Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.)
Abstract
:1. Introduction
2. Results
2.1. The yl1 Plants Exhibit Premature Leaf Senescence
2.2. Alterations of Leaf Senescence Related Parameters
2.3. The Premature Leaf Senescence of yl1 is Controlled by a Single Recessive Gene
2.4. Preliminary Mapping of YL1
2.5. Plant Hormone Treatments
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Genetic Populations
4.2. Sampling for Measurement of Leaf Senescence Related Physiological Parameters and RNA Extraction
4.3. Measurement of Leaf Senescence Related Physiological Parameters
4.4. RNA Extraction and qRT-PCR
4.5. DNA Extraction and SSR Analysis
4.6. Linkage Map and Genetic Distance
4.7. Plant Hormone Treatments
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Masclaux, C.; Valadier, M.H.; Brugière, N.; Morot-Gaudry, J.F.; Hirel, B. Characterization of the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. Planta 2000, 211, 510–518. [Google Scholar] [CrossRef]
- Edwards, K.D.; Bombarely, A.; Story, G.W.; Allen, F.; Mueller, L.A.; Coates, S.A.; Jones, L. TobEA: An atlas of tobacco gene expression from seed to senescence. BMC Genom. 2010, 11, 142. [Google Scholar] [CrossRef]
- Arntzen, C.J. Using tobacco to treat cancer. Science 2008, 321, 1052–1053. [Google Scholar] [CrossRef]
- Monreal-Escalante, E.; Ramos-Vega, A.A.; Salazar-Gonzalez, J.A.; Banuelos-Hernandez, B.; Angulo, C.; Rosales-Mendoza, S. Expression of the VP40 antigen from the Zaire ebolavirus in tobacco plants. Planta 2017, 246, 123–132. [Google Scholar] [CrossRef]
- Budzianowski, J. Tobacco against Ebola virus disease. Przegl. Lek. 2015, 72, 567–571. [Google Scholar]
- Vanhercke, T.; El Tahchy, A.; Liu, Q.; Zhou, X.R.; Shrestha, P.; Divi, U.K.; Ral, J.P.; Mansour, M.P.; Nichols, P.D.; James, C.N.; et al. Metabolic engineering of biomass for high energy density: Oilseed-like triacylglycerol yields from plant leaves. Plant Biotechnol. J. 2014, 12, 231–239. [Google Scholar] [CrossRef]
- Fuchs, J.; Neuberger, T.; Rolletschek, H.; Schiebold, S.; Nguyen, T.H.; Borisjuk, N.; Borner, A.; Melkus, G.; Jakob, P.; Borisjuk, L. A noninvasive platform for imaging and quantifying oil storage in submillimeter tobacco seed. Plant Physiol. 2013, 161, 583–593. [Google Scholar] [CrossRef]
- Andrianov, V.; Borisjuk, N.; Pogrebnyak, N.; Brinker, A.; Dixon, J.; Spitsin, S.; Flynn, J.; Matyszczuk, P.; Andryszak, K.; Laurelli, M.; et al. Tobacco as a production platform for biofuel: Overexpression of Arabidopsis DGAT and LEC2 genes increases accumulation and shifts the composition of lipids in green biomass. Plant Biotechnol. J. 2010, 8, 277–287. [Google Scholar] [CrossRef]
- Li, W.; Zhang, H.L.; Li, X.X.; Zhang, F.X.; Liu, C.; Du, Y.M.; Gao, X.M.; Zhang, Z.L.; Zhang, X.B.; Hou, Z.H.; et al. Intergrative metabolomic and transcriptomic analyses unveil nutrient remobilization events in leaf senescence of tobacco. Sci. Rep. 2017, 7, 12126. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.Y.; Li, L.L.; Zhao, Y.N.; Zhao, C.X.; Chen, X.; Liu, P.P.; Zhou, H.N.; Zhang, J.J.; Hu, C.X.; Chen, A.G.; et al. Metabolic changes in primary, secondary, and lipid metabolism in tobacco leaf in response to topping. Anal. Bioanal. Chem. 2018, 410, 839–851. [Google Scholar] [CrossRef]
- Zhao, Z.; Li, Y.F.; Zhao, S.C.; Zhang, J.W.; Zhang, H.; Fu, B.; He, F.; Zhao, M.Q.; Liu, P.F. Transcriptome Analysis of Gene Expression Patterns Potentially Associated with Premature Senescence in Nicotiana tabacum L. Molecules 2018, 23, 2856. [Google Scholar] [CrossRef] [PubMed]
- Li, L.L.; Zhao, J.Y.; Zhao, Y.N.; Lu, X.; Zhou, Z.H.; Zhao, C.X.; Xu, G.W. Comprehensive investigation of tobacco leaves during natural early senescence via multi-platform metabolomics analyses. Sci. Rep. 2016, 6, 37976. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.O.; Kim, H.J.; Gil Nam, H. Leaf Senescence. Annu. Rev. Plant Biol. 2007, 58, 115–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schippers, J.H. Transcriptional networks in leaf senescence. Curr. Opin. Plant Biol. 2015, 27, 77–83. [Google Scholar] [CrossRef] [PubMed]
- Gan, S.S.; Amasino, R.M. Making Sense of Senescence (Molecular Genetic Regulation and Manipulation of Leaf Senescence). Plant Physiol. 1997, 113, 313–319. [Google Scholar] [CrossRef] [Green Version]
- Quirino, B.F.; Noh, Y.S.; Himelblau, E.; Amasino, R.M. Molecular aspects of leaf senescence. Trends Plant Sci. 2000, 5, 278–282. [Google Scholar] [CrossRef]
- Ali, A.; Gao, X.M.; Guo, Y.F. Initiation, Progression, and Genetic Manipulation of Leaf Senescence. Methods Mol. Biol. 2018, 1744, 9–31. [Google Scholar]
- Guo, Y.; Cai, Z.; Gan, S. Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ. 2004, 27, 521–549. [Google Scholar] [CrossRef]
- Jibran, R.; Hunter, D.A.; Dijkwel, P.P. Hormonal regulation of leaf senescence through integration of developmental and stress signals. Plant Mol. Boil. 2013, 82, 547–561. [Google Scholar] [CrossRef]
- Yolcu, S.; Li, X.; Li, S.; Kim, Y.J. Beyond the genetic code in leaf senescence. J. Exp. Bot. 2018, 69, 801–810. [Google Scholar] [CrossRef]
- Wingler, A.; Masclaux-Daubresse, C.; Fischer, A.M. Sugars, senescence, and ageing in plants and heterotrophic organisms. J. Exp. Bot. 2009, 60, 1063–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, Y.F.; Gan, S.S. Translational researches on leaf senescence for enhancing plant productivity and quality. J. Exp. Bot. 2014, 65, 3901–3913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gregersen, P.L.; Culetic, A.; Boschian, L.; Krupinska, K. Plant senescence and crop productivity. Plant Mol. Biol. 2013, 82, 603–622. [Google Scholar] [CrossRef] [PubMed]
- Hortensteiner, S.; Krautler, B. Chlorophyll breakdown in higher plants. Biochim. Biophys. Acta 2011, 1807, 977–988. [Google Scholar] [CrossRef] [Green Version]
- Breeze, E.; Harrison, E.; McHattie, S.; Hughes, L.; Hickman, R.; Hill, C.; Kiddle, S.; Kim, Y.S.; Penfold, C.A.; Jenkins, D.; et al. High-Resolution Temporal Profiling of Transcripts during Arabidopsis Leaf Senescence Reveals a Distinct Chronology of Processes and Regulation. Plant. Cell 2011, 23, 873–894. [Google Scholar] [CrossRef]
- Thomas, H.; Stoddart, J.L. Leaf senescence. Annu. Rev. Plant Physiol. 1980, 31, 83–111. [Google Scholar] [CrossRef]
- Noh, Y.S.; Amasino, R.M. Identification of a promoter region responsible for the senescence-specific expression of SAG12. Plant Mol. Biol. 1999, 41, 181–194. [Google Scholar] [CrossRef]
- Jan, S.; Abbas, N.; Ashraf, M.; Ahmad, P. Roles of potential plant hormones and transcription factors in controlling leaf senescence and drought tolerance. Protoplasma 2019, 256, 313–329. [Google Scholar] [CrossRef]
- Khan, M.; Rozhon, W.; Poppenberger, B. The role of hormones in the aging of plants—A mini-review. Gerontology 2014, 60, 49–55. [Google Scholar] [CrossRef]
- Bindler, G.; Plieske, J.; Bakaher, N.; Gunduz, I.; Ivanov, N.; van der Hoeven, R.; Ganal, M.; Donini, P. A high density genetic map of tobacco (Nicotiana tabacum L.) obtained from large scale microsatellite marker development. Theor. Appl. Genet. 2011, 123, 219–230. [Google Scholar] [CrossRef]
- Bindler, G.; van der Hoeven, R.; Gunduz, I.; Plieske, J.; Ganal, M.; Rossi, L.; Gadani, F.; Donini, P. A microsatellite marker based linkage map of tobacco. Theor. Appl. Genet. 2007, 114, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Tong, Z.J.; Yang, Z.M.; Chen, X.J.; Jiao, F.C.; Li, X.Y.; Wu, X.F.; Gao, Y.L.; Xiao, B.G.; Wu, W.W. Large-scale development of microsatellite markers in nicotiana tabacum and construction of a genetic map of flue-cured tobacco. Plant Breed. 2012, 131, 674–680. [Google Scholar] [CrossRef]
- Lan, T.; Zheng, S.F.; Yang, L.; Wu, S.X.; Wang, B.; Zhang, S.J.; Tong, Z.J.; Chen, Y.Z.; Chen, S.H.; Duan, Y.L.; et al. Mapping of quantitative trait loci conferring resistance to bacterial wilt in tobacco (Nicotiana tabacum L.). Plant Breed. 2014, 133, 672–677. [Google Scholar] [CrossRef]
- Sun, M.M.; Cheng, L.R.; Jiang, C.H.; Zhu, C.G.; Ren, M.; Zhang, Y.S.; Zhang, Y.; Liu, D.; Zhao, Q.; Geng, R.M.; et al. Identification of a major QTL affecting resistance to brown spot in tobacco (Nicotiana tabacum L.) via linkage and association mapping methods. Euphytica 2018, 214, 195–208. [Google Scholar] [CrossRef]
- Tong, Z.J.; Jiao, T.L.; Wang, F.Q.; Li, M.Y.; Leng, X.D.; Gao, Y.L.; Li, Y.P.; Xiao, B.G.; Wu, W.R. Mapping of quantitative trait loci conferring resistance to brown spot in flue-cured tobacco (Nicotiana tabacum L.). Plant Breed. 2012, 131, 335–339. [Google Scholar] [CrossRef]
- Vontimitta, V.; Lewis, R.S. Mapping of quantitative trait loci affecting resistance to Phytophthora nicotianae in tobacco (Nicotiana tabacum L.) line Beinhart-1000. Mol. Breed. 2012, 29, 89–98. [Google Scholar] [CrossRef]
- Cheng, L.R.; Yang, A.G.; Jiang, C.H.; Ren, M.; Zhang, Y.; Feng, Q.F.; Wang, S.M.; Guan, Y.S.; Luo, C. Quantitative trait loci mapping for plant height in tobacco using linkage and association mapping methods. Crop. Sci. 2015, 55, 641–647. [Google Scholar] [CrossRef]
- Kalivas, A.; Ganopoulos, I.; Bosmali, I.; Tsaliki, E.; Osathanunkul, M.; Xanthopoulou, A.; Moysiadis, T.; Avramidou, E.; Grigoriadis, I.; Zambounis, A.; et al. Genetic diversity and structure of tobacco in greece on the basis of morphological and microsatellite markers. Crop. Sci. 2016, 56, 2652–2662. [Google Scholar] [CrossRef]
- Tong, Z.J.; Xiao, B.G.; Chen, X.J.; Fang, D.H.; Zhang, Y.H.; Huang, C.J.; Li, Y.P. Construction of a genetic linkage map of cigar tobacco (Nicotiana tabacum L.) based on SSR markers and comparative studies. Czech. J. Genet. Plant Breed. 2018, 54, 115–122. [Google Scholar]
- Thompson, J.E.; Froese, C.D.; Madey, E.; Smith, M.D.; Hong, Y. Lipid metabolism during plant senescence. Prog. Lipid Res. 1998, 37, 119–141. [Google Scholar] [CrossRef]
- Tanaka, A.; Tanaka, R. Chlorophyll metabolism. Curr. Opin. Plant Biol. 2006, 9, 248–255. [Google Scholar] [CrossRef] [PubMed]
- Leitch, I.J.; Hanson, L.; Lim, K.Y.; Kovarik, A.; Chase, M.W.; Clarkson, J.J.; Leitch, A.R. The ups and downs of genome size evolution in polyploid species of Nicotiana (Solanaceae). Ann. Bot. 2008, 101, 805–814. [Google Scholar] [CrossRef] [PubMed]
- Renny-Byfield, S.; Chester, M.; Kovarik, A.; Le Comber, S.C.; Grandbastien, M.A.; Deloger, M.; Nichols, R.A.; Macas, J.; Novak, P.; Chase, M.W.; et al. Next generation sequencing reveals genome downsizing in allotetraploid Nicotiana tabacum, predominantly through the elimination of paternally derived repetitive DNAs. Mol. Biol. Evol. 2011, 28, 2843–2854. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.Z.; Wu, X.R.; Zhang, X.F.; Jiang, C.H.; Xiao, B.G.; Zhang, Y.Y.; Wang, Y.Y.; Liu, G.S. Mapping of two white stem genes in tetraploid common tobacco (Nicotiana tabacum L.). Mol. Breed. 2014, 34, 1065–1074. [Google Scholar] [CrossRef]
- Michel, V.; Julio, E.; Candresse, T.; Cotucheau, J.; Decorps, C.; Volpatti, R.; Moury, B.; Glais, L.; Dorlhac de Borne, F.; Decroocq, V.; et al. NtTPN1: A RPP8-like R gene required for Potato virus Y-induced veinal necrosis in tobacco. Plant J. 2018, 95, 700–714. [Google Scholar] [CrossRef]
- Bao, Y.G.; Ding, N.; Qin, Q.L.; Wu, X.; Martinez, N.; Miller, R.; Zaitlin, D.; Li, D.D.; Yang, S.M. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. Mol. Breed. 2019, 39, 122–131. [Google Scholar] [CrossRef]
- Wang, X.W.; Yang, S.; Chen, Y.D.; Zhang, S.M.; Zhao, Q.S.; Li, M.; Gao, Y.L.; Yang, L.; Bennetzen, J.L. Comparative genome-wide characterization leading to simple sequence repeat marker development for Nicotiana. BMC Genom. 2018, 19, 500. [Google Scholar] [CrossRef]
- Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet. 2011, 12, 499–510. [Google Scholar] [CrossRef]
- Xiao, B.G.; Tan, Y.T.; Long, N.; Chen, X.J.; Tong, Z.J.; Dong, Y.; Li, Y.P. SNP-based genetic linkage map of tobacco (Nicotiana tabacum L.) using next-generation RAD sequencing. J. Biol. Res. Thessalon. 2015, 22, 11. [Google Scholar] [CrossRef]
- Gong, D.P.; Huang, L.; Xu, X.H.; Wang, C.Y.; Ren, M.; Wang, C.K.; Chen, M.L. Construction of a high-density SNP genetic map in flue-cured tobacco based on SLAF-seq. Mol. Breed. 2016, 36, 100. [Google Scholar] [CrossRef]
- Thimmegowda, G.C.; Ramadoss, S.K.; Kaikala, V.; Rathinavelu, R. Whole genome resequencing of tobacco (Nicotiana tabacum L.) genotypes and high-throughput SNP discovery. Mol. Breed. 2018, 38, 121. [Google Scholar] [CrossRef]
- Cheng, L.R.; Chen, X.C.; Jiang, C.H.; Ma, B.; Ren, M.; Cheng, Y.Z.; Liu, D.; Geng, R.M.; Yang, A.G. High-density SNP genetic linkage map construction and quantitative trait locus mapping for resistance to cucumber mosaic virus in tobacco (Nicotiana tabacum L.). Crop. J. 2019, 7, 539–547. [Google Scholar] [CrossRef]
- Reinbothe, C.; Springer, A.; Samol, I.; Reinbothe, S. Plant oxylipins: Role of jasmonic acid during programmed cell death, defence and leaf senescence. FEBS J. 2009, 276, 4666–4681. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.R.; Jiang, Y.J.; Han, X.; Wang, H.P.; Pan, J.J.; Yu, D.Q. Jasmonate regulates leaf senescence and tolerance to cold stress: Crosstalk with other phytohormones. J. Exp. Bot. 2017, 68, 1361–1369. [Google Scholar] [CrossRef]
- Jiang, Y.J.; Liang, G.; Yang, S.Z.; Yu, D.Q. Arabidopsis wrky57 functions as a node of convergence for jasmonic acid- and auxin-mediated signaling in jasmonic acid-induced leaf senescence. Plant Cell 2014, 26, 230–245. [Google Scholar] [CrossRef]
- Xie, Y.; Huhn, K.; Brandt, R.; Potschin, M.; Bieker, S.; Straub, D.; Doll, J.; Drechsler, T.; Zentgraf, U.; Wenkel, S. REVOLUTA and WRKY53 connect early and late leaf development in Arabidopsis. Development 2014, 141, 4772–4783. [Google Scholar] [CrossRef]
- Wang, D.W.; Wang, S.M.; Chao, J.T.; Wu, X.R.; Sun, Y.H.; Li, F.X.; Lv, J.; Gao, X.M.; Liu, G.S.; Wang, Y.Y. Morphological phenotyping and genetic analyses of a new chemical-mutagenized population of tobacco (Nicotiana tabacum L.). Planta 2017, 246, 149–163. [Google Scholar] [CrossRef]
- He, Y.H.; Gan, S.S. A Gene Encoding an acyl hydrolase is involved in leaf senescence in Arabidopsis. Plant Cell 2002, 14, 805–815. [Google Scholar] [CrossRef]
- Edwards, K.D.; Fernandez-Pozo, N.; Drake-Stowe, K.; Humphry, M.; Evans, A.D.; Bombarely, A.; Allen, F.; Hurst, R.; White, B.; Kernodle, S.P.; et al. A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genom. 2017, 18, 448. [Google Scholar] [CrossRef]
- Bassam, B.J.; Caetano-Anolles, G.; Gresshoff, P.M. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 1991, 196, 80–83. [Google Scholar] [CrossRef]
- Li, H.H.; Ribaut, J.M.; Li, Z.L.; Wang, J.K. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 2008, 116, 243–260. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.L.; Guo, Y.F. Hormone treatments in studying leaf senescence. Methods Mol. Biol. 2018, 1744, 125–132. [Google Scholar] [PubMed]
Population Type | Cross | Total | Wild Type | Mutant Type | Segregation Ration | χ2 1 |
---|---|---|---|---|---|---|
F2 | HD × yl1 | 154 | 111 | 43 | 2.581 | 0.701 |
F2 | G3 × yl1 | 155 | 115 | 40 | 2.875 | 0.054 |
BC1F1 | (HD × yl1) × yl1 | 155 | 83 | 72 | 1.153 | 0.781 |
BC1F1 | (G3 × yl1) × yl1 | 163 | 77 | 86 | 0.895 | 0.497 |
Gene Name | Accession Number 1 | Forward Primer Sequence 1 | Reverse Primer Sequence 1 |
---|---|---|---|
Actin | Nitab4.5_0009320g0010.1 | CAAGGAAATCACGGCTTTGG | AAGGGATGCGAGGATGGA |
SAG12 | Nitab4.5_0001608g0070.1 | ATTTTCAGCGGTGGCAGCT | GTAAGAAGTCGTAGGCTCG |
RBCS | Nitab4.5_0006249g0010.1 | CCTGCTAAGGATACAATTAG | CTCAAATTTCTTGTTGTCA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, X.; Wu, X.; Liu, G.; Zhang, Z.; Chao, J.; Li, Z.; Guo, Y.; Sun, Y. Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.). Plants 2019, 8, 415. https://doi.org/10.3390/plants8100415
Gao X, Wu X, Liu G, Zhang Z, Chao J, Li Z, Guo Y, Sun Y. Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.). Plants. 2019; 8(10):415. https://doi.org/10.3390/plants8100415
Chicago/Turabian StyleGao, Xiaoming, Xinru Wu, Guanshan Liu, Zenglin Zhang, Jiangtao Chao, Zhiyuan Li, Yongfeng Guo, and Yuhe Sun. 2019. "Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.)" Plants 8, no. 10: 415. https://doi.org/10.3390/plants8100415