3′5′HAGGGCAAGCCGGACTTTCTTCCGGCAGTGAACAAATTCAAGAGTA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, Q.; Fan, Y.; Luo, S.; Liu, C.; Yuan, S. Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants 2024, 13, 3396. https://doi.org/10.3390/plants13233396

AMA Style

Yang Q, Fan Y, Luo S, Liu C, Yuan S. Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants. 2024; 13(23):3396. https://doi.org/10.3390/plants13233396

Chicago/Turabian Style

Yang, Qiyu, Youwei Fan, Shuwen Luo, Chun Liu, and Suxia Yuan. 2024. "Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H" Plants 13, no. 23: 3396. https://doi.org/10.3390/plants13233396

APA Style

Yang, Q., Fan, Y., Luo, S., Liu, C., & Yuan, S. (2024). Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants, 13(23), 3396. https://doi.org/10.3390/plants13233396

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop