Evaluation of Biological Plant Protection Products for Their Ability to Induce Olive Innate Immune Mechanisms and Control Colletotrichum acutatum, the Causal Agent of Olive Anthracnose
Abstract
:1. Introduction
2. Results
2.1. In Situ Evaluation of Biological Plant Protection Products (PPPs) on cv. Koroneiki
2.2. In Situ Evaluation of Plant Protection Products (PPPs) on cv. Kalamon
2.3. Quantification of Olive Innate Immunity Gene Expression Levels
3. Discussion
4. Materials and Methods
4.1. Plant Protection Products
4.2. In Situ Experiments on Olive Fruits
4.3. Defense Related Genes Expression
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moral, J.; De Oliveira, R.; Trapero, A. Elucidation of the Disease Cycle of Olive Anthracnose Caused by Colletotrichum acutatum. Phytopathology 2008, 99, 548–556. [Google Scholar] [CrossRef] [PubMed]
- Cacciola, S.O.; Faedda, R.; Sinatra, F.; Agosteo, G.E.; Schena, L.; Frisullo, S.; Magnano di San Lio, G. Olive Anthracnose. J. Plant Pathol. 2012, 94, 29–44. [Google Scholar]
- Licciardello, G.; Moral, J.; Strano, M.C.; Caruso, P.; Sciara, M.; Bella, P.; Sorrentino, G.; Di Silvestro, S. Characterization of Colletotrichum Strains Associated with Olive Anthracnose in Sicily. Phytopathol. Mediterr. 2022, 61, 139–151. [Google Scholar] [CrossRef]
- Talhinhas, P.; Mota-Capitão, C.; Martins, S.; Ramos, A.P.; Neves-Martins, J.; Guerra-Guimarães, L.; Várzea, V.; Silva, M.C.; Sreenivasaprasad, S.; Oliveira, H. Epidemiology, Histopathology and Aetiology of Olive Anthracnose Caused by Colletotrichum acutatum and C. gloeosporioides in Portugal. Plant Pathol. 2011, 60, 483–495. [Google Scholar] [CrossRef]
- Iliadi, M.K.; Tjamos, E.C.; Antoniou, P.P.; Tsitsigiannis, D.I. First Report of Colletotrichum acutatum Causing Anthracnose on Olives in Greece. Plant Dis. 2017, 102, 820. [Google Scholar] [CrossRef]
- Sergeeva, V.; Nair, N.G.; Spooner-Hart, R. Evidence of Early Flower Infection in Olives (Olea europaea) by Colletotrichum acutatum and C. gloeosporioides Causing Anthracnose Disease. Australas. Plant Dis. Notes 2008, 3, 81–82. [Google Scholar]
- Moreira, K.A.; Oliveira, J.T.C.; da Silva, E.G.; da Rocha, A.T.; de Medeiros, E.V.; de Carvalho, J.S.B.; de Lima, J.R.S. Resistance Induction Anthracnose Control in Pepper Plants Using Acibenzolar-S-Methyl. Divers. J. 2021, 6, 2011–2024. [Google Scholar] [CrossRef]
- Azevedo-Nogueira, F.; Martins-Lopes, P.; Gomes, S. Current Understanding of Olea europaea L.—Colletotrichum acutatum Interactions in the Context of Identification and Quantification Methods—A Review. Crop Prot. 2020, 132, 105106. [Google Scholar] [CrossRef]
- Moreira, V.; Ferronato, B.; de Benedetti, F.; González-Barrios, P.; Mondino, P.; Alaniz, S. Incidence of Colletotrichum Latent Infections during Olive Fruit Development under Uruguayan Environmental Conditions. Int. J. Pest Manag. 2022, 68, 286–294. [Google Scholar] [CrossRef]
- Schena, L.; Mosca, S.; Cacciola, S.O.; Faedda, R.; Sanzani, S.M.; Agosteo, G.E.; Sergeeva, V.; Magnano di San Lio, G. Species of the Colletotrichum gloeosporioides and C. boninense Complexes Associated with Olive Anthracnose. Plant Pathol. 2014, 63, 437–446. [Google Scholar] [CrossRef]
- Talhinhas, P.; Loureiro, A.; Oliveira, H. Olive Anthracnose: A Yield- and Oil Quality-Degrading Disease Caused by Several Species of Colletotrichum That Differ in Virulence, Host Preference and Geographical Distribution. Mol. Plant Pathol. 2018, 19, 1797–1807. [Google Scholar] [CrossRef]
- Kolainis, S.; Koletti, A.; Lykogianni, M.; Karamanou, D.; Gkizi, D.; Tjamos, S.E.; Paraskeuopoulos, A.; Aliferis, K.A. An Integrated Approach to Improve Plant Protection against Olive Anthracnose Caused by the Colletotrichum acutatum Species Complex. PLoS ONE 2020, 15, e0233916. [Google Scholar] [CrossRef] [PubMed]
- Martins, F.; Pereira, J.A.; Baptista, P. Olive Anthracnose and Its Management by Fungal Endophytes: An Overview. In Plant Microbe Interface; Springer International Publishing: Cham, Switzerland, 2019; pp. 253–269. [Google Scholar] [CrossRef]
- Moral, J.; Agustí-Brisach, C.; Agalliu, G.; de Oliveira, R.; Pérez-Rodríguez, M.; Roca, L.F.; Romero, J.; Trapero, A. Preliminary Selection and Evaluation of Fungicides and Natural Compounds to Control Olive Anthracnose Caused by Colletotrichum Species. Crop Prot. 2018, 114, 167–176. [Google Scholar] [CrossRef]
- Nigro, F.; Antelmi, I.; Sion, V.; Pacifico, A. Integrated Approaches to Control Fungi Affecting the Canopy of Olive Trees. IOBC-WPRS Bull. 2019, 141, 14–18. [Google Scholar]
- Materatski, P.; Varanda, C.; Carvalho, T.; Campos, M.D.; Gomes, L.; Nobre, T.; Rei, F. Plants Virulence and Diversity of Colletotrichum spp. Associated to Olive Anthracnose. Plants 2019, 8, 311. [Google Scholar] [CrossRef]
- Sanders, G.M.; Korsten, L. Survey of Fungicide Resistance of Colletotrichum gloeosporioides from Different Avocado Production Areas. S. Afr. Avocado Grow. Assoc. Yearb. 1999, 22, 35–38. [Google Scholar]
- Busby, P.E.; Ridout, M.; Newcombe, G. Fungal Endophytes: Modifiers of Plant Disease. Plant Mol. Biol. 2016, 90, 645–655. [Google Scholar] [CrossRef] [PubMed]
- Gao, F.K.; Dai, C.C.; Liu, X.Z. Mechanisms of Fungal Endophytes in Plant Protection against Pathogens. Afr. J. Microbiol. Res. 2010, 4, 1346–1351. [Google Scholar] [CrossRef]
- Speckbacher, V.; Zeilinger, S. Secondary Metabolites of Mycoparasitic Fungi. Second. Metab. Appl. 2018, 37–55. [Google Scholar] [CrossRef]
- Poveda, J.; Baptista, P. Filamentous Fungi as Biocontrol Agents in Olive (Olea Europaea L.) Diseases: Mycorrhizal and Endophytic Fungi. Crop Prot. 2021, 146, 105672. [Google Scholar] [CrossRef]
- Lorito, M.; Woo, S.L. Trichoderma: A Multi-Purpose Tool for Integrated Pest Management BT. In Principles of Plant-Microbe Interactions: Microbes for Sustainable Agriculture; Lugtenberg, B., Ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 345–353. ISBN 978-3-319-08575-3. [Google Scholar]
- Moreira, R.R.; Nesi, C.N.; May De Mio, L.L. Bacillus spp. and Pseudomonas putida as Inhibitors of the Colletotrichum acutatum Group and Potential to Control Glomerella Leaf Spot. Biol. Control 2014, 72, 30–37. [Google Scholar] [CrossRef]
- Trotel-Aziz, P.; Couderchet, M.; Biagianti, S.; Aziz, A. Characterization of New Bacterial Biocontrol Agents Acinetobacter, Bacillus, Pantoea and Pseudomonas spp. Mediating Grapevine Resistance against Botrytis cinerea. Environ. Exp. Bot. 2008, 64, 21–32. [Google Scholar] [CrossRef]
- Punja, Z.K.; Utkhede, R.S. Using Fungi and Yeasts to Manage Vegetable Crop Diseases. Trends Biotechnol. 2003, 21, 400–407. [Google Scholar] [CrossRef]
- Kupper, K.C.; Corrêa, F.E.; de Azevedo, F.A.; da Silva, A.C. Bacillus subtilis to Biological Control of Postbloom Fruit Drop Caused by Colletotrichum acutatum under Field Conditions. Sci. Hortic. 2012, 134, 139–143. [Google Scholar] [CrossRef]
- Klein, M.N.; da Silva, A.C.; Kupper, K.C. Bacillus subtilis Based-Formulation for the Control of Postbloom Fruit Drop of Citrus. World J. Microbiol. Biotechnol. 2016, 32, 205. [Google Scholar] [CrossRef]
- Yenjit, P.; Intanoo, W.; Chamswarng, C.; Siripanich, J.; Intana, W. Use of Promising Bacterial Strains for Controlling Anthracnose on Leaf and Fruit of Mango Caused by Colletotrichum gloeosporioides. Walailak J. Sci. Technol. 2004, 1, 56–69. [Google Scholar]
- Sahile, S.; Fininsa, C.; Sakhula, P.K.; Ahmed, S. Evaluation of Pathogenic Isolates in Ethiopia for the Control of Chocolate Spot in Faba Bean. Afr. Crop Sci. J. 2009, 17, 4. [Google Scholar] [CrossRef]
- Lamsal, K.; Kim, S.W.; Kim, Y.S.; Lee, Y.S. Application of Rhizobacteria for Plant Growth Promotion Effect and Biocontrol of Anthracnose Caused by Colletotrichum acutatum on Pepper. Mycobiology 2012, 40, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Pangallo, S.; Li Destri Nicosia, M.G.; Agosteo, G.E.; Abdelfattah, A.; Romeo, F.V.; Cacciola, S.O.; Rapisarda, P.; Schena, L. Evaluation of a Pomegranate Peel Extract as an Alternative Means to Control Olive Anthracnose. Phytopathology 2017, 107, 1462–1467. [Google Scholar] [CrossRef]
- Thomashow, L.S. Biological Control of Plant Root Pathogens. Curr. Opin. Biotechnol. 1996, 7, 343–347. [Google Scholar] [CrossRef] [PubMed]
- Durrant, W.E.; Dong, X. Systemic Acquired Resistance. Annu. Rev. Phytopathol. 2004, 42, 185–209. [Google Scholar] [CrossRef]
- Kloepper, J.W.; Ryu, C.-M.; Zhang, S. Induced Systemic Resistance and Promotion of Plant Growth by Bacillus spp. Phytopathology 2004, 94, 1259–1266. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.P.; Hartmann, A.; Gao, X.; Borriss, R. Biocontrol Mechanism by Root-Associated Bacillus amyloliquefaciens FZB42—A Review. Front. Microbiol. 2015, 6, 780. [Google Scholar] [CrossRef] [PubMed]
- Kamle, M.; Borah, R.; Bora, H.; Jaiswal, A.K.; Singh, R.K.; Kumar, P. Systemic Acquired Resistance (SAR) and Induced Systemic Resistance (ISR): Role and Mechanism of Action Against Phytopathogens BT—Fungal Biotechnology and Bioengineering; Hesham, A.E.-L., Upadhyay, R.S., Sharma, G.D., Manoharachary, C., Gupta, V.K., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 457–470. ISBN 978-3-030-41870-0. [Google Scholar]
- Freeman, S.; Barbul, O.; David, D.R.; Nitzani, Y.; Zveibil, A.; Elad, Y. Trichoderma spp. for Biocontrol of Colletotrichum acutatum and Botrytis cinerea in Strawberry. IOBC WPRS Bull. 2001, 24, 147–150. [Google Scholar]
- Freeman, S.; Minz, D.; Kolesnik, I.; Barbul, O.; Zveibil, A.; Maymon, M.; Nitzani, Y.; Kirshner, B.; Rav-David, D.; Bilu, A.; et al. Trichoderma Biocontrol of Colletotrichum acutatum and Botrytis cinerea and Survival in Strawberry. Eur. J. Plant Pathol. 2004, 110, 361–370. [Google Scholar] [CrossRef]
- Es-Soufi, R.; El Bouzdoudi, B.; Bouras, M.; El Kbiach, M.L.; Badoc, A.; Lamarti, A. Assessment of the Effect of Environmental Factors on the Antagonism of Bacillus amyloliquefaciens and Trichoderma harzianum to Colletotrichum acutatum. Adv. Microbiol. 2017, 7, 729–742. [Google Scholar] [CrossRef]
- Es-Soufi, R.; Tahiri, H.; Azaroual, L.; El Oualkadi, A.; Martin, P.; Badoc, A.; Lamarti, A. In Vitro Antagonistic Activity of Trichoderma harzianum and Bacillus amyloliquefaciens against Colletotrichum acutatum. Adv. Microbiol. 2020, 10, 82–94. [Google Scholar] [CrossRef]
- Dennis, C.; Webster, J. Antagonistic Properties of Species-Groups of Trichoderma: II. Production of Volatile Antibiotics. Trans. Br. Mycol. Soc. 1971, 57, 41–48. [Google Scholar] [CrossRef]
- Živković, S.; Stojanović, S.; Ivanović, Ž.; Gavrilović, V.; Popović, T.; Balaž, J. Screening of antagonistic activity of microorganisms against Colletotrichum acutatum and Colletotrichum gloeosporioides. Arch. Biol. Sci. 2010, 62, 611–623. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of Inducible Defense-Related Proteins in Infected Plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Bufe, A.; Spangfort, M.D.; Kahlert, H.; Schlaak, M.; Becker, W.-M. The Major Birch Pollen Allergen, Bet v 1, Shows Ribonuclease. Act. Planta 1996, 199, 413–415. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Van Strien, E.A. The Families of Pathogenesis-Related Proteins, Their Activities, and Comparative Analysis of PR-1 proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–97. [Google Scholar] [CrossRef]
- Rockenbach, M.F.; Velho, A.C.; Alaniz, S.M.; Stadnik, M.J. Resistance of Apple Leaves to Infection by Colletotrichum fructicola Acts Independently of Hypersensitive Reaction and PR-1 and PR-10 Gene Expression. Trop. Plant Pathol. 2018, 43, 360–370. [Google Scholar] [CrossRef]
- Tziros, G.T.; Samaras, A.; Karaoglanidis, G.S. Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive. Molecules 2021, 26, 1043. [Google Scholar] [CrossRef]
- Swinburne, T.R.; Barr, J.G.; Brown, A.E. Production of Antibiotics by Bacillus subtilis and Their Effect on Fungal Colonists of Apple Leaf Scars. Trans. Br. Mycol. Soc. 1975, 65, 211–217. [Google Scholar] [CrossRef]
- Serrano, L.; Manker, D.; Brandi, F.; Cali, T. The Use of Bacillus subtilis QST 713 and Bacillus pumilus QST 2808 as Protectant Fungicides in Conventional Application Programs for Black Leaf Streak Control. In Proceedings of the VII International Symposium on Banana: ISHS-ProMusa Symposium on Bananas and Plantains: Towards Sustainable Global Production 986, Salvador, Brazil, 10 October 2011; pp. 149–155. [Google Scholar]
- Bizos, G.; Papatheodorou, E.M.; Chatzistathis, T.; Ntalli, N.; Aschonitis, V.G.; Monokrousos, N. The Role of Microbial Inoculants on Plant Protection, Growth Stimulation, and Crop Productivity of the Olive Tree (Olea Europea L.). Plants 2020, 9, 743. [Google Scholar] [CrossRef] [PubMed]
- Marcos, R.; Izquierdo, Y.; Vellosillo, T.; Kulasekaran, S.; Cascón, T.; Hamberg, M.; Castresana, C. 9-Lipoxygenase-Derived Oxylipins Activate Brassinosteroid Signaling to Promote Cell Wall-Based Defense and Limit Pathogen Infection. Plant Physiol. 2015, 169, 2324–2334. [Google Scholar] [CrossRef] [PubMed]
- Medina, E.; De Castro, A.; Romero, C.; Brenes, M. Comparison of the Concentrations of Phenolic Compounds in Olive Oils and Other Plant Oils: Correlation with Antimicrobial Activity. J. Agric. Food Chem. 2006, 54, 4954–4961. [Google Scholar] [CrossRef] [PubMed]
- Omar, S.H. Oleuropein in Olive and Its Pharmacological Effects. Sci. Pharm. 2010, 78, 133–154. [Google Scholar] [CrossRef]
- Di Francesco, A.; Ugolini, L.; Lazzeri, L.; Mari, M. Production of Volatile Organic Compounds by Aureobasidium pullulans as a Potential Mechanism of Action against Postharvest Fruit Pathogens. Biol. Control 2015, 81, 8–14. [Google Scholar] [CrossRef]
- Mari, M.; Martini, C.; Spadoni, A.; Rouissi, W.; Bertolini, P. Biocontrol of Apple Postharvest Decay by Aureobasidium pullulans. Postharvest Biol. Technol. 2012, 73, 56–62. [Google Scholar] [CrossRef]
- Ippolito, A.; Nigro, F. Impact of Preharvest Application of Biological Control Agents on Postharvest Diseases of Fresh Fruits and Vegetables. Crop Prot. 2000, 19, 715–723. [Google Scholar] [CrossRef]
- Schena, L.; Nigro, F.; Pentimone, I.; Ligorio, A.; Ippolito, A. Control of Postharvest Rots of Sweet Cherries and Table Grapes with Endophytic Isolates of Aureobasidium pullulans. Postharvest Biol. Technol. 2003, 30, 209–220. [Google Scholar] [CrossRef]
- Yacoub, A.; Gerbore, J.; Magnin, N.; Chambon, P.; Dufour, M.C.; Corio-Costet, M.F.; Guyoneaud, R.; Rey, P. Ability of Pythium oligandrum Strains to Protect Vitis vinifera L., by Inducing Plant Resistance against Phaeomoniella chlamydospora, a Pathogen Involved in Esca, a Grapevine Trunk Disease. Biol. Control 2016, 92, 7–16. [Google Scholar] [CrossRef]
- Mohamed, N.; Lherminier, J.; Farmer, M.-J.; Fromentin, J.; Béno, N.; Houot, V.; Milat, M.-L.; Blein, J.-P. Defense Responses in Grapevine Leaves Against Botrytis cinerea Induced by Application of a Pythium oligandrum Strain or Its Elicitin, Oligandrin, to Roots. Phytopathology 2007, 97, 611–620. [Google Scholar] [CrossRef]
- Naghdi Badi, H.; Abdollahi, M.; Mehrafarin, A.; Ghorbanpour, M.; Tolyat, M.; Qaderi, A.; Ghiaci Yekta, M. An Overview on Two Valuable Natural and Bioactive Compounds, Thymol and Carvacrol, in Medicinal Plants. J. Med. Plants 2017, 16, 1–32. [Google Scholar]
- Scariot, F.J.; Foresti, L.; Delamare, A.P.L.; Echeverrigaray, A.P.L.S. Activity of Monoterpenoids on the in Vitro Growth of Two Colletotrichum Species and the Mode of Action on C. acutatum. Pestic. Biochem. Physiol. 2020, 170, 104698. [Google Scholar] [CrossRef] [PubMed]
- Nazzaro, F.; Fratianni, F.; Coppola, R.; Feo, V. De Essential Oils and Antifungal Activity. Pharmaceuticals 2017, 10, 86. [Google Scholar] [CrossRef] [PubMed]
- Oviedo, L.A.; García, C.M.; Durango, D.L.; Numpaque, M.A.; Gil, J.H. Thymol and Carvacrol: Biotransformation and Antifungal Activity against the Plant Pathogenic Fungi Colletotrichum acutatum and Botryodiplodia theobromae. Trop. Plant Pathol. 2011, 36, 3–13. [Google Scholar]
- Cabanás, C.G.L.; Schilirò, E.; Valverde-Corredor, A.; Mercado-Blanco, J. Systemic Responses in a Tolerant Olive (Olea europaea L.) Cultivar upon Root Colonization by the Vascular Pathogen Verticillium dahliae. Front. Microbiol. 2015, 6, 155736. [Google Scholar] [CrossRef]
- Trabelsi, R.; Sellami, H.; Gharbi, Y.; Cheffi, M.; Chaari, A.; Baucher, M.; El Jaziri, M.; Triki, M.A.; Gdoura, R. Response of Olive Tree (Olea europaea L. cv. Chemlali) to Infection with Soilborne Fungi. J. Plant Dis. Prot. 2017, 124, 153–162. [Google Scholar] [CrossRef]
- Ben Amira, M.; Lopez, D.; Triki Mohamed, A.; Khouaja, A.; Chaar, H.; Fumanal, B.; Gousset-Dupont, A.; Bonhomme, L.; Label, P.; Goupil, P.; et al. Beneficial Effect of Trichoderma harzianum Strain Ths97 in Biocontrolling Fusarium solani Causal Agent of Root Rot Disease in Olive Trees. Biol. Control 2017, 110, 70–78. [Google Scholar] [CrossRef]
- Gouvinhas, I.; Martins-Lopes, P.; Carvalho, T.; Barros, A.; Gomes, S. Impact of Colletotrichum acutatum Pathogen on Olive Phenylpropanoid Metabolism. Agriculture 2019, 9, 173. [Google Scholar] [CrossRef]
Biological Plant Protection Products | Active Substances | Maximum Certified Dose | Supplier |
---|---|---|---|
Amylo-X® WG | Bacillus amyloliquefaciens subsp. plantarum strain D747 | 1.5 g L−1 | K&N Efthymiadis S.A., Athens, Greece |
Botector® WG | Aureobasidium pullulans DSM 14940; Aureobasidium pullulans DSM 14941 | 1 g L−1 | Elanco Hellas S.A., Avlonas, Greece |
FytoSave® SL | Chito-oligosaccharides (COS-OGA) | 3.3 mL L−1 | Elton International Trading Co. S.A., Athens, Greece |
LBG 01F34® SL | Potassium phosphonates | 4 mL L−1 | BASF Hellas S.A., Athens, Greece |
Mevalone® CS | Eugenol, Thymol, Geraniol | 4 mL L−1 | K&N Efthymiadis S.A., Athens, Greece |
Polyversum® WP | Pythium oligandrum strain M1 | 0.3 g L−1 | BASF Hellas S.A., Athens, Greece |
Remedier® WP | Trichoderma asperellum strain ICC012 Trichoderma gamsii strain ICC080 | 2.5 g L−1 | AGROLOGY S.A., Athens, Greece |
Serenade Aso® SC | Bacillus amyloliquefaciens strain QST 713 | 10 mL L−1 | Bayer Hellas A.G., Athens, Greece |
Sonata® SC | Bacillus pumilus strain QST 2808 | 1 mL L−1 | Bayer Hellas A.G., Athens, Greece |
Trianum-P® WG | Trichoderma harzianum strain T22 | 0.3 g L−1 | Koppert B.V. Hellas, Athens, Greece |
Vacciplant® SL | Laminarin | 2 mL L−1 | Alfa Agricultural Supplies S.A., Athens, Greece |
Number | Percentage of Fruit Rot |
---|---|
0 | No visible symptoms |
1 | Visible symptoms affecting less than 25% of the fruit surface |
2 | Visible symptoms affecting 25–50% of the fruit surface |
3 | Visible symptoms affecting 50–75% of the fruit surface |
4 | Visible symptoms affecting 75–100% of the fruit surface |
5 | Fruit completely rotten |
Gene | Primers | Primer Sequence (5′–3′) | Product Size (bp) | Accession Number | Reference |
---|---|---|---|---|---|
Phenylalanine ammonia-lyase (Pal) | OePAL-F | CATTGAAAGGTAGCCATCTA | 101 | KJ511868 | [65] |
OePAL-R | CTAGCAAATTGGAAGAGGTT | ||||
Copper amin oxidase (Cuao) | OeCUAO-F | AAGATGGCCTTGGGAAGAAT | 191 | GQ851613 | [47] |
OeCUAO-R | TTCTGCCAATCCTGTTCTCC | ||||
Putative alcohol dehydrogenase (Aldh1) | OeALDH1-F | TTTAAGTGGGGAGCTCAAATACA | 200 | JX266197 | |
OeALDH1-R | GATGCTTCAGATATTCCCATGC | ||||
Beta-1,3-glucanase (Bglu) | BGLU-F | TTTCACGCGTTGGTAATCCG | 180 | AJ810085.1 | |
BGLU-R | CAGCCTTTTCAAGTGCTGCA | ||||
Major pollen allergen (Mpol) | Mpol-F | TGTTCCCCAACCTCCAGTTT | 186 | XM_0230363 | |
Mpol-R | TCCTTCTGCTCTCGTGTAACC | ||||
9-Lipoxygenase (Lox) | LOX-F | CAAGCGAAACACCAGAACCA | 180 | EU678670.1 | |
LOX-R | CCACGGATCCTCCAAGAACC | ||||
Phenylalanine ammonia-lyase (Phely) | OlPhely-F | CAAAAGCCTAAACAAGATCG | 188 | XM_023030332.1 | |
OlPhely-R | CAGGGGTGGCTTGAAAATTC | ||||
Chitinase 2 (CHI 2) | Olest73-F | ACGCTAGTGCAGCAAGTATGACAAGGAGA | 145 | CK087221 | |
Olest73-R | GGAGCCGTGGCGGTCCCACT | ||||
Pathogenesis-related Protein (PR10) | PR10-F | GATGTGTGGAGAGGCTTT | 153 | JZ823324 | [64] |
PR10-R | CGTCATTTTTCTTCCTAGG | ||||
Thaumatine-like protein (PR5) | PR5-F | GGGCAAGTGAACAGGCTT | 177 | JZ844402.1 | [66] |
PR5-R | GGCGGTTGTAACAACCCGT | ||||
Actin | OlActin-F | GAGCGGGAAATTGTGAGAGA | 195 | AF545569 | [47] |
OlActin-R | CTGGTAAAGAACCTCAGGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Varveri, M.; Papageorgiou, A.G.; Tsitsigiannis, D.I. Evaluation of Biological Plant Protection Products for Their Ability to Induce Olive Innate Immune Mechanisms and Control Colletotrichum acutatum, the Causal Agent of Olive Anthracnose. Plants 2024, 13, 878. https://doi.org/10.3390/plants13060878
Varveri M, Papageorgiou AG, Tsitsigiannis DI. Evaluation of Biological Plant Protection Products for Their Ability to Induce Olive Innate Immune Mechanisms and Control Colletotrichum acutatum, the Causal Agent of Olive Anthracnose. Plants. 2024; 13(6):878. https://doi.org/10.3390/plants13060878
Chicago/Turabian StyleVarveri, Maria, Anastasia G. Papageorgiou, and Dimitrios I. Tsitsigiannis. 2024. "Evaluation of Biological Plant Protection Products for Their Ability to Induce Olive Innate Immune Mechanisms and Control Colletotrichum acutatum, the Causal Agent of Olive Anthracnose" Plants 13, no. 6: 878. https://doi.org/10.3390/plants13060878