Differential Symptomology, Susceptibility, and Titer Dynamics Manifested by Phytoplasma-Infected Periwinkle and Tomato Plants
Abstract
:1. Introduction
2. Results
2.1. PPT Phytoplasma-Induced Symptoms in Tomato and Periwinkle Plants
2.2. Standard Curves
2.3. PPT Phytoplasma Concentration in Host Plants
2.4. PPT Phytoplasma Titer Indicated by IDP Level
3. Discussion
4. Materials and Methods
4.1. Potato Purple Top (PPT) Phytoplasma
4.2. Graft Inoculation
4.3. Symptom Observation and Stereomicroscopic Imaging
4.4. Sample Collection and DNA Extraction
4.5. PCR Amplification and Cloning of Marker Genes from PPT Phytoplasma, Tomato, and Periwinkle
4.6. Standard Curve Generation and qPCR Analysis
4.7. Western Blot Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hogenhout, S.A.; Oshima, K.; Ammar, E.D.; Kakizawa, S.; Kingdom, H.N.; Namba, S. Phytoplasmas: Bacteria that manipulate plants and insects. Mol. Plant Pathol. 2008, 9, 403–423. [Google Scholar] [CrossRef]
- Lee, I.M.; Davis, R.E.; Gundersen-Rindal, D.E. Phytoplasma: Phytopathogenic mollicutes. Annu. Rev. Microbiol. 2000, 54, 221–255. [Google Scholar] [CrossRef]
- Oshima, K.; Kakizawa, S.; Nishigawa, H.; Jung, H.-Y.; Wei, W.; Suzuki, S.; Arashida, R.; Nakata, D.; Miyata, S.-i.; Ugaki, M. Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nat. Genet. 2004, 36, 27–29. [Google Scholar] [CrossRef]
- Kube, M.; Mitrovic, J.; Duduk, B.; Rabus, R.; Seemüller, E. Current view on phytoplasma genomes and encoded metabolism. Sci. World J. 2012, 2012, 185942. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.; Li, Q.; Zhao, Y.; Wei, H.; Wang, J.; Baker, C.J.; Liu, Q.; Wei, W. Integration of metabolomics and existing omics data reveals new insights into phytoplasma-induced metabolic reprogramming in host plants. PLoS ONE 2021, 16, e0246203. [Google Scholar] [CrossRef] [PubMed]
- Block, A.; Toruño, T.Y.; Elowsky, C.G.; Zhang, C.; Steinbrenner, J.; Beynon, J.; Alfano, J.R. The Pseudomonas syringae type III effector Hop D1 suppresses effector-triggered immunity, localizes to the endoplasmic reticulum, and targets the Arabidopsis transcription factor NTL9. New Phytol. 2014, 201, 1358–1370. [Google Scholar] [CrossRef] [PubMed]
- Park, C.-J.; Bart, R.; Chern, M.; Canlas, P.E.; Bai, W.; Ronald, P.C. Overexpression of the endoplasmic reticulum chaperone BiP3 regulates XA21-mediated innate immunity in rice. PLoS ONE 2010, 5, e9262. [Google Scholar] [CrossRef] [PubMed]
- Inaba, J.; Kim, B.M.; Zhao, Y.; Jansen, A.M.; Wei, W. The endoplasmic reticulum is a key battleground between phytoplasma aggression and host plant defense. Cells 2023, 12, 2110. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; MacLean, A.M.; Sugio, A.; Maqbool, A.; Busscher, M.; Cho, S.T.; Kamoun, S.; Kuo, C.H.; Immink, R.G.; Hogenhout, S.A. Parasitic modulation of host development by ubiquitin-independent protein degradation. Cell 2021, 184, 5201–5214. [Google Scholar] [CrossRef] [PubMed]
- Sugio, A.; MacLean, A.M.; Grieve, V.M.; Hogenhout, S.A. Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis. Proc. Natl. Acad. Sci. USA 2011, 108, 1254–1263. [Google Scholar] [CrossRef] [PubMed]
- MacLean, A.M.; Sugio, A.; Makarova, O.V.; Findlay, K.C.; Grieve, V.M.; Tóth, R.; Nicolaisen, M.; Hogenhout, S.A. Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants. Plant Physiol. 2011, 157, 831–841. [Google Scholar] [CrossRef]
- Wei, W.; Davis, R.E.; Nuss, D.L.; Zhao, Y. Phytoplasmal infection derails genetically preprogrammed meristem fate and alters plant architecture. Proc. Natl. Acad. Sci. USA 2013, 110, 19149–19154. [Google Scholar] [CrossRef]
- Wei, W.; Davis, R.E.; Bauchan, G.R.; Zhao, Y. New symptoms identified in phytoplasma-infected plants reveal extra stages of pathogen-induced meristem fate-derailment. Mol. Plant-Microbe Interact. 2019, 32, 1314–1323. [Google Scholar] [CrossRef]
- Wei, W.; Kakizawa, S.; Suzuki, S.; Jung, H.Y.; Nishigawa, H.; Miyata, S.I.; Oshima, K.; Ugaki, M.; Hibi, T.; Namba, S. In planta dynamic analysis of onion yellows phytoplasma using localized inoculation by insect transmission. Phytopath. 2004, 94, 244–250. [Google Scholar] [CrossRef]
- Weintraub, P.G.; Beanland, L. Insect vectors of phytoplasmas. Annu. Rev. Entomol. 2006, 51, 91–111. [Google Scholar] [CrossRef]
- Marcone, C. Movement of phytoplasmas and the development of disease in the plant. In Phytoplasmas: Genomes, Plant Hosts and Vectors; Weintraub, P.G., Jones, P., Eds.; CABI: Wallingford, UK, 2009; pp. 114–131. [Google Scholar]
- Carminati, G.; Brusa, V.; Loschi, A.; Ermacora, P.; Martini, M. Spatiotemporal and Quantitative Monitoring of the Fate of ‘Candidatus Phytoplasma Solani’ in Tomato Plants Infected by Grafting. Pathogens 2021, 10, 811. [Google Scholar] [CrossRef]
- Wei, W.; Inaba, J.; Zhao, Y.; Mowery, J.D.; Hammond, R. Phytoplasma infection blocks starch breakdown and triggers chloroplast degradation, leading to premature leaf senescence, sucrose reallocation, and spatiotemporal redistribution of phytohormones. Int. J. Mol. Sci. 2022, 23, 1810. [Google Scholar] [CrossRef]
- Wang, Y.Q.; Melzer, R.; Theißen, G. A double-flowered variety of lesser periwinkle (Vinca minor fl. pl.) that has persisted in the wild for more than 160 years. Ann. Bot. 2011, 107, 1445–1452. [Google Scholar] [CrossRef] [PubMed]
- Gilman, E.F.; Howe, T.; Klein, R.W.; Hansen, G. Catharanthus roseus Periwinkle, Madagascar Periwinkle, Vinca. A Series of the Environmental Horticulture Department, UF/IFAS Extension. Original Publication Date October 1999. Revised March 2023. Available online: https://edis.ifas.ufl.edu/publication/FP112 (accessed on 8 January 2024).
- Wu, W.; Ding, Y.; Wei, W.; Davis, R.; Lee, I.M.; Hammond, R.; Zhao, Y. Salicylic acid-mediated elicitation of tomato defense against infection by potato purple top phytoplasma. Ann. Appl. Biol. 2012, 161, 36–45. [Google Scholar] [CrossRef]
- Marzachí, C.; Bosco, D. Relative quantification of chrysanthemum yellows (16Sr I) phytoplasma in its plant and insect host using real-time polymerase chain reaction. Mol. Biotechnol. 2005, 30, 117–128. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.; Kumar, S.; Lakhanpaul, S. Differential distribution of phytoplasma during phyllody progression in sesame (Sesamum indicum L.) under field conditions: An important consideration for effective sampling of diseased tissue. Crop Prot. 2018, 110, 288–294. [Google Scholar] [CrossRef]
- Deng, S.; Hiruki, C. Amplification of 16S rRNA genes from culturable and non-culturable mollicutes. J. Microbiol. Methods 1991, 14, 53–61. [Google Scholar] [CrossRef]
- Lee, I.-M.; Martini, M.; Marcone, C.; Zhu, S.F. Classification of phytoplasma strains in the elm yellows group (16SrV) and proposal of ‘Candidatus Phytoplasma ulmi’ for the phytoplasma associated with elm yellows. Int. J. Syst. Evol. Microbiol. 2004, 54 Pt 2, 337–347. [Google Scholar] [CrossRef]
- Ammara, U.; Al-Sadi, A.M.; Al-Shihi, A.; Amin, I. Real-time qPCR assay for the TYLCV titer in relation to symptoms-based disease severity scales. Int. J. Agric. Biol. 2017, 19, 145–151. [Google Scholar] [CrossRef]
- Mello, A.F.; Yokomi, R.K.; Melcher, U.; Chen, J.C.; Fletcher, J. Citrus stubborn severity is associated with Spiroplasma citri titer but not with bacterial genotype. Plant Dis. 2010, 94, 75–82. [Google Scholar] [CrossRef]
- Avendaño-Benequen, M.; Silva-Rojas, H.V.; Marbán-Mendoza, N.; Rebollar-Alviter, A. Mexican periwinkle virescence phytoplasma associated with phyllody and virescence in strawberry (Fragaria x ananassa Duch.) in Michoacan, Mexico. Eur. J. Plant Pathol. 2017, 147, 451–454. [Google Scholar] [CrossRef]
- Mazraie, M.A.; Izadpanah, K.; Hamzehzarghani, H.; Salehi, M.; Faghihi, M.M. Spread and colonization pattern of ‘Candidatus Phytoplasma aurantifolia’ in lime plants [Citrus aurantifolia (Christm.) Swingle] as revealed by real-time PCR assay. J. Plant Pathol. 2019, 101, 629–637. [Google Scholar] [CrossRef]
- Lee, S.; Chu, C.Y.; Chu, C.C. Expression Level of a Phenylalanine Ammonia-Lyase Gene in Poinsettia Is Negatively Correlated with Poinsettia Branch-Inducing Phytoplasma Titer. Microbiol. Spectr. 2022, 10, e03814-22. [Google Scholar] [CrossRef] [PubMed]
- Jawhari, M.; Abrahamian, P.; Abdel Sater, A.; Sobh, H.; Tawidian, P.; Abou-Jawdah, Y. Specific PCR and real-time PCR assays for detection and quantitation of ‘Candidatus Phytoplasma phoenicium’. Mol. Cell Probes 2015, 29, 63–70. [Google Scholar] [CrossRef]
- Wei, W.; Zhao, Y.; Davis, R.E. Phytoplasma inoculum titre and inoculation timing influence symptom development in newly infected plants. Phytopathogenic Mollicutes 2019, 9, 115–116. [Google Scholar] [CrossRef]
- Su, Y.T.; Chen, J.C.; Lin, C.P. Phytoplasma-induced floral abnormalities in Catharanthus roseus are associated with phytoplasma accumulation and transcript repression of floral organ identity genes. Mol. Plant Microbe Interact. 2011, 24, 1502–1512. [Google Scholar] [CrossRef] [PubMed]
- Prezelj, N.; Nikolić, P.; Gruden, K.; Ravnikar, M.; Dermastia, M. Spatiotemporal distribution of flavescence dorée phytoplasma in grapevine. Plant Pathol. 2013, 62, 760–766. [Google Scholar] [CrossRef]
- Boso, S.; Alonso-Villaverde, V.; Gago, P.; Santiago, J.L.; Martínez, M.C. Susceptibility to downy mildew (Plasmopara viticola) of different Vitis varieties. Crop Prot. 2014, 63, 26–35. [Google Scholar] [CrossRef]
- Bull, C.T.; Gebben, S.J.; Goldman, P.H.; Trent, M.; Hayes, R.J. Host genotype and hypersensitive reaction influence population levels of Xanthomonas campestris pv. vitians in lettuce. Phytopathology 2015, 105, 316–324. [Google Scholar] [CrossRef]
- Dutta, A.; Croll, D.; McDonald, B.A.; Barrett, L.G. Maintenance of variation in virulence and reproduction in populations of an agricultural plant pathogen. Evol. Appl. 2021, 14, 335–347. [Google Scholar] [CrossRef]
- Tovi, N.; Frenk, S.; Hadar, Y.; Minz, D. Host specificity and spatial distribution preference of three Pseudomonas isolates. Front. Microbiol. 2019, 9, 3263. [Google Scholar] [CrossRef]
- Al-Saleh, M.A.; Ibrahim, Y.E.; Abo-Elyousr, K.A.M.; Alibrahim, J.S. Population dynamics of Xanthomonas campestris pv. vitians on different plant species and management of bacterial leaf spot of lettuce under greenhouse conditions. Crop. Protect. 2011, 30, 883–887. [Google Scholar] [CrossRef]
- Munyaneza, J.E. Purple top disease and beet leafhopper-transmitted virescence agent (BLTVA) phytoplasma in potatoes of the Pacific Northwest of the United States. In Potato in Progress: Science Meets Practice; Haverkort, A.J., Struik, P.C., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2005; pp. 211–220. [Google Scholar]
- Munyaneza, J.E.; Crosslin, J.M.; Lee, I.-M. Phytoplasmas diseases and insect vectors in potatoes of the Pacific Northwest of the United States. Bull. Insectology 2007, 60, 181–182. [Google Scholar]
- Untegrasser, A.; Cutcutache, I.; Koressaar, T.; Ye, L.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Inaba, J.-I.; Nagy, P.D. Tombusvirus RNA replication depends on the TOR pathway in yeast and plants. Virology 2018, 519, 207–222. [Google Scholar] [CrossRef] [PubMed]
Plant Sample | Shape | Weight (Gram) | Length (Centimeter) | Width (Centimeter) | |
---|---|---|---|---|---|
mock-inoculated | Sepals-flower1 | Separated | 0.018 | 1.6 | 0.7 |
Sepals-flower2 | Separated | 0.016 | 1.2 | 0.5 | |
Sepals-flower3 | Separated | 0.028 | 1.7 | 0.6 | |
Sepals-flower4 | Separated | 0.018 | 1.5 | 0.6 | |
Mean ± SD | NA | 0.021 ± 0.01 | 1.467 ± 0.21 | 0.6 ± 0.08 | |
PPT-infected | Sepal-BB1 | fused | 0.217 | 5 | 3.2 |
Sepal-BB2 | fused | 0.165 | 4.5 | 2.5 | |
Sepal-BB3 | fused | 0.223 | 4.5 | 2.4 | |
Sepal-BB4 | fused | 0.222 | 3.5 | 2.6 | |
Mean ± SD | NA | 0.207 ± 0.02 | 4.375 ± 0.54 | 2.675 ± 0.31 |
Target Gene | Primer Name | Primer Sequence | Reference | |
---|---|---|---|---|
PCR amplification of target genes | 16S rRNA (PPT) | P1 | AAGAGTTTGATCCTGGCTCA | [24] |
P1A | AACGCTGGCGGCGCGCCTAATAC | [25] | ||
16S-SR | GGTCTGTCAAAACTGAAGATG | [25] | ||
18S rRNA (tomato) | Tom18SbF1 | ATTGGAGGGCAAGTCTGGTG | This study | |
Tom18SbR1 | GCGATCCGAACATTTCACCG | This study | ||
Actin (periwinkle) | CrAct3bF1 | TTGTTGGTCGCCCTAGACAC | This study | |
CrAct3bR1 | GTGATGCCAAGATGGAGCCT | This study | ||
qPCR analysis of target genes | 16S rRNA (PPT) | MPPLPPT16SF2 | AGGGTGCGTAGGCTGTTAGA | [21] |
MPPLPPT16SR2 | TGCCTCAGCGTCAGTAAAGA | [21] | ||
18S rRNA (tomato) | Tom18SinF1 | ACAGGCCCGGGTAATCTTTG | This study | |
Tom18SbR1 | GCGATCCGAACATTTCACCG | This study | ||
Actin (periwinkle) | CrAct3inF2 | CGGCAACATTGTACTCAGTGG | This study | |
CrAct3bR2 | TGCTCATCCTATCGGCGATG | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ivanauskas, A.; Inaba, J.; Zhao, Y.; Bottner-Parker, K.D.; Wei, W. Differential Symptomology, Susceptibility, and Titer Dynamics Manifested by Phytoplasma-Infected Periwinkle and Tomato Plants. Plants 2024, 13, 787. https://doi.org/10.3390/plants13060787
Ivanauskas A, Inaba J, Zhao Y, Bottner-Parker KD, Wei W. Differential Symptomology, Susceptibility, and Titer Dynamics Manifested by Phytoplasma-Infected Periwinkle and Tomato Plants. Plants. 2024; 13(6):787. https://doi.org/10.3390/plants13060787
Chicago/Turabian StyleIvanauskas, Algirdas, Junichi Inaba, Yan Zhao, Kristi D. Bottner-Parker, and Wei Wei. 2024. "Differential Symptomology, Susceptibility, and Titer Dynamics Manifested by Phytoplasma-Infected Periwinkle and Tomato Plants" Plants 13, no. 6: 787. https://doi.org/10.3390/plants13060787