Next Article in Journal
The Involvement of Amino Acid Metabolism in the Mechanisms of Salt Tolerance Adaptation in Medicago sativa and Medicago truncatula
Previous Article in Journal
Marker-Assisted Backcross Breeding of Drought-Tolerant Maize Lines Transformed by Vacuolar H+-Pyrophosphatase Gene (AnVP1) from Ammopiptanthus nanus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 14
Issue 6
10.3390/plants14060928
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MIKC-Type MADS-Box Gene Analysis Reveals the Role of PlSOC1 in Bud Dormancy Transition in Herbaceous Peony

by
Qiaoyu Huang
1,
Xiaoxuan Chen
2,
Shuyun Zhong
2,
Shuangzhe Wu
2,
Junhong Guo
2,
Qiyao Wang
2,
Jiahe Li
2,
Danqing Li
3,
Yiping Xia
2,
Jiaping Zhang
2,* and
Xiaobin Wang
1,*
1
Jiangxi Provincial Key Laboratory for Postharvest Storage and Preservation of Fruits & Vegetables, College of Agronomy, Jiangxi Agricultural University, Nanchang 330045, China
2
College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, China
3
Department of Landscape Architecture, Zhejiang Sci-Tech University, Hangzhou 310018, China
*
Authors to whom correspondence should be addressed.
Plants 2025, 14(6), 928; https://doi.org/10.3390/plants14060928
Submission received: 16 January 2025 / Revised: 10 March 2025 / Accepted: 13 March 2025 / Published: 15 March 2025
(This article belongs to the Topic Plant Physiological and Ecological Responses to Environmental Stress)
Browse Figures
Versions Notes

Abstract

:
The MIKC-type MADS-box (MIKC) gene family is essential for controlling various plant developmental processes, including flowering time and dormancy transitions. Although the MIKC gene family has been widely studied across different plants, its characterization and functional study in herbaceous peony remain limited. In this study, 19 Paeonia lactiflora Pall. MIKC-type (PlMIKC) genes were identified from the transcriptome of a low-chilling requirement Paeonia lactiflora Pall. cultivar ‘Hang Baishao’. These MIKC genes were categorized into seven clades: six were classified as MIKCC-type, including FUL/AP1, DAM, PI, AGL18, AGL12, AG, and SOC1, and one, AGL30, was classified as MIKC*-type. Notably, the FLC clade genes were absent in Paeonia lactiflora Pall. The PlMIKC genes were predominantly localized to the nucleus, and their sequences contained highly conserved MADS and K-domains. Phylogenetic analysis demonstrated that PlMIKC genes share a strong evolutionary affinity with the MIKC genes from grapevine (Vitis vinifera) and poplar (Populus trichocarpa). A low-temperature-induced bud dormancy transition (BDT) experiment revealed that PlMIKC genes, such as PlFUL and PlDAM, were highly expressed during dormancy maintenance, while PlSOC1, PlAGL12, and PlAGL30 were upregulated during BDT. Additionally, the transient overexpression of PlSOC1 in ‘Hang Baishao’ significantly accelerated BDT and promoted bud break, suggesting that SOC1, traditionally linked to flowering regulation, also plays a key role in dormancy transition. Since limited literature on the MIKC gene family is currently available in herbaceous peony, this study expands the knowledge of the MIKC genes in Paeonia lactiflora Pall. and offers valuable insights into the molecular regulation of bud dormancy in response to low temperatures.

1. Introduction

Perennial plants in boreal and temperate regions have developed adaptive growth strategies that enable them to cycle annually between growth and dormancy, protecting shoot apical meristems from adverse environmental conditions [1]. A key trait of perennials is their capacity to remain dormant, during which the meristem temporarily becomes unresponsive to growth-promoting signals until dormancy is lifted [2]. Throughout the life cycle of perennial plants, buds progress through distinct dormancy stages: paradormancy, endodormancy, and ecodormancy [3]. Notably, the transition from endodormancy to ecodormancy is crucial for subsequent bud break and flowering under favorable spring conditions [4]. Understanding the mechanisms governing bud dormancy transition (BDT) is essential for addressing significant agricultural challenges, particularly issues like failed bud break and blooming of perennials growing in the subtropical zone [5,6,7,8].
MADS-box transcription factors are distinguished by the MADS domain, a highly conserved region located at the N-terminal of the protein [9]. The MADS-box gene family, comprising type I and type II (MIKC-type) genes, is crucial for plant growth and development, with MIKC-type genes serving as key regulators of bud dormancy and flowering [10,11]. MIKC-type genes are further categorized into two subgroups, MIKCC and MIKC*, based on sequence variations in the intervening region [12]. In Arabidopsis thaliana, MIKCC genes are grouped into 12 phylogenetic clades, including AP1/FUL, SOC1, AG, SVP, AGL15 (AGL18), AP3/PI, SEP, AGL6, FLC, BS, AGL12, and AGL17 [13,14]. The analysis of increasing transcriptome data indicates that MIKC genes are modulated by environmental signals and play a pivotal role in regulating bud dormancy [15,16]. Among these MIKC genes, the Dormancy-associated MADS-box (DAM) gene, a homolog of the Arabidopsis SHORT VEGETATIVE PHASE (SVP) gene, was first identified in a non-dormant evergrowing peach (Prunus persica) mutant [17] and later recognized as a master regulator of dormancy induction and maintenance in perennial species, such as peach [18], leafy spurge (Euphorbia esula) [19], pear (Pyrus pyrifolia) [20], and apricot (Prunus mume) [21].
In contrast to the DAM gene, another MIKC homolog, Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CO1 (SOC1), has been shown to facilitate bud dormancy release and bud break in tree peony (Paeonia suffruticosa) [22] and kiwifruit (Actinidia chinensis) [23]. In hybrid aspen (Populus tremula x Populus tremuloides), the APETALA1 (AP1) gene regulates seasonal growth cessation via the CONSTANS (CO)/FLOWERING LOCUS T (FT) module [24]. Additionally, a newly identified MIKC gene, the low-temperature-induced MADS-box (LIM1) gene, has been shown to activate the gibberellic acid (GA) pathway, facilitating dormancy release by reducing callose accumulation and reopening plasmodesmata [25]. MIKC genes are also involved in responding to various stresses. In Arabidopsis, AGL16 negatively regulates drought resistance by affecting stomatal density and movement [26]. AGL21 is responsive to various environmental stresses, with its overexpression resulting in increased sensitivity to abscisic acid, salt, and osmotic stresses [27]. Moreover, MIKC genes are also crucial for regulating flower development and flowering time [14]. In tomato (Solanum lycopersicum), the overexpression of the MIKC gene Tomato MADS 8 (TM8) led to abnormal stamens and poorly viable pollen [28]. In Arabidopsis, key MIKC genes such as SOC1 [29], FLOWERING LOCUS C (FLC) [30], AGAMOUS-LIKE 18 (AGL18) [31], AGL24 [32], and SVP [33] have been identified as crucial regulators of flowering time. Nevertheless, the mechanisms by which MIKC genes regulate bud dormancy in herbaceous perennials remain poorly understood.
Herbaceous peony (Paeonia lactiflora Pall.), belonging to the Paeoniaceae family, is a versatile ornamental and oil crop cultivated worldwide, known for its vibrant flowers and promising oilseed production [34,35]. The overwintering buds of herbaceous peony are generated from underground parts in autumn and enter endodormancy under a short daylength and low temperatures [36]. Sufficient low temperatures are needed in winter to complete the transition from endodormancy to ecodormancy [8]. However, global warming has resulted in increasingly frequent warm winters, reducing the accumulation of chilling temperatures necessary for the dormancy transition of herbaceous peony [36,37]. This disruption hampers subsequent growth and development, ultimately leading to reduced crop yields, particularly in southern China [37,38]. Current research has predominantly focused on understanding the processes of bud dormancy in woody plants, while the mechanisms governing these processes in herbaceous peony remain largely unexplored [39]. Although our previous studies on physiological responses and gene expression have identified several MIKC gene homologs, such as SVP, SOC1, and AP1, whose expression correlates with dormancy transitions [36,40], a comprehensive exploration of MIKC gene involvement in regulating bud dormancy in herbaceous peony is still lacking.
Given the crucial role of MIKC-type MADS-box genes in regulating bud dormancy and flowering, along with the limited knowledge of their characteristics in herbaceous peony, we aimed to identify and conduct a comprehensive analysis of MIKC genes in Paeonia lactiflora Pall. The objective of this study is to achieve the following: (1) identify and characterize the MIKC genes in Paeonia lactiflora Pall.; (2) analyze the expression of these MIKC genes during low-temperature-induced BDT and clarify the role of PlSOC1 in this process. This study offers novel insights into the role of MIKC-type genes in regulating bud dormancy and lays foundation for developing low-chilling requirement herbaceous peony cultivars to address agricultural challenges posed by climate change.

2. Results

2.1. Identification and Phylogenetic Analysis of MIKC-Type Genes in Herbaceous Peony

A total of 19 MIKC-type transcripts, corresponding to eight genes, were identified from the Paeonia lactiflora Pall. transcriptome (Table 1). Detailed information on PlMIKCs, including protein size, molecular weight, isoelectric point (PI), instability index, hydrophilic index (grand average of hydropathy, GRAVY), and subcellular localization is provided in Table 1. Specifically, the lengths of PlMIKC proteins ranged from 127 to 351 amino acids, with molecular weights spanning from 14.30 to 39.55 kDa. The pI values ranged between 5.65 and 10.17. Subcellular localization predictions indicated that all PlMIKCs are localized in the nucleus (Table 1).
To explore the evolutionary relationships among MIKC-type gene families, a phylogenetic tree was constructed using MIKC proteins from Arabidopsis thaliana (At), Vitis vinifera (VIT), Populus trichocarpa (Potri.), Amborella trichopoda (scaffold), Oryza sativa (LOC_Os), Actinidia chinensis (Actinidia), and Prunus persica (Prupe.). The analysis revealed that these proteins were categorized into seven clades, with six classified as MIKCC-type, including FUL/AP1, DAM, PI, AGL18, AGL12, AG, and SOC1, and one, AGL30, classified as MIKC*-type (Figure 1). Notably, the FLC subfamily genes were absent in Paeonia lactiflora Pall. The DAM (SVP) subfamily had the largest number of members, with six genes, followed by four members in the AP1/FUL-like subfamily, and two genes in the AGL18, PI, and AGL30 subfamilies. The SOC1, AG, and AGL12 subfamilies contained only one gene (Figure 1).

2.2. Multiple-Sequence Alignment of PlMIKCs

To further investigate the structures of MIKC-type genes, sequence alignments were conducted on PlMIKC proteins from the AP1/FUL, DAM, SOC1, PI, AGL18, and AGL12 clades. The multiple sequence alignment of these PlMIKCs revealed high similarity among the sequences, which contained the conserved MADS and K-domains. In detail, the MADS domain ranged from approximately 6 to 63 amino acids, while the K-domain spanned from 109 to 144 amino acids (Figure 2).

2.3. Protein Structure and Conserved Motif Distribution Analysis

To gain a deeper insight into the structural diversity of PlMIKC genes, protein structure and conserved motifs were compared in relation to their phylogenetic relationships. A phylogenetic tree of the 19 PlMIKC proteins was constructed using the Maximum Likelihood method, revealing four distinct groups: Group 1 consisted of six PlDAMs, Group 2 included PlAGL12, PlAGL18, PlSOC1, and PlPIs, Group 3 contained PlFULs and PlAGL30s, while Group 4 consisted solely of PlAG (Figure 3A). The conserved domain analysis showed that all the 19 PlMIKCs contained the MADS domain, with most also containing the K-domain, except for PlFUL-2, PlAGL30s, and PlAG (Figure 3A). The MEME was employed to detect conserved motifs within the PlMIKC proteins (Figure 3B) and the amino acid sequences of the six conserved motifs are presented in Figure 3C. Motif analysis revealed that motif 1 was the most characteristic MADS-box domain, while motif 2 corresponded to the K-domain. Most PlMIKCs contained both motifs 1 and 2; however, motif 1 was absent in PlAGL18-2 and PlPI-1, while motif 2 was missing in PlFUL-2 and PlAG. In the PlDAM subfamily, members except PlDAM-3 contained motifs 3, 4, and 5. Notably, motif 6 was found only in PlFUL-1, PlFUL-3, and PlFUL-4 among the 19 PlMIKCC proteins, highlighting the structural diversity across subfamilies (Figure 3B,C). These findings suggest that members within the same subfamily share strong similarity in motif composition, indicating that genes within a group may perform similar functions.

2.4. Low-Temperature Triggers BDT in Herbaceous Peony

To explore the involvement of these PlMIKC genes in the dormancy transition of herbaceous peony, we conducted a controlled low-temperature-induced BDT experiment. One-year-old rhizomes of Paeonia lactiflora Pall. ‘Hang Baishao’ were placed in a dark freezer at 4 °C. After 0–5 weeks of controlled low temperature exposure, the status of the rhizomes is shown in Figure 4A. The corresponding ability to undergo bud breakage and regrow increased gradually. Specifically, no plants sprouted without chilling treatment or after only 1 week of a short-term low temperature. With prolonged chilling, sprouting occurred more quickly, and plant height increased, but no further significant changes were observed beyond 4 weeks of treatment (Figure 4B). These results indicate that the buds remained in endodormancy during weeks 0 to 1 and shifted to ecodormancy during weeks 4 to 5.

2.5. Expression Pattern of the PlMIKC Genes During BDT

We next investigated the expression pattern of the 19 PlMIKC genes of ‘Hang Baishao’ during BDT. Cluster analysis revealed three distinct expression trends across the dormancy phases. Several genes, including PlFUL-3, PlFUL-4, PlDAM-6, PlAGL18-1, and PlAGL18-2, exhibited high expression at week 0 (endodormancy stage), followed by significant downregulation, maintaining consistently low expression levels during the subsequent BDT and ecodormancy phases (Figure 5A). In contrast, genes such as PlAG, PlPI-1, PlPI-2, PlAGL30-2, PlSOC1, and PlAGL12 demonstrated low expression during week 0 to week 1, corresponding to the endodormancy phase, but their expression gradually increased, peaking during the late BDT or ecodormancy phases. Another subset of genes, including five PlDAMs, two PlFULs, and PlAGL30-1, showed pronounced upregulation after 1 week of short-term chilling, followed by a decline during the BDT phase. In the ecodormancy phase, their expression either remained low or increased again (Figure 5A). These differential expression patterns underscore the complex regulatory roles of PlMIKC genes during the transition from endodormancy to ecodormancy, reflecting their involvement in the modulation of dormancy phases.
To verify the RNA sequencing results, qRT-PCR was performed on PlAGL18-1 and PlSOC1, which were downregulated and upregulated during BDT, respectively. As shown in Figure 5B, PlAGL18 was highly expressed during endodormancy but dropped sharply after cold treatment, remaining low in the dormancy transition and ecodormancy stages. In contrast, PlSOC1 showed a continuous increase under cold exposure. The Pearson correlations between FPKM values and qRT-PCR results were 0.888 and 0.977 (p < 0.01), confirming the reliability of the transcriptome data (Figure 5B).
To investigate the potential interactions between PlMIKC proteins, we conducted the protein–protein interaction predictions using key Arabidopsis MIKC homologous proteins as a reference. In this interaction network, AtSOC1 occupies a central position and exhibits strong interactions with AtFUL (AtAGL8), AtAGL12, AtAP1, and AtSVP, all of which have been reported to interact directly (Figure 6). In this study, PlSOC1 expression was consistently upregulated under low-temperature treatment, correlating with dormancy transition and positively associated with PlAGL18 and PlAGL30 expression, while negatively correlated with the PlDAMs and PlFULs expression (Figure 4 and Figure 6). These findings suggest that PlSOC1 may play a regulatory role in herbaceous peony dormancy transition by interacting with PlFUL, PlDAM, PlAGL30, and PlAGL18.

2.6. PlSOC1 Promotes BDT in Herbaceous Peony

The previous study indicates that PlSOC1 could be essential in regulating the dormancy transition in herbaceous peony (Figure 5 and Figure 6). To further assess its function in dormancy transition in herbaceous peony, we constructed an overexpression vector (Figure 7A) and transiently overexpressed PlSOC1 in ‘Hang Baishao’ during the early BDT stage (after 3 weeks of low-temperature treatment). YFP fluorescence was detected in PlSOC1-overexpressing plants and empty vector-transformed controls, but not in wild-type (WT) plants (Figure 7B).
Compared to empty vector-transformed plants, PlSOC1-overexpressing plants exhibited a significant increase in PlSOC1 expression levels (Figure 7C). Importantly, the bud break percentage and bud length of PlSOC1-overexpressing plants significantly increased from 45.8% to 94.4% and from 3.4 cm to 11.2 cm, respectively (Figure 7B,C). These findings suggest that PlSOC1 promotes BDT and bud break in herbaceous peony.

3. Discussion

3.1. MIKC-Type Genes in Peony

With the completion of genome and transcriptome sequencing, MADS-box genes have been extensively identified and analyzed in many significant plant species [42]. The number of MADS-box genes varies significantly across plant species. Arabidopsis has been found to contain 107 MADS-box genes, of which 39 are classified as MIKC-type [13]. Similarly, rice (Oryza sativa) possesses 75 MADS-box genes, with 38 of them belonging to the MIKC-type [43]. In rose (Rosa chinensis), Liu et al. identified 58 non-redundant MIKCC uni-transcripts from transcriptomic data and grouped them into 12 clades [14]. However, the identification and annotation of MIKC genes in herbaceous peony remain unexplored. In this study, 19 MIKC-type genes were identified from the herbaceous peony transcriptome and categorized into seven subfamilies based on bioinformatics analysis: FUL/AP1 (4), SVP (6), AGL18 (2), PI (2), AGL30 (2), AG (1), AGL12 (1), and SOC1 (1). Interestingly, the FLC subfamily was absent from the Paeonia lactiflora Pall. transcriptome, a finding consistent with reports from other plant species, such as wintersweet (Chimonanthus praecox) [44] and rose [14]. Such losses of MIKC genes, particularly within the TM8-like and FLC-like clades, are hypothesized to reflect adaptive evolutionary events [45].
Tree peony (Paeonia sect. Moutan DC.) is a perennial deciduous shrub and a sibling species of herbaceous peony belonging to the same genus Paeonia. Since the publication of the tree peony (Paeonia ostii) genome [46], the genome-wide characterization of the MADS-box gene family in Paeonia ostii has been conducted. Yang et al. identified 110 MADS-box genes in Paeonia ostii, among which 40 were MIKC genes. MIKC genes were further classified into 12 evolutionary clades: AP1/FUL, AP3/PI, AG, SEP, SOC1, SVP, AGL6, AGL12, AGL15, AGL17, FLC, and BS. Notably, no PoMIKC genes were found in the FLC and AGL17 clades, similar to the findings in this study [47]. In both herbaceous and tree peony, the MIKC gene family is an important factor in regulating flower development. In Paeonia lactiflora Pall., PlAP3-1, PlAP3-2, and PlPI mainly govern stamen and petal formation, while PlSEP3 controls sepal and petal identity. The expression analysis of key MIKC genes in Paeonia ostii floral organs showed that MIKC genes play a crucial role in floral development [47]. In tree peony (Paeonia suffruticosa), PsAGL6, PsAG, and PsSEP likely regulate sepals and carpels, while PsPI probably controls stamen and pistil petalization [48,49,50].

3.2. Functional Analysis of PlMIKC Genes Based on Gene Expression Pattern

The MADS-box gene family, particularly with regard to the MIKC-type genes, has been widely recognized as key regulators of dormancy transitions [11,44]. The expression trends of the 19 PlMIKCs genes during the BDT of ‘Hang Baishao’ in this study provide new insights into their roles in dormancy regulation. Importantly, PlDAMs were highly expressed during endodormancy but were downregulated during the BDT phase. This suggests their role in dormancy maintenance, similar to the function of DAMs in species such as pear [20] and apricot [21]. Meanwhile, FUL (AGL8), a member of MIKC genes acting downstream of FT, has been shown to interact with SOC1 to promote flowering and modulate meristem determinacy in Arabidopsis [51]. Although the expression trends of PlFUL-1 and PlFUL-2 during endodormancy were similar to that of PlDAM, with both showing significant upregulation, PlFUL exhibited a gradual increase throughout the BDT and ecodormancy phases. This suggests that PlFUL might be involved in the dormancy transition of herbaceous peony in response to prolonged low temperature exposure. Additionally, the transient upregulation of several PlDAM and PlFUL genes in response to short-term low-temperature highlights the responsiveness of MIKC-type genes to environmental cues, as observed in other perennial species like peach [18] and pear [20].
In contrast to PlDAMs, PlSOC1, PlAGL12, and PlAGL30 exhibit low expression during endodormancy but show increased expression during BDT, consistent with dormancy transition phases. In Arabidopsis, AGL18 is pivotal for root development and flowering transition [31], while AGL30 plays a key role in regulating pollen development [52]. However, their specific contributions to dormancy regulation remain largely unexplored. Notably, in this study, AGL18 and AGL30 displayed expression patterns similar to SOC1 and were positively correlated with BDT, suggesting a potential positive regulatory role in BDT. These findings highlight the diverse and critical functions of MIKC genes in dormancy regulation, offering valuable insights into their potential roles in orchestrating developmental transitions during dormancy phases.

3.3. SOC1: Traditionally Known for Promoting Flowering, but Also Facilitates Dormancy Transition

SOC1 is known as a central regulator in Arabidopsis floral transition and flowering time by integrating multiple signaling pathways [32]. The overexpression of the tree peony PsSOC1 gene in Arabidopsis promoted early flowering, accompanied by the upregulation of LEAFY (LFY) [53]. The Bambusa oldhamii SOC1-like gene BoMADS50 was highly expressed during the floral primordium formation stage, and its overexpression induced early flowering in transgenic rice [54]. Nevertheless, the role of SOC1 in the bud dormancy transition of perennials remains largely unknown. However, seasonal expression studies have detected SOC1 activity during winter dormancy in several species, such as tree peony [53] and Japanese apricot [55]. Voogd et al. [23] investigated the phenotype of kiwifruit lines overexpressing AcSOC1i, AcSOC1e, and AcSOC1f, revealing that only AcSOC1i significantly promoted earlier bud break compared to control plants [23]. Similarly, hybrid poplars in the ecodormancy stage overexpressing MADS12 (a SOC1-like gene) show early bud break, highlighting the involvement of SOC1 in bud reactivation [56]. A recent study in tree peony confirmed that PsSOC1 interacts with the DELLA protein RGA-LIKE 1 (RGL1), a negative regulator of the GA pathway, to promote bud dormancy release [22]. In addition, SOC1 is believed to be associated with chilling requirements. In apricot, specific allele combinations of SOC1, such as 262/262 or 262/278, have been linked to high chilling requirement trait, while the 215/278 combination is associated with low-CR trait [57]. Our earlier research on herbaceous peony observed the consistent upregulation of PlSOC1 until the ecodormancy phase during winter [36,40]. In this study, PlSOC1 was the most highly expressed gene among the 19 MIKC genes, with its expression positively correlated with dormancy transition. Transient overexpression of PlSOC1 in ‘Hang Baishao’ significantly promoted bud break. Therefore, an increasing number of studies have shown that SOC1 is not only an integrator of flowering but also a key factor in promoting dormancy transition.

4. Materials and Methods

4.1. Plant Materials

The Paeonia lactiflora Pall. cultivar ‘Hang Baishao’ was selected as plant material based on our previous research [36,37]. ‘Hang Baishao’ is a native cultivar with a low chilling requirement trait and can grow successfully in low-latitude regions (Figure 8) [38,58].
The flowers of ‘Hang Baishao’ display a range of colors, with pink (Figure 8A) and red-purple (Figure 8B) being the most prevalent. In addition, it produces large and abundant seed pods (Figure 8C), making it a highly valuable oilseed crop. As a geophyte, the aboveground parts of ‘Hang Baishao’ senesce in September, entering a dormant phase as underground buds during the winter. In the following spring, ‘Hang Baishao’ resumes growth in March and blooms in mid-April [36,38]. Moreover, we have conducted extensive agronomic observations on ‘Hang Baishao’ over the years. For more details on its chilling requirement, adaptability, ornamental features and growth habits, please refer to Wang et al. [37,38].
In this study, dormant one-year-old ‘Hang Baishao’ rhizomes are used for cold treatment and gene function verification. ‘Hang Baishao’ rhizomes were obtained from the Perennial Flower Resources Garden at Zhejiang University in Hangzhou, China. Compared to multi-year-old herbaceous peony, one-year-old rhizomes offer advantages of being easier to obtain, smaller in size (Figure 8D), and more suitable for Agrobacterium infection (Figure 8E,F) [59].

4.2. Low-Temperature Treatment and Transcriptome Analysis

Dormant one-year-old ‘Hang Baishao’ rhizomes were subjected to a controlled low temperature (4 °C) for 0 to 5 weeks (0–5 W) to obtain rhizome buds at the endodormancy, dormancy transition, and ecodormancy stages, respectively. The buds from different dormancy stages were collected, immediately frozen in liquid nitrogen, and stored at −80 °C until subsequent transcriptome sequencing. Additionally, a group of rhizomes, exposed to 0–5 weeks of low temperature, was transferred to a greenhouse (25 °C, 16/8 h light/dark) to observe bud break and growth performances, as described by Wang et al. [36].
Total RNA was extracted from the sampled buds using the RNAprep Pure Plant Kit (Tiangen, Beijing, China). The RNA concentration and quality were measured using a Nanodrop 2100 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and its integrity was assessed by 1.0% agarose gel electrophoresis. Subsequently, cDNA libraries were constructed using a SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA). The final library, prepared at a volume of 20 µL with a concentration of 5 nM, was sequenced on the BGIseq500 platform (BGI, Beijing Genomic Institute, Shenzhen, China) with three biological replicates per sample. Sequencing data were filtered using SOAPnuke (v1.5.2) to yield clean reads in FASTQ format. Since the genome of herbaceous peony has not yet been published, clean reads were de novo assembled into transcripts using Trinity v2.5.1. Gene expression was normalized into FPKM using RSEM (v.1.3.0).

4.3. Identification and Phylogenetic Analysis of MIKC Genes

To identify MIKC genes, a separate phylogenetic analysis was conducted. Specifically, a hidden Markov model (HMM) search was performed on the herbaceous peony transcriptome using the HMM profile (PF00319) of the SRF-TF domain from the Pfam database (http://pfam.xfam.org/, accessed on 2 January 2025). MADS-box (PF00319) HMM searches were conducted with HMMER3.0 [60] with default parameters (http://hmmer.org/, accessed on 2 January 2025). Additionally, protein sequences were also compared to representative MIKC genes from Arabidopsis using BLASTP with an E-value cutoff of 10−5 to detect potential MIKC genes absent from the predicted protein set. Low-quality sequences lacking both start and stop codons were excluded to improve accuracy. The identified MIKC genes were further verified through the NCBI Conserved Domain Database (https://www.ncbi.nlm.nih.gov/cdd, accessed on 2 January 2025).
A phylogenetic analysis of MIKC proteins was carried out using the predicted proteomes of Paeonia lactiflora Pall. ‘Hang Baishao’ along with representative plant species: Arabidopsis thaliana, Vitis vinifera, Populus trichocarpa, Amborella trichopoda, Oryza sativa, Actinidia chinensis, and Prunus persica. Among these species, Arabidopsis thaliana and Oryza sativa are representative dicot and monocot species, respectively. Populus trichocarpa serves as a model for bud dormancy in woody plants, while Amborella trichopoda represents the most basal angiosperm lineage. Actinidia chinensis, Prunus persica, and Vitis vinifera are key fruit tree species, with well-established research on their role in MIKC genes during bud dormancy [16,23,61]. Protein sequences of Arabidopsis thaliana MIKC family members were downloaded from The Arabidopsis Information Resource (TAIR, http://www.Arabidopsis.org/, accessed on 3 January 2025). Sequences of Actinidia chinensis were obtained from the Kiwifruit Genome Database (http://kiwifruitgenome.org/, accessed on 3 January 2025). Supplementary genome and protein data were obtained from NCBI and Phytozome (https://phytozome.jgi.doe.gov/, accessed on 3 January 2025). MIKC protein sequences were aligned using MAFFT v7.467 [62] with default settings. The phylogenetic analysis of the alignment was performed with FastTree v2.1.12 [63]. The phylogenetic tree based on sequence similarity was generated and visualized using MEGA v7.0.21 and the sequence alignment of PlMIKCs was visualized using GeneDoc v2.6 [64].

4.4. Physicochemical Characteristics and Subcellular Localization Prediction

The physicochemical characteristics of PlMIKC proteins were assessed via ExPASY ProtParam (https://web.expasy.org/protparam/, accessed on 7 January 2025). The analysis included parameters such as molecular weight, amino acid composition, instability index, PI, and GRAVY score. Subcellular localization predictions were conducted using Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/, accessed on 7 January 2025) [65].

4.5. Protein Structure and Conserved Motif Analysis

Domain information for the PlMIKCs was identified using NCBI Batch-CD-search (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi, accessed on 7 January 2025) [66]. Conserved motifs within the PlMIKC proteins were examined through MEME Suite (V5.5.7, http://meme-suite.org, accessed on 7 January 2025) [67]. Additionally, TBtools v2.152 was employed to visualize the phylogenetic tree, domains, and conserved motifs of the 19 PlMIKC proteins [68].

4.6. Expression Profiles of PlMIKC Genes During Dormancy Transition

The expression levels of PlMIKC genes during dormancy transitions were visualized in TBtools v2.152 using log2-transformed FPKM values from the transcriptome obtained in 4.1. The protein–protein interaction network was analyzed using the STRING database (https://cn.string-db.org/, accessed on 7 January 2025) [69].

4.7. Transient Overexpression of PlSOC1 in Herbaceous Peony

The PlSOC1 coding sequence was cloned into the pHB-YFP vector to create the p35S::PlSOC1 construct, which was subsequently transferred into Agrobacterium strain GV3101. The Agrobacterium cells were cultured until the bacterial suspension reached an OD600 of 1.2, then centrifuged at 4000 rpm for 10 min at 25 °C. The pellet was resuspended in infection buffer (OD = 1.0) containing 10 mM MgCl2, 10 mM 2-(N-morpholino) ethanesulfonic acid (MES), and 20 µM acetosyringone (AS), and subsequently incubated at 28 °C in the dark for 3 h. One-year-old Paeonia lactiflora Pall. rhizomes, chilled for 3 weeks, were immersed in the incubated Agrobacterium suspension and subjected to a negative pressure vacuum (−0.9 kg/cm2) for 10 min, followed by slow deflation for 20 min. After infection, the rhizomes were rinsed with clean water for 5 min, dried with absorbent paper, and initially kept in darkness for 3 days before being transferred to a growth chamber for incubation (22 °C, 16/8 h light/dark cycle, and light intensity of 2000 lux). After 15 days of cultivation, transformed rhizome buds were collected to observe phenotypes and detect YFP fluorescence and PlSOC1 expression. Plants showing both YFP fluorescence and a significant increase (p < 0.05) in PlSOC1 expression were confirmed as positively transformed. The primers used are listed in Table 2.

4.8. Quantitative Real-Time PCR (qRT–PCR) Analysis

One microgram of the extracted total RNA from Section 4.2 was converted to cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Shiga, Japan). Alpha-tubulin (TUBA) was used as a reference gene [36] and the primers are listed in Table 3. qRT–PCR was conducted with SYBR Premix Ex Taq (Takara, Shiga, Japan) on a CFX Connect TM Real-Time PCR Detection system (Bio-Rad, Hercules, CA, USA). Every reaction contained 4 µL of cDNA, 5 µL of TB Green, 0.5 µL of forward primer, and 0.5 µL of reverse primer. The qRT–PCR cycle parameters were as follows: 2 min at 95 °C; 39 cycles of 5 s at 95 °C and 30 s at 55 °C; and a melting curve program of 5 s at 95 °C, 5 s at 65 °C, and 5 s at 95 °C. The PCR procedure used was completed according to the manufacturer’s instructions. The 2−△△CT method was used to calculate the gene expression level [70].

5. Conclusions

In this study, we identified and conducted a phylogenetic analysis of MIKC-type genes in herbaceous peony. A total of 19 PlMIKC genes were identified and classified into seven subfamilies, with the FLC subfamily notably absent in the Paeonia lactiflora Pall. transcriptome. We analyzed the domain information, conserved motif distribution, and expression patterns of these PlMIKC genes during different dormancy stages in herbaceous peony. The findings highlighted the diverse and crucial roles of PlDAM, PlFUL, PlSOC1, and PlAGL18 in dormancy transition. Furthermore, the overexpression of PlSOC1 in herbaceous peony confirmed its role in promoting dormancy transition and bud break. This study fills the gap in the comprehensive analysis of MIKC-type genes in herbaceous peony and enhances the understanding of their role in dormancy regulation. Additionally, it provides a foundation for breeding low-chilling-requirement peony germplasm for cultivation in warming climates.

Author Contributions

Methodology, Q.H. and X.W.; software, X.W. and X.C.; validation and formal analysis, Q.H. and X.W.; investigation, S.Z., S.W., J.G., Q.W., J.L. and X.W.; resources, X.W.; writing, review and editing, Q.H., D.L. and X.W.; visualization, Q.H., X.C., D.L. and X.W.; supervision and funding acquisition, Y.X. and J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China under grant numbers 32371933 and 32071822.

Data Availability Statement

Data are contained within the article; additional inquiries can be addressed directly to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Anderson, J.V.; Gesch, R.W.; Jia, Y.; Chao, W.S.; Horvath, D.P. Seasonal shifts in dormancy status, carbohydrate metabolism, and related gene expression in crown buds of leafy spurge. Plant Cell Environ. 2005, 28, 1567–1578. [Google Scholar] [CrossRef]
  2. Rohde, A.; Bhalerao, R.P. Plant dormancy in the perennial context. Trends Plant Sci. 2007, 12, 217–223. [Google Scholar] [CrossRef]
  3. Lang, G.A.; Early, J.D.; Martin, G.C.; Darnell, R.L. Endo-, Para-, and Ecodormancy: Physiological Terminology and Classification for Dormancy Research. HortScience 1987, 22, 371–377. [Google Scholar] [CrossRef]
  4. Takahashi, H.; Nishihara, M.; Yoshida, C.; Itoh, K. Gentian FLOWERING LOCUS T orthologs regulate phase transitions: Floral induction and endodormancy release. Plant Physiol. 2022, 188, 1887–1899. [Google Scholar] [CrossRef]
  5. Johnson, N.C.; Xie, S.P.; Kosaka, Y.; Li, X. Increasing occurrence of cold and warm extremes during the recent global warming slowdown. Nat. Commun. 2018, 9, 1724. [Google Scholar] [CrossRef] [PubMed]
  6. Ochieng, J.; Kirimi, L.; Mathenge, M. Effects of climate variability and change on agricultural production: The case of small scale farmers in Kenya. NJAS-Wagening. J. Life Sci. 2021, 77, 71–78. [Google Scholar] [CrossRef]
  7. Sieber, J. Impacts of, and adaptation options to, extreme weather events and climate change concerning thermal power plants. Clim. Change 2013, 121, 55–66. [Google Scholar] [CrossRef]
  8. Jewaria, P.K.; Hanninen, H.; Li, X.; Bhalerao, R.P.; Zhang, R. A hundred years after: Endodormancy and the chilling requirement in subtropical trees. New Phytol. 2021, 231, 565–570. [Google Scholar] [CrossRef]
  9. Grimplet, J.; Martínez-Zapater, J.M.; Carmona, M.J. Structural and functional annotation of the MADS-box transcription factor family in grapevine. BMC Genom. 2016, 17, 80. [Google Scholar] [CrossRef]
  10. Becker, A.; Theissen, G. The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol. Phylogenetics Evol. 2003, 29, 464–489. [Google Scholar] [CrossRef]
  11. Ma, M.M.; Zhang, H.F.; Tian, Q.; Wang, H.C.; Zhang, F.Y.; Tian, X.; Zeng, R.F.; Huang, X.M. MIKC type MADS-box transcription factor LcSVP2 is involved in dormancy regulation of the terminal buds in evergreen perennial litchi (Litchi chinensis Sonn.). Hortic. Res. 2024, 11, uhae150. [Google Scholar] [CrossRef] [PubMed]
  12. Henschel, K.; Kofuji, R.; Hasebe, M.; Saedler, H.; Münster, T.; Theißen, G. Two Ancient Classes of MIKC-type MADS-box Genes are Present in the Moss Physcomitrella patens. Mol. Biol. Evol. 2002, 19, 801–814. [Google Scholar] [CrossRef]
  13. Pařenicová, L.; de Folter, S.; Kieffer, M.; Horner, D.S.; Favalli, C.; Busscher, J.; Cook, H.E.; Ingram, R.M.; Kater, M.M.; Davies, B.; et al. Molecular and Phylogenetic Analyses of the Complete MADS-Box Transcription Factor Family in Arabidopsis: New Openings to the MADS World. Plant Cell 2003, 15, 1538–1551. [Google Scholar] [CrossRef] [PubMed]
  14. Liu, J.; Fu, X.; Dong, Y.; Lu, J.; Ren, M.; Zhou, N.; Wang, C. MIKC(C)-type MADS-box genes in Rosa chinensis: The remarkable expansion of ABCDE model genes and their roles in floral organogenesis. Hortic. Res. 2018, 5, 25. [Google Scholar] [CrossRef]
  15. Horvath, D.P.; Chao, W.S.; Suttle, J.C.; Thimmapuram, J.; Anderson, J.V. Transcriptome analysis identifies novel responses and potential regulatory genes involved in seasonal dormancy transitions of leafy spurge (Euphorbia esula L.). BMC Genom. 2008, 9, 536. [Google Scholar] [CrossRef]
  16. Li, D.; Shao, L.; Zhang, J.; Wang, X.; Zhang, D.; Horvath, D.P.; Zhang, L.; Zhang, J.; Xia, Y. MADS-box transcription factors determine the duration of temporary winter dormancy in closely related evergreen and deciduous Iris spp. J. Exp. Bot. 2022, 73, 1429–1449. [Google Scholar] [CrossRef]
  17. Bielenberg, D.G.; Wang, Y.; Li, Z.; Zhebentyayeva, T.; Fan, S.; Reighard, G.L.; Scorza, R.; Abbott, A.G. Sequencing and annotation of the evergrowing locus in peach [Prunus persica (L.) Batsch] reveals a cluster of six MADS-box transcription factors as candidate genes for regulation of terminal bud formation. Tree Genet. Genomes 2008, 4, 495–507. [Google Scholar] [CrossRef]
  18. Zhao, Y.L.; Li, Y.; Cao, K.; Yao, J.L.; Bie, H.L.; Khan, I.A.; Fang, W.C.; Chen, C.W.; Wang, X.W.; Wu, J.L.; et al. MADS-box protein PpDAM6 regulates chilling requirement-mediated dormancy and bud break in peach. Plant Physiol. 2023, 193, 448–465. [Google Scholar] [CrossRef]
  19. Horvath, D.P.; Sung, S.; Kim, D.; Chao, W.; Anderson, J. Characterization, expression and function of DORMANCY ASSOCIATED MADS-BOX genes from leafy spurge. Plant Mol. Biol. 2010, 73, 169–179. [Google Scholar] [CrossRef]
  20. Yang, Q.; Yang, B.; Li, J.; Wang, Y.; Tao, R.; Yang, F.; Wu, X.; Yan, X.; Ahmad, M.; Shen, J.; et al. ABA-responsive ABRE-BINDING FACTOR3 activates DAM3 expression to promote bud dormancy in Asian pear. Plant Cell Environ. 2020, 43, 1360–1375. [Google Scholar] [CrossRef]
  21. Sasaki, R.; Yamane, H.; Ooka, T.; Jotatsu, H.; Kitamura, Y.; Akagi, T.; Tao, R. Functional and expressional analyses of PmDAM genes associated with endodormancy in Japanese apricot. Plant Physiol. 2011, 157, 485–497. [Google Scholar] [CrossRef]
  22. Zhang, Y.; Niu, D.; Yuan, Y.; Liu, F.; Wang, Z.; Gao, L.; Liu, C.; Zhou, G.; Gai, S. PsSOC1 is involved in the gibberellin pathway to trigger cell proliferation and budburst during endodormancy release in tree peony. New Phytol. 2024, 243, 1017–1033. [Google Scholar] [CrossRef]
  23. Voogd, C.; Wang, T.; Varkonyi-Gasic, E. Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy. J. Exp. Bot. 2015, 66, 4699–4710. [Google Scholar] [CrossRef] [PubMed]
  24. Azeez, A.; Miskolczi, P.; Tylewicz, S.; Bhalerao, R.P. A tree ortholog of APETALA1 mediates photoperiodic control of seasonal growth. Curr. Biol. 2014, 24, 717–724. [Google Scholar] [CrossRef]
  25. Pandey, S.K.; Maurya, J.P.; Aryal, B.; Drynda, K.; Nair, A.; Miskolczi, P.; Singh, R.K.; Wang, X.; Ma, Y.; de Souza Moraes, T.; et al. A regulatory module mediating temperature control of cell-cell communication facilitates tree bud dormancy release. Embo J. 2024, 43, 5793–5812. [Google Scholar] [CrossRef] [PubMed]
  26. Zhao, P.-X.; Miao, Z.-Q.; Zhang, J.; Chen, S.-Y.; Liu, Q.-Q.; Xiang, C.-B. Arabidopsis MADS-box factor AGL16 negatively regulates drought resistance via stomatal density and stomatal movement. J. Exp. Bot. 2020, 71, 6092–6106. [Google Scholar] [CrossRef] [PubMed]
  27. Yu, L.H.; Wu, J.; Zhang, Z.S.; Miao, Z.Q.; Zhao, P.X.; Wang, Z.; Xiang, C.B. Arabidopsis MADS-Box Transcription Factor AGL21 Acts as Environmental Surveillance of Seed Germination by Regulating ABI5 Expression. Mol. Plant 2017, 10, 834–845. [Google Scholar] [CrossRef]
  28. Daminato, M.; Masiero, S.; Resentini, F.; Lovisetto, A.; Casadoro, G. Characterization of TM8, a MADS-box gene expressed in tomato flowers. BMC Plant Biol. 2014, 14, 319. [Google Scholar] [CrossRef]
  29. Immink, R.G.; Pose, D.; Ferrario, S.; Ott, F.; Kaufmann, K.; Valentim, F.L.; de Folter, S.; van der Wal, F.; van Dijk, A.D.; Schmid, M.; et al. Characterization of SOC1’s central role in flowering by the identification of its upstream and downstream regulators. Plant Physiol. 2012, 160, 433–449. [Google Scholar] [CrossRef]
  30. Moon, J.; Lee, H.; Kim, M.; Lee, I. Analysis of flowering pathway integrators in Arabidopsis. Plant Cell Physiol. 2005, 46, 292–299. [Google Scholar] [CrossRef]
  31. Tapia-López, R.; García-Ponce, B.; Dubrovsky, J.G.; Garay-Arroyo, A.; Pérez-Ruíz, R.V.; Kim, S.-H.; Acevedo, F.; Pelaz, S.; Alvarez-Buylla, E.R. An AGAMOUS-Related MADS-Box. Gene, XAL1 (AGL12), Regulates Root Meristem Cell Proliferation and Flowering Transition in Arabidopsis. Plant Physiol. 2008, 146, 1182–1192. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, C.; Chen, H.; Er, H.L.; Soo, H.M.; Kumar, P.P.; Han, J.H.; Liou, Y.C.; Yu, H. Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development 2008, 135, 1481–1491. [Google Scholar] [CrossRef] [PubMed]
  33. Jang, S.; Torti, S.; Coupland, G. Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis. Plant J. 2009, 60, 614–625. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, X.; Shi, X.; Zhang, R.; Zhang, K.; Shao, L.; Xu, T.; Li, D.; Zhang, D.; Zhang, J.; Xia, Y. Impact of summer heat stress inducing physiological and biochemical responses in herbaceous peony cultivars (Paeonia lactiflora Pall.) from different latitudes. Ind. Crop Prod. 2022, 184, 115000. [Google Scholar] [CrossRef]
  35. Zhang, R.; Wang, X.; Shi, X.; Shao, L.; Xu, T.; Xia, Y.; Li, D.; Zhang, J. Chilling Requirement Validation and Physiological and Molecular Responses of the Bud Endodormancy Release in Paeonia lactiflora ‘Meiju’. Int. J. Mol. Sci. 2021, 22, 8382. [Google Scholar] [CrossRef]
  36. Wang, X.; Zhang, R.; Huang, Q.; Shi, X.; Li, D.; Shao, L.; Xu, T.; Horvath, D.P.; Xia, Y.; Zhang, J. Comparative Study on Physiological Responses and Gene Expression of Bud Endodormancy Release Between Two Herbaceous Peony Cultivars (Paeonia lactiflora Pall.) with Contrasting Chilling Requirements. Front. Plant Sci. 2021, 12, 772285. [Google Scholar] [CrossRef]
  37. Wang, X.; Li, D.; Zhang, D.; Shi, X.; Wu, Y.; Qi, Z.; Ding, H.; Zhu, K.; Xia, Y.; Zhang, J. Improving crucial details and selecting the optimal model for evaluating the chilling requirement of Paeonia lactiflora Pall. at low latitudes during four winters. Sci. Hortic. 2020, 265, 109175. [Google Scholar] [CrossRef]
  38. Wang, X.; Zhang, R.; Zhang, K.; Shao, L.; Xu, T.; Shi, X.; Li, D.; Zhang, J.; Xia, Y. Development of a Multi-Criteria Decision-Making Approach for Evaluating the Comprehensive Application of Herbaceous Peony at Low Latitudes. Int. J. Mol. Sci. 2022, 23, 14342. [Google Scholar] [CrossRef]
  39. Zhao, Y.; Liu, C.; Sui, J.; Liang, J.; Ge, J.; Li, J.; Pan, W.; Yi, M.; Du, Y.; Wu, J. A wake-up call: Signaling in regulating ornamental geophytes dormancy. Ornam. Plant Res. 2022, 2, 8. [Google Scholar] [CrossRef]
  40. Zhang, J.; Wu, Y.; Li, D.; Wang, G.; Li, X.; Xia, Y. Transcriptomic analysis of the underground renewal buds during dormancy transition and release in ‘Hangbaishao’ peony (Paeonia lactiflora). PLoS ONE 2015, 10, e0119118. [Google Scholar] [CrossRef]
  41. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  42. Won, S.Y.; Jung, J.A.; Kim, J.S. Genome-wide analysis of the MADS-Box. gene family in Chrysanthemum. Comput. Biol. Chem. 2021, 90, 107424. [Google Scholar] [CrossRef] [PubMed]
  43. Arora, R.; Agarwal, P.; Ray, S.; Singh, A.K.; Singh, V.P.; Tyagi, A.K.; Kapoor, S. MADS-box gene family in rice: Genome-wide identification, organization and expression profiling during reproductive development and stress. BMC Genom. 2007, 8, 242. [Google Scholar] [CrossRef]
  44. Hou, H.; Tian, M.; Liu, N.; Huo, J.; Sui, S.; Li, Z. Genome-wide analysis of MIKCC-type MADS-box genes and roles of CpFUL/SEP/AGL6 superclade in dormancy breaking and bud formation of Chimonanthus praecox. Plant Physiol. Biochem. 2023, 196, 893–902. [Google Scholar] [CrossRef] [PubMed]
  45. Gramzow, L.; Theißen, G. Phylogenomics reveals surprising sets of essential and dispensable clades of MIKC(c)-group MADS-box genes in flowering plants. J. Exp. Zool. B Mol. Dev. Evol. 2015, 324, 353–362. [Google Scholar] [CrossRef]
  46. Yuan, J.; Jiang, S.; Jian, J.; Liu, M.; Yue, Z.; Xu, J.; Li, J.; Xu, C.; Lin, L.; Jing, Y.; et al. Genomic basis of the giga-chromosomes and giga-genome of tree peony Paeonia ostii. Nat. Commun. 2022, 13, 7328. [Google Scholar] [CrossRef]
  47. Yang, X.; Guo, Q.; Liu, S.; Wang, D.; Zuo, D.; Niu, T.; Wei, D.; Guo, L.; Hou, X. Genome-wide characterization of the MADS-box gene family in Paeonia ostii and expression analysis of genes related to floral organ development. BMC Genom. 2025, 26, 49. [Google Scholar] [CrossRef]
  48. Li, Y.; Lu, J.; Chang, Y.; Tang, W.; Yang, Q. Comparative analysis of tree peony petal development by transcriptome sequencing. Acta Physiol. Plant 2017, 39, 216. [Google Scholar] [CrossRef]
  49. Wenlong, T.; Pengfei, Z.; Yonghua, L.I.; Dan, H.E.; Jiuxing, L.U. Cloning and Expression Analysis of Transcription Factor Gene PsAGL6 in Tree Peony (Paeonia suffruticosa L.). Acta Bot. Boreali-Occident. Sin. 2018, 38, 439–444. [Google Scholar]
  50. Lu, J.; Zheng, Y.; Wang, H.; Wang, Z.; Li, Y.; Gao, G.; Li, Y. Cloning and Expression Analysis of PsPI Gene in Tree Peony (Paeonia suffruticosa). J. Plant Physiol. 2019. [Google Scholar] [CrossRef]
  51. Melzer, S.; Lens, F.; Gennen, J.; Vanneste, S.; Rohde, A.; Beeckman, T. Flowering-time genes modulate meristem determinacy and growth form in Arabidopsis thaliana. Nat. Genet. 2008, 40, 1489–1492. [Google Scholar] [CrossRef] [PubMed]
  52. Adamczyk, B.J.; Fernandez, D.E. MIKC* MADS Domain Heterodimers Are Required for Pollen Maturation and Tube Growth in Arabidopsis. Plant Physiol. 2009, 149, 1713–1723. [Google Scholar] [CrossRef]
  53. Zhang, Y.; Li, Y.; Zhang, Y.; Guan, S.; Liu, C.; Zheng, G.; Gai, S. Isolation and Characterization of a SOC1-Like Gene from Tree Peony (Paeonia suffruticosa). Plant Mol. Biol. Rep. 2014, 33, 855–866. [Google Scholar] [CrossRef]
  54. Hou, D.; Li, L.; Ma, T.; Pei, J.; Zhao, Z.; Lu, M.; Wu, A.; Lin, X. The SOC1-like gene BoMADS50 is associated with the flowering of Bambusa oldhamii. Hortic. Res. 2021, 8, 133. [Google Scholar] [CrossRef]
  55. Kitamura, Y.; Takeuchi, T.; Yamane, H.; Tao, R. Simultaneous down-regulation of DORMANCY-ASSOCIATED MADS-box6 and SOC1 during dormancy release in Japanese apricot (Prunus mume) flower buds. J. Hortic. Sci. Biotech. 2016, 91, 476–482. [Google Scholar] [CrossRef]
  56. Gómez-Soto, D.; Ramos-Sánchez, J.M.; Alique, D.; Conde, D.; Triozzi, P.M.; Perales, M.; Allona, I. Overexpression of a SOC1-Related Gene Promotes Bud Break in Ecodormant Poplars. Front. Plant Sci. 2021, 12, 670497. [Google Scholar] [CrossRef] [PubMed]
  57. Trainin, T.; Bar-Ya’akov, I.; Holland, D. ParSOC1, a MADS-box gene closely related to Arabidopsis AGL20/SOC1, is expressed in apricot leaves in a diurnal manner and is linked with chilling requirements for dormancy break. Tree Genet. Genomes 2013, 9, 753–766. [Google Scholar] [CrossRef]
  58. Zhang, J.; Li, D.; Shi, X.; Zhang, D.; Qiu, S.; Wei, J.; Zhang, J.; Zhou, J.; Zhu, K.; Xia, Y. Mining and expression analysis of candidate genes involved in regulating the chilling requirement fulfillment of Paeonia lactiflora ‘Hang Baishao’. BMC Plant Biol. 2017, 17, 262. [Google Scholar] [CrossRef]
  59. Zhang, K.; Wang, X.; Chen, X.; Zhang, R.; Guo, J.; Wang, Q.; Li, D.; Shao, L.; Shi, X.; Han, J.; et al. Establishment of a Homologous Silencing System with Intact-Plant Infiltration and Minimized Operation for Studying Gene Function in Herbaceous Peonies. Int. J. Mol. Sci. 2024, 25, 4412. [Google Scholar] [CrossRef]
  60. Finn, R.D.; Clements, J.; Eddy, S.R. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, W29–W37. [Google Scholar] [CrossRef]
  61. Falavigna, V.D.S.; Guitton, B.; Costes, E.; Andres, F. I Want to (Bud) Break Free: The Potential Role of DAM and SVP-Like Genes in Regulating Dormancy Cycle in Temperate Fruit Trees. Front. Plant Sci. 2018, 9, 1990. [Google Scholar] [CrossRef] [PubMed]
  62. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  63. Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef] [PubMed]
  64. Nicholas, K.B.; Nicholas, H.B. GeneDoc: A Tool for Editing and Annotating Multiple Sequence Alignments. 1997. Available online: https://api.semanticscholar.org/CorpusID:81058551 (accessed on 3 January 2025).
  65. Chou, K.C.; Shen, H.B. Plant-mPLoc: A top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 2010, 5, e11335. [Google Scholar] [CrossRef]
  66. Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.H.; Song, J.S.; Thanki, N.; Yamashita, R.A.; et al. The conserved domain database in 2023. Nucleic Acids Res. 2023, 51, D384–D388. [Google Scholar] [CrossRef]
  67. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  68. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
  69. Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 2023, 51, D638–D646. [Google Scholar] [CrossRef]
  70. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆C(T) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Plants 14 00928 g001
Figure 1. Phylogenetic analysis of PlMIKC proteins and homologs from other plants. The phylogenetic tree was generated by the MEGA v7.0.21 [41] using the maximum likelihood method with 1000 bootstrap replications. Arabidopsis thaliana (At), Vitis vinifera (VIT), Populus trichocarpa (Potri.), Amborella trichopoda (scaffold), Oryza sativa (LOC_Os), Actinidia chinensis (Actinidia), and Prunus persica (Prupe.). Different subfamilies are distinguished by different background colors and the PlMIKCC proteins were marked with red colors.
Figure 1. Phylogenetic analysis of PlMIKC proteins and homologs from other plants. The phylogenetic tree was generated by the MEGA v7.0.21 [41] using the maximum likelihood method with 1000 bootstrap replications. Arabidopsis thaliana (At), Vitis vinifera (VIT), Populus trichocarpa (Potri.), Amborella trichopoda (scaffold), Oryza sativa (LOC_Os), Actinidia chinensis (Actinidia), and Prunus persica (Prupe.). Different subfamilies are distinguished by different background colors and the PlMIKCC proteins were marked with red colors.
Plants 14 00928 g001
Plants 14 00928 g002
Figure 2. Multiple sequence alignment of key PlMIKC proteins. The MADS and K-domains are indicated with red lines. Background colors denote sequence homology: blue for 100%, dark gray for >75%, and light gray for >50%, respectively.
Figure 2. Multiple sequence alignment of key PlMIKC proteins. The MADS and K-domains are indicated with red lines. Background colors denote sequence homology: blue for 100%, dark gray for >75%, and light gray for >50%, respectively.
Plants 14 00928 g002
Plants 14 00928 g003
Figure 3. The phylogenetic tree, protein structure, and conserved motifs of the 19 PlMIKC proteins. (A) Phylogenetic tree and protein structure. (B) Conserved motif. (C) Amino acid sequence of the six motifs.
Figure 3. The phylogenetic tree, protein structure, and conserved motifs of the 19 PlMIKC proteins. (A) Phylogenetic tree and protein structure. (B) Conserved motif. (C) Amino acid sequence of the six motifs.
Plants 14 00928 g003
Plants 14 00928 g004
Figure 4. Low temperature induces BDT in herbaceous peony. (A) The status of rhizomes after 0–5 weeks of controlled low-temperature treatment. Bar: 1 cm. (B) Observations of days to first plant sprouting and plant height of ‘Hang Baishao’ rhizomes which were treated with low temperature exposure for 0–5 weeks and then transferred to greenhouse for 30 days. Endo, endodormancy; Eco, ecodormancy. Data are presented as mean ± SD and Error bars represent SDs. One-way analysis of variance (ANOVA) was used to compare the differences and different letters indicate significant differences (p < 0.05).
Figure 4. Low temperature induces BDT in herbaceous peony. (A) The status of rhizomes after 0–5 weeks of controlled low-temperature treatment. Bar: 1 cm. (B) Observations of days to first plant sprouting and plant height of ‘Hang Baishao’ rhizomes which were treated with low temperature exposure for 0–5 weeks and then transferred to greenhouse for 30 days. Endo, endodormancy; Eco, ecodormancy. Data are presented as mean ± SD and Error bars represent SDs. One-way analysis of variance (ANOVA) was used to compare the differences and different letters indicate significant differences (p < 0.05).
Plants 14 00928 g004
Plants 14 00928 g005
Figure 5. Expression pattern of PlMIKC genes during BDT of herbaceous peony and qRT-PCR analysis of PlAGL18-1 and PlSOC1. (A) Expression heatmap of PlMIKC genes during BDT. The numbers in the heatmap represent relative expression FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values. The red arrow and box highlight the significant upregulation of PlSOC1 during the BDT of herbaceous peony. (B) qRT-PCR analysis of PlAGL18-1 and PlSOC1. Endo, endodormancy; Eco, ecodormancy. ** p < 0.01.
Figure 5. Expression pattern of PlMIKC genes during BDT of herbaceous peony and qRT-PCR analysis of PlAGL18-1 and PlSOC1. (A) Expression heatmap of PlMIKC genes during BDT. The numbers in the heatmap represent relative expression FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values. The red arrow and box highlight the significant upregulation of PlSOC1 during the BDT of herbaceous peony. (B) qRT-PCR analysis of PlAGL18-1 and PlSOC1. Endo, endodormancy; Eco, ecodormancy. ** p < 0.01.
Plants 14 00928 g005
Plants 14 00928 g006
Figure 6. The protein–protein interaction network of Arabidopsis MIKC proteins. All interactions are experimentally determined, with line thickness indicating the strength of data support.
Figure 6. The protein–protein interaction network of Arabidopsis MIKC proteins. All interactions are experimentally determined, with line thickness indicating the strength of data support.
Plants 14 00928 g006
Plants 14 00928 g007
Figure 7. Overexpression of PlSOC1 promotes dormancy transition and bud break in herbaceous peony. (A) YFP-tagged overexpression vector used in this study. (B) YFP fluorescence detection and phenotype of transformed plants. (C) The expression level of PlSOC1 and observations of bud break percentage and bud length in PlSOC1-overexpressing lines and empty vector-transformed lines. EV, empty vector. Significant differences from the control were determined by Student’s t-test (** p < 0.01).
Figure 7. Overexpression of PlSOC1 promotes dormancy transition and bud break in herbaceous peony. (A) YFP-tagged overexpression vector used in this study. (B) YFP fluorescence detection and phenotype of transformed plants. (C) The expression level of PlSOC1 and observations of bud break percentage and bud length in PlSOC1-overexpressing lines and empty vector-transformed lines. EV, empty vector. Significant differences from the control were determined by Student’s t-test (** p < 0.01).
Plants 14 00928 g007
Plants 14 00928 g008
Figure 8. Flowers, seed pod, and one-year-old rhizomes of plant material Paeonia lactiflora Pall. ‘Hang Baishao’. The flowers of ‘Hang Baishao’ display a range of colors, with pink (A) and red-purple (B) being the most prevalent. One-year-old rhizomes (C) offer the advantages of being easier to obtain, smaller in size (D), and more suitable for Agrobacterium immersion (E) and infection (F).
Figure 8. Flowers, seed pod, and one-year-old rhizomes of plant material Paeonia lactiflora Pall. ‘Hang Baishao’. The flowers of ‘Hang Baishao’ display a range of colors, with pink (A) and red-purple (B) being the most prevalent. One-year-old rhizomes (C) offer the advantages of being easier to obtain, smaller in size (D), and more suitable for Agrobacterium immersion (E) and infection (F).
Plants 14 00928 g008
Table 1. Detailed information on the 19 MIKC-type genes identified from herbaceous peony.
Table 1. Detailed information on the 19 MIKC-type genes identified from herbaceous peony.
Gene NameGene IDAmino AcidMolecular
Weight		PIInstability
Index		GRAVYSubcellular
Location
PlDAM-2CL2631.Contig1_All22826,050.666.9259.02−0.734Nucleus
PlDAM-3CL2631.Contig2_All18421,467.829.2659.32−0.723Nucleus
PlDAM-6CL2631.Contig3_All22325,533.086.9259.25−0.749Nucleus
PlAGL12CL5197.Contig3_All20023,194.027.0247.74−0.408Nucleus
PlAGL18CL6471.Contig2_All25228,738.646.0454.01−0.762Nucleus
PlAGL30-1F02_cb5982_c0/f1p0/186521124,086.839.8238.24−0.559Nucleus
PlAGL30-2F02_cb5982_c1/f1p0/197635139,547.656.1249.89−0.663Nucleus
PlDAM-4F02_cb7706_c1/f1p0/155922826,050.666.9259.02−0.734Nucleus
PlFUL-1F03_cb13331_c0/f2p0/133126230,262.349.5558.59−0.929Nucleus
PlFUL-2F03_cb6642_c0/f2p0/113512714,302.8810.0140.170.035Nucleus
PlDAM-1F03_cb7864_c0/f3p1/144522325,533.086.9259.25−0.749Nucleus
PlDAM-5F03_cb9970_c0/f3p1/144722826,050.666.9259.02−0.734Nucleus
PlFUL-3F04_cb14472_c0/f3p0/109525229,265.898.6856.03−1.028Nucleus
PlAGUnigene17023_All16819,064.7110.1747.30−0.702Nucleus
PlPI-2Unigene18796_All26530,655.269.3537.83−0.609Nucleus
PlFUL-4Unigene18852_All24228,053.558.3856.58−0.992Nucleus
PlSOC1Unigene22847_All22425,382.855.6554.89−0.637Nucleus
PlAGL18-2Unigene23635_All18821,515.765.8658.56−0.422Nucleus
PlPI-1Unigene26195_All18521,385.226.1055.92−0.764Nucleus
Note: PI, isoelectric point; GRAVY, grand average of hydropathy.
Table 2. Primer sequences used for generating p35S::PlSOC1 construct in this study.
Table 2. Primer sequences used for generating p35S::PlSOC1 construct in this study.
Primer NamesPrimer Sequences (5′-3′)
p35S::PlSOC1_FCTTGGATCCTCGAGCTGCAGGAAGCTCAATCAGTTTCATCCCAA
p35S::PlSOC1_RCCCTTGCTCACCATACTAGTGTTCTGTAATATAATGCGTTTAATTCTGC
Table 3. Primer sequences used for qRT–PCR in this study.
Table 3. Primer sequences used for qRT–PCR in this study.
Primer NamesPrimer Sequences (5′-3′)
PlATUBA_FGACGTGGGCTCGATCTGAAT
PlATUBA_RATCCCTTGCCTGAGCATCAC
PlSOC1_FATGCGCGAGACAATTGAACG
PlSOC1_RTCAACGGTGCATGATCCCAA
PlAGL18-1_FCGCTGCGCAAGCAGATTAAG
PlAGL18-1_RTAAGGCTCAGAAGGCAACCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huang, Q.; Chen, X.; Zhong, S.; Wu, S.; Guo, J.; Wang, Q.; Li, J.; Li, D.; Xia, Y.; Zhang, J.; et al. MIKC-Type MADS-Box Gene Analysis Reveals the Role of PlSOC1 in Bud Dormancy Transition in Herbaceous Peony. Plants 2025, 14, 928. https://doi.org/10.3390/plants14060928

AMA Style

Huang Q, Chen X, Zhong S, Wu S, Guo J, Wang Q, Li J, Li D, Xia Y, Zhang J, et al. MIKC-Type MADS-Box Gene Analysis Reveals the Role of PlSOC1 in Bud Dormancy Transition in Herbaceous Peony. Plants. 2025; 14(6):928. https://doi.org/10.3390/plants14060928

Chicago/Turabian Style

Huang, Qiaoyu, Xiaoxuan Chen, Shuyun Zhong, Shuangzhe Wu, Junhong Guo, Qiyao Wang, Jiahe Li, Danqing Li, Yiping Xia, Jiaping Zhang, and et al. 2025. "MIKC-Type MADS-Box Gene Analysis Reveals the Role of PlSOC1 in Bud Dormancy Transition in Herbaceous Peony" Plants 14, no. 6: 928. https://doi.org/10.3390/plants14060928

APA Style

Huang, Q., Chen, X., Zhong, S., Wu, S., Guo, J., Wang, Q., Li, J., Li, D., Xia, Y., Zhang, J., & Wang, X. (2025). MIKC-Type MADS-Box Gene Analysis Reveals the Role of PlSOC1 in Bud Dormancy Transition in Herbaceous Peony. Plants, 14(6), 928. https://doi.org/10.3390/plants14060928

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop