Next Article in Journal
Chloroplast Genome Sequence of Artemisia scoparia: Comparative Analyses and Screening of Mutational Hotspots
Next Article in Special Issue
Relationships between Iraqi Rice Varieties at the Nuclear and Plastid Genome Levels
Previous Article in Journal
Comparative Proteomics Reveals Cold Acclimation Machinery Through Enhanced Carbohydrate and Amino Acid Metabolism in Wucai (Brassica Campestris L.)
Previous Article in Special Issue
Rice Novel Semidwarfing Gene d60 Can Be as Effective as Green Revolution Gene sd1
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 8
Issue 11
10.3390/plants8110475
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Two SNP Mutations Turned off Seed Shattering in Rice

by
Yu Zhang
†,
Jiawu Zhou
†,
Ying Yang
†,
Walid Hassan Elgamal
‡,
Peng Xu
,
Jing Li
,
Yasser Z. El-Refaee
‡,
Suding Hao
and
Dayun Tao
*
Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences (YAAS), Kunming 650200, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
Present address: Rice Research Department, Field Crops Research Institute, Agricultural Research Center, 33717 Sakha, Kafr El-Sheikh, Egypt.
Plants 2019, 8(11), 475; https://doi.org/10.3390/plants8110475
Submission received: 29 August 2019 / Revised: 3 November 2019 / Accepted: 5 November 2019 / Published: 6 November 2019
(This article belongs to the Special Issue Genetics in Rice)
Browse Figures
Versions Notes

Abstract

:
Seed shattering is an important agronomic trait in rice domestication. In this study, using a near-isogenic line (NIL-hs1) from Oryza barthii, we found a hybrid seed shattering phenomenon between the NIL-hs1 and its recurrent parent, a japonica variety Yundao 1. The heterozygotes at hybrid shattering 1 (HS1) exhibited the shattering phenotype, whereas the homozygotes from both parents conferred the non-shattering. The causal HS1 gene for hybrid shattering was located in the region between SSR marker RM17604 and RM8220 on chromosome 4. Sequence verification indicated that HS1 was identical to SH4, and HS1 controlled the hybrid shattering due to harboring the ancestral haplotype, the G allele at G237T site and C allele at C760T site from each parent. Comparative analysis at SH4 showed that all the accessions containing ancestral haplotype, including 78 wild relatives of rice and 8 African cultivated rice, had the shattering phenotype, whereas all the accessions with either of the homozygous domestic haplotypes at one of the two sites, including 17 wild relatives of rice, 111 African cultivated rice and 65 Asian cultivated rice, showed the non-shattering phenotype. Dominant complementation of the G allele at G237T site and the C allele at C760T site in HS1 led to a hybrid shattering phenotype. These results help to shed light on the nature of seed shattering in rice during domestication and improve the moderate shattering varieties adapted to mechanized harvest.

1. Introduction

During rice domestication, seed shattering is one of the most greatly changed traits for seed dispersal. Easy shattering leads to the loss of production [1], and more attention is paid on selection for non-shattering but threshable rice in modern rice breeding [2]. Seed shattering is caused by the formation and degradation of the abscission zone (AZ), which, constituted by a band of small cells, is responsive to signals promoting abscission [3].
Recently, several genes responsible for seed shattering were identified in rice. qSH1 encodes a BELL homeobox protein. An SNP mutation in the regulatory region of qSH1 could inhibit its expression, which resulted in defective abscission layer development [4]. The allelic genes of SH4 [5], SHA1 [6] and GL4 [7] encoding a trihelix transcriptional factor, all controlled the seed shattering, however, haplotypes were divergent because of two different SNP mutations. A “G237T” mutation in SH4 and SHA1 was responsible for the loss of seed shattering in Asian cultivated rice [5,6], whereas “C760T” transition in GL4 conferred non-shattering seeds in African cultivated rice [7]. The SHAT1 gene, which encoded an APETALA2 transcription factor, was responsible for seed shattering through specifying abscission zone development in rice. The expression of SHAT1 was positively regulated by the transcription factor SH4, which was required for the AZ identification during the early spikelet developmental stage, and qSH1 functions downstream of SHAT1 and SH4, promoting the AZ differentiation by maintaining the expression of SHAT1 and SH4 [8]. SH5, which is highly homologous to qSH1, also controlled seed shattering by regulating lignin deposition in the pedicel region [9]. OsGRF4 could increase the expression of two cytokinin dehydrogenase precursor genes resulting in the high cytokinin level, which led to reduced seed shattering [10]. OSH15 together with SH5 induced seed shattering by repressing lignin biosynthesis genes [11]; ObSH3 in Oryza barthii encoded a YABBY transcription factor, which was also required for the development of the seed abscission layer [12]. In addition, some other minor genes and allelic interaction at major locus might be involved in the seed shattering domestication as rice underwent a prolonged domestication process, with continuing selection for reduced shattering [13,14].
O. barthii is one of the relatives distributed in West Africa, sharing the same AA genome as Asian cultivated rice. Most of O. barthii accessions exhibited the seed shattering. The previous report indicated that GL4 in O. barthii was involved in the non-shattering selection during the African cultivated rice domestication [7], but the nature of seed shattering was still not clear. Here, we report that a novel locus, named hybrid shattering 1 (HS1), controlled the seed shattering in the hybrid between O. barthii and O. sativa. A near-isogenic line (NIL-hs1) from O. barthii, and its recurrent parent, a japonica variety Yundao 1, showed the non-shattering phenotype. Interestingly, the hybrid between two parents showed the seed shattering, similar to the ancestral wild rice. Whether it was shattering or not was dependent on the different haplotypes of two SNPs at HS1. This result could help us understand the complex molecular mechanism of seed shattering.

2. Results

2.1. HS1 Controlled the Hybrid Seed Shattering in Rice

We developed a NIL-hs1 carrying genome fragment from O. barthii on chromosome 4 in the Yundao 1 genetic background. Surprisingly, Yundao 1 and the NIL-hs1 showed the non-shattering seed, while F1 hybrid exhibited seed shattering (Figure 1A, Table S1). In order to distinguish the differences in abscission layer structure between F1 hybrid and its parents, longitudinal sections at the seeds base were observed using fluorescent microscopy. The results showed that Yundao 1 displayed the deficiency in abscission zone development near the vascular bundle (Figure 1B), the NIL-hs1 showed no abscission layer on the palea side and the partial abscission layer on the lemma side between the seed pedicel and the spikelet, respectively (Figure 1D). Conversely, the F1 hybrid had a continuous abscission zone between the vascular bundle and the epidermis (Figure 1C). These results indicated that seed shattering in the F1 hybrid resulted from the complete and continuous abscission layer, whereas the loss of seed shattering in Yundao 1 and NIL-hs1 was caused by the irregular development of the abscission zone.

2.2. Dominant Complementation of G Allele at G237T Site and C Allele at C760T Site in HS1 Led to Hybrid Seed Shattering Phenotype

In order to understand whether HS1 acted as a single Mendelian factor or not, the seed shattering rate was investigated in BC4F1 and BC4F2 populations derived from the cross between Yundao 1 and NIL-hs1. All the BC4F1 individuals showed seed shattering. The seed shattering rate in the BC4F2 population was segregated into non-shattering and shattering classes in a 246:205 ratio, which fitted the 1:1 ratio (χ2 = 1.870, P = 0.172) (Figure S1). These results indicated that the seed shattering in F1 hybrid was controlled by a single gene. We designated it as HS1.
A population of 790 BC4F2 plants was generated for mapping the HS1. Eight polymorphic SSR markers in the introgressed region on chromosome 4 were used for genotyping the 790 individuals in the BC4F2 population. HS1 was mapped into a 0.4 cM region flanked by RM17604 and RM8220, at genetic distances of 0.3 and 0.1 cM, respectively, and co-segregated with RM17616 (Figure 2). The homozygotes from both parents at RM17616 showed a non-shattering phenotype, whereas the heterozygotes at RM17616 showed a shattering phenotype. Based on the GRAMENE public database (http://www.gramene.org), the physical distance between RM17604 and RM8220 was about 434.6 kb. The mapping region of HS1 was similar to the location of SH4/GL4 (LOC_Os04g57530/ORGLA04G0254300) identified from the Asian rice and the African rice [4,5,6]. In order to confirm whether the HS1 was allelic to SH4/GL4 or not, the sequence analysis of SH4 in Yundao 1 and NIL-hs1 was performed. A total of 13 SNPs, 5 indels in the 2.3 kb of aligned sequenced DNA were identified (Figure 3), which resulted in 1 amino acid insertion, 4 amino acid substitutions, 6 amino acid deletions and pre-stop codon in NIL-hs1, respectively (Figure 3). Of these, two base substitutions of G237T and C760T (C760T referred that the C to T SNP mutation in HS1 was at nucleotide position 760 in O. barthii, which was the same as C769T mutation in Yundao 1) resulted in the mutation of Asn79 to Lys79 and Gln258 to a stop codon, respectively. It was reported that the G allele at G237T site and the C allele at C760T site were responsible for the seed shattering during the Asian cultivated rice and the African cultivated rice domestication, respectively [4,5,6]. Thus, we postulated that HS1 was identical to SH4 and GL4. The G allele at G237T site and the T allele at C760T in the Yundao 1 background, and the T allele at G237T site and the C allele at C760T in the NIL-hs1 background all conferred the non-shattering phenotype, whereas the combination of the G allele at G237T site and the C allele at C760T site exhibited the shattering phenotype. Dominant complementation of the G allele at G237T site and the C allele at C760T site in SH4 led to the hybrid shattering phenotype. Moreover, SH4 in NIL-hs1 had a unique deletion of the 227th amino acid residue isoleucine (Ile), compared with that in other AA genome species in the genus Oryza.

2.3. Two SNP Mutations Turned off Seed Shattering in Rice

In order to confirm the function of the two SNPs, we reanalyzed the gene sequence of SH4 in 95 wild accessions of rice, 119 O. glaberrima and 65 O. sativa using previously published data. All the accessions harboring both the G allele at G237T site and the C allele at C760T site exhibited the shattering phenotype, including 2 O. longistaminata accessions, 22 of 28 O. barthii accessions, 8 of 119 O. glaberrima accessions, 2 O. glumaepatula accessions, 20 of 25 O. nivara accessions and 30 of 36 O. rufipogon accessions. All the accessions (varieties) with either the G allele at G237T site or the C allele at C760T site showed the non-shattering, including 6 of 28 O. barthii accessions, 111 of 119 O. glaberrima accessions, 5 of 25 O. nivara accessions, 6 of 36 O. rufipogon accessions and 65 Asian cultivated varieties. These results indicated that the G allele at G237T site and the C allele at C760T site were ancestral alleles in African rice domestication and Asian rice domestication, respectively, whereas the T allele at both sites that resulted from selection pressure were mutation alleles. The ancestral haplotype (the G allele at G237T site and the C allele at C760T site) induced a shattering phenotype in rice, whereas domestic haplotypes (the G allele at G237T site and the T allele at C760T site, the T allele at G237T site and the C allele at C760T site) all exhibited the loss or reduction of seed shattering (Table 1), which was consistent with our experimental results that the hybrid harboring ancestral haplotype showed a shattering phenotype; however, Yundao 1 and NIL-hs1 carrying homozygous domestic haplotypes exhibited a non-shattering phenotype.

3. Discussion

What causes the differences in seed shattering in different species is totally an open question. Loss or reduction of seed shattering represents a key transition to domestication in rice [15,16]. In this study, it was a serendipitous finding that the hybrid F1 derived from the cross between the non-shattering Yundao 1 and NIL-hs1 that displayed the seed shattering phenotype. And we reported that a novel locus HS1 controlled the hybrid shattering between O. sativa and O. barthii. Yundao 1 and NIL-hs1 showed the irregular and partially developed abscission layer, whereas the F1 hybrid exhibited a continuous abscission layer between seed pedicel and spikelet. HS1 and SH4 were mapped into a similar region on chromosome 4 [5], interestingly, SH4 functioned in the seed shattering on the homozygous background, whereas HS1 conferred the seed shattering on the heterozygous background. What resulted in this difference? It was suggested that an allelic interaction at a single locus or an epistatic interaction at two independent loci from the non-shattering species O. sativa and O. barthii determined the phenotype. Interestingly, HS1 and SH4 were mapped into a similar region on Chromosome 4 and sequencing analysis confirmed that HS1, allelic to SH4, carrying ancestral haplotype (the G allele at G237T site and the C allele at C760T site) contributed to shattering in the F1 hybrid. Thus, an allelic interaction at SH4 was responsible for the hybrid seed shattering. NIL-hs1 and most of O. glaberrima accessions shared the same SH4 haplotype, and we also found that the hybrid between the O. glaberrima and O. sativa also displayed the seed shattering phenotype. As we know, it is difficult to obtain the hybrid progeny between O. glaberrima and O. sativa, one of the reasons is that interspecific hybrid sterility between O. glaberrima and O. sativa prevents the formation of hybrid offspring, and another reason is that strong seed shattering in the hybrid increases the difficulty of the crossing. Previous studies reported that one single-nucleotide polymorphism, G237T or C760T, controlled seed shattering in rice independently, because one SNP was fixed and not polymorphic in the wild and cultivated accessions [5,6,7]. In this study, the relationship of the different haplotypes of SH4 and the shattering phenotype was analyzed from the whole gene sequence viewpoint. Moreover, two base mutations of G237T and C760T at SH4 occurred in Trihelix DNA binding domain, indicating that this domain played an important role in seed shattering and either of the nucleotide acid mutations had no effect on the function of the DNA binding domain. The transcription factor SH4 controlled the AZ identification by positively regulating the expression of SHAT1, and qSH1 could promote the AZ differentiation by maintaining the expression of SHAT1 and SH4 [8], suggesting that two amino acid substitutions (Asn79 to Lys79 and Gln258 to a stop codon) in SH4 might affect the interaction with SHAT1 and qSH1, resulting in the loss of seed shattering. In addition, with the similar genetic background, the shattering degree of Yundao 1 was easier than that of NIL-hs1, there were two possibilities: (1) The haplotype of T237 and C760 combination conferred the easier shattering than that of G237 and T760 combination; (2) other genes in the introgressed region could decrease the seed shattering rate by regulating the expression of SH4. These results would provide new clues into the molecular basis of seed shattering in rice, and breeders can take the advantage of different haplotype combinations adapted to the moderate shattering degree so as to meet the need for mechanized harvest.
Asian cultivated rice (O. sativa L.) was domesticated from wild species O. rufipogon thousands of years ago [17,18], whereas O. glaberrima Steud. was an African species of rice that was domesticated from the wild progenitor O. barthii about 3000 years ago [15,16]. In this study, 79% of O. barthii accessions harbored the G allele at G237T site and the C allele at C760T site in SH4, but 93% of O. glaberrima accessions carried the G allele at G237T site and the T allele at C760T site. It is suggested that the wild-type G at the G237T site was fixed, while the mutated T allele at the C760T site was selected during the African cultivated domestication. The function of the G allele at G237T site (Lysine residue) may be critical for the growth and development of the African wild relative of rice and African cultivated rice so that it was fixed during the gradual domestication process, while the T allele at G237T site contributing to the small grain size was selected, which may be an adaptation to the extreme environment in West Africa, such as drought, soil acidity, iron and aluminum toxicity [7,19,20]. Two haplotypes of SH4 in O. rufipogon existed, whereas the cultivated rice only had one domestic haplotype, these results were also observed in O. barthii and O. glaberrima. Compared with African cultivated rice, domestic allele in Asian cultivated rice was the G237T mutation, while the C allele at C760T mutation was fixed, indicating that the C alleles at the C760T site might be involved in the selection of a large grain size [7]. This might be one of the reasons that the yield of Asian cultivated rice was higher than that of African cultivated rice. Taken together, the seed shattering characteristics were selected in African cultivated rice and Asian cultivated rice, respectively, which were consistent with the theory that O. glaberrima and O. sativa were domesticated in parallel [12,18].

4. Materials and methods

4.1. Plant Materials

An O. barthii accession, Acc.104284, introduced from the International Rice Research Institute (IRRI), as a donor and male parent, was crossed with a temperate japonica variety of O. sativa, Yundao 1, from Yunnan province, P. R. China. The male gametes in hybrid F1 between O. barthii and O. sativa were fully sterile, and the female gametes in hybrid F1 were partially fertile, thus, hybrid F1 as the female parent was consecutively backcrossed with Yundao 1 as the male parent. BC3 plants were self-pollinated for 13 generations to produce the BC3F14 introgression lines. Four hundred and twenty-six polymorphic SSR markers evenly distributed on 12 chromosomes of rice were used to evaluate the substituted fragments from O. barthii. The results indicated that only 14.8 cM segments on chromosome 4 were substituted by the O. barthii genome. The individuals harboring the homozygous genome fragment from O. barthii were selected as NIL-hs1. NIL-hs1 was crossed with the recurrent parent Yundao 1, and then was self-fertilized to produce the BC4F2 population. We found the BC4F1 plants all showed seed shattering, while seed shattering and non-shattering were both observed in the BC4F2 population. Seven hundred and ninety individuals were used to mapping HS1 for seed shattering between O. sativa and O. barthii.
All plant materials were grown in the paddy field at the Experiment Station, YAAS, located in Jinghong, Yunnan Province, P. R. China.

4.2. Evaluation of Seed Shattering Rate

The spikelets of each plant were bagged at the stage of heading. Then, the panicles were collected at the stage of maturity, and panicles freely fell 2 m to the plastic box (60 cm × 90 cm). All the grains shredded prior to the test were counted as shattering grains. The shattering rate was calculated by a percentage of shattered seeds to the total seeds. The shattering rate below 5% or above 50%, was defined as the non-shattering type and the shattering type, respectively.

4.3. Microscopy

Seeds including pedicels were collected at the stage of maturity, and slices made by mature and dry seeds were stained with 1% acridine orange. Abscission layer at seed base was observed by Fluorescent microscopy (OLYMPUS BX53).

4.4. DNA Extraction and SSR Analysis

The experimental procedure for DNA extraction was performed as previously described [21]; rice SSR markers were selected from the Gramene database (http://www.gramene.org) or previously published SSR markers in rice [22]. PCR was performed as follows: a total volume of 10 μL containing 10 ng template DNA, 1 × buffer, 0.2 μM of each primer, 50 μM of dNTPs and 0.5 units of Taq polymerase (Tiangen Company, Beijing, China). The reaction mixture was incubated at 94 °C for an initial 4 min, followed by 30 cycles of 94 °C 30 s, 55 °C 30 s and 72 °C 30 s, and a final extension step of 5 min at 72 °C. PCR products were separated on 8% non-denaturing polyacrylamide gel and detected using the silver staining method.

4.5. Linkage Analysis

A linkage map was constructed on the basis of genetic linkage between the genotype of SSR markers and seed shattering phenotype in the BC4F2 population.

4.6. Sequencing

In order to compare the sequence difference of SH4 between Yundao 1 and NIL-hs1, the primer (SH4-F: CCGAACACCAAACGCCTCAG, SH4-R: CCGTACTCCCAATACTCGCAGA) was designed on the 5′UTR and 3′UTR region of SH4 gene for amplifying the target sequence. PCR mixture (25 uL) contained 0.4 mM of each dNTP, 0.3 uM of each primer, 0.5 units of Taq polymerase (KOD FX DNA polymerase, Toyobo, Japan) and template DNA 100 ng in the GeneAMP PCR system 9700 (Applied Biosystems, Foster City, CA, USA). The PCR program was 94 °C for 2 min, followed by 30 cycles at 98 °C for 10 s, 55 °C for 30 s and 68 °C for 2 min. PCR products were separated in 1% agarose gels.

4.7. Haplotype Analysis of the SH4 Gene

To analyze the haplotype of the SH4 gene, the nucleotide sequence of SH4 in the AA genome was downloaded from the GenBank database, wild rice genome project and public data [5,7,15,23,24,25], 2 SNPs of G237T and C760T were analyzed in 279 rice accessions.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/8/11/475/s1, Figure S1. Frequency distributions of seed shattering rate and the sequence alignment of HS1. Figure S2. The information on haplotypes in SH4 of 279 accessions in AA genome Oryza. Table S1. The seed shattering rate of Yundao 1, NIL-hs1 and F1 hybrid.

Author Contributions

Y.Z., J.Z. and D.T. planned and designed the research. Y.Y., W.H.E., P.X., J.L., Y.Z.E.-R. and S.H. performed the laboratory experiments. Y.Z., J.Z. and Y.Y. analyzed the data together. Y.Z., J.Z. and D.T. finished the manuscript. All authors reviewed and approved the final manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (Grant Nos. U1502265, 31660380, 31201196), Yunnan Provincial Science and Technology Department, China (Grant Nos. 2015HB079, 2018FG001-086) and the Yunnan Provincial Government (YNWR-QNBJ-2018-359).

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

NIL: Near isogenic line; AL: Abscission layer, V: Vascular bundle.

References

  1. Ji, H.; Kim, S.-R.; Kim, Y.-H.; Kim, H.; Eun, M.-Y.; Jin, I.-D.; Cha, Y.-S.; Yun, D.-W.; Ahn, B.-O.; Lee, M.C.; et al. Inactivation of the CTD phosphatase-like gene OsCPL1 enhances the development of the abscission layer and seed shattering in rice. Plant J. 2010, 61, 96–106. [Google Scholar] [CrossRef]
  2. Avik, R.; Debarati, C. Shattering or not shattering: That is the question in domestication of rice (Oryza sativa L.). Genet. Resour. Crop Evol. 2018, 65, 391–395. [Google Scholar]
  3. Oba, S.; Sumi, N.; Fujimoto, F.; Yasue, T. Association between Grain Shattering Habit and Formation of Abscission Layer Controlled by Grain Shattering gene sh-2 in Rice (Oryza sativa L.). Jpn. J. Crop Sci. 1995, 64, 607–615. [Google Scholar] [CrossRef]
  4. Konishi, S.; Izawa, T.; Lin, S.Y.; Ebana, K.; Fukuta, Y.; Sasaki, T.; Yano, M.; Huang, X.; Hansen, N.; Tsuji, N. An SNP Caused Loss of Seed Shattering During Rice Domestication. Science 2006, 312, 1392–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Li, C.; Zhou, A.; Sang, T. Rice domestication by reducing shattering. Science 2008, 311, 1936–1939. [Google Scholar] [CrossRef] [PubMed]
  6. Lin, Z.; Griffith, M.E.; Li, X.; Zhu, Z.; Tan, L.; Fu, Y.; Zhang, W.; Wang, X.; Xie, D.; Sun, C. Origin of seed shattering in rice (Oryza sativa L.). Planta 2007, 226, 11–20. [Google Scholar] [CrossRef] [PubMed]
  7. Wu, W.; Liu, X.; Wang, M.; Meyer, R.S.; Luo, X.; Ndjiondjop, M.-N.; Tan, L.; Zhang, J.; Wu, J.; Cai, H.; et al. A single-nucleotide polymorphism causes smaller grain size and loss of seed shattering during African rice domestication. Nat. Plants 2017, 3, 17064. [Google Scholar] [CrossRef] [PubMed]
  8. Zhou, Y.; Lu, D.; Li, C.; Luo, J.; Zhu, B.-F.; Zhu, J.; Shangguan, Y.; Wang, Z.; Sang, T.; Zhou, B.; et al. Genetic control of seed shattering in rice by the APETALA2 transcription factor shattering abortion1. Plant Cell 2012, 24, 1034–1048. [Google Scholar] [CrossRef]
  9. Yoon, J.; Cho, L.-H.; Kim, S.L.; Choi, H.; Koh, H.-J.; An, G. The BEL1-type homeobox gene SH5 induces seed shattering by enhancing abscission-zone development and inhibiting lignin biosynthesis. Plant J. 2014, 79, 717–728. [Google Scholar] [CrossRef]
  10. Sun, P.; Zhang, W.; Wang, Y.; He, Q.; Shu, F.; Liu, H.; Wang, J.; Wang, J.; Yuan, L.; Deng, H. OsGRF4 controls grain shape, panicle length and seed shattering in rice. J. Integr. Plant Biol. 2016, 58, 836–847. [Google Scholar] [CrossRef]
  11. Yoon, J.; Cho, L.-H.; Antt, H.W.; Koh, H.-J.; An, G. KNOX Protein OSH15 Induces Grain Shattering by Repressing Lignin Biosynthesis Genes. Plant Physiol. 2017, 174, 312–325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Lv, S.; Wu, W.; Wang, M.; Meyer, R.S.; Ndjiondjop, M.-N.; Tan, L.; Zhou, H.; Zhang, J.; Fu, Y.; Cai, H.; et al. Genetic control of seed shattering during African rice domestication. Nat. Plants 2018, 4, 331–337. [Google Scholar] [CrossRef] [PubMed]
  13. Zheng, Y.; Crawford, G.W.; Jiang, L.; Chen, X. Rice Domestication Revealed by Reduced Shattering of Archaeological rice from the Lower Yangtze valley. Sci. Rep. 2016, 6, 28136. [Google Scholar] [CrossRef] [PubMed]
  14. Ishikawa, R.; Thanh, P.T.; Nimura, N.; Htun, T.M.; Yamasaki, M.; Ishii, T. Allelic interaction at seed-shattering loci in the genetic backgrounds of wild and cultivated rice species. Genes Genet. Syst. 2010, 85, 265–271. [Google Scholar] [CrossRef] [Green Version]
  15. Wang, M.; Yu, Y.; Haberer, G.; Marri, P.R.; Fan, C.; Goicoechea, J.L.; Zuccolo, A.; Song, X.; Kudrna, D.; Ammiraju, J.S.S.; et al. The genome sequence of African rice (Oryza glaberrima) and evidence for independent domestication. Nat. Genet. 2014, 46, 982–988. [Google Scholar] [CrossRef]
  16. Huang, X.; Kurata, N.; Wei, X.; Wang, Z.-X.; Wang, A.; Zhao, Q.; Zhao, Y.; Liu, K.; Lu, H.; Li, W.; et al. A map of rice genome variation reveals the origin of cultivated rice. Nature 2012, 490, 497–501. [Google Scholar] [CrossRef] [Green Version]
  17. Khush, G.S. Origin, dispersal, cultivation and variation of rice. Oryza Mol. Plant 1997, 35, 25–34. [Google Scholar] [CrossRef]
  18. Brar, D.; Khush, G. Alien introgression in rice. Plant Mol. Biol. 1997, 35, 35–47. [Google Scholar] [CrossRef]
  19. Sanchez, P.; Wing, R.; Brar, D. Genetics and Genomics of Rice; Zhang, Q., Wing, R.A., Eds.; Springer: New York, NY, USA, 2013; pp. 9–25. [Google Scholar]
  20. Vaughan, D.A.; Lu, B.-R.; Tomooka, N. The evolving story of rice evolution. Plant Sci. 2008, 174, 394–408. [Google Scholar] [CrossRef]
  21. Edwards, K.; Johnstone, C.; Thompson, C. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 1991, 19, 1349. [Google Scholar] [CrossRef]
  22. McCouch, S.; Teytelman, L.; Xu, Y.; Lobos, K.; Clare, K.; Walton, M.; Fu, B.; Maghirang, R.; Li, Z.; Xing, Y.; et al. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.) (supplement). DNA Res. 2002, 9, 257–279. [Google Scholar] [CrossRef] [PubMed]
  23. Zhao, Q.; Feng, Q.; Lu, H.; Li, Y.; Wang, A.; Tian, Q.; Zhan, Q.; Lu, Y.; Zhang, L.; Huang, T.; et al. Pan-genome analysis highlights the extent of genomic variation in cultivated and wild rice. Nat. Genet. 2018, 50, 278–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Huang, X.; Zhao, Y.; Wei, X.; Li, C.; Wang, A.; Zhao, Q.; Li, W.; Guo, Y.; Deng, L.; Zhu, C.; et al. Genome-wide association study of flowering time and grain yield traits in a worldwide collection of rice germplasm. Nat. Genet. 2011, 44, 32–39. [Google Scholar] [CrossRef] [PubMed]
  25. Thurber, C.S.; Reagon, M.; Gross, B.L.; Olsen, K.M.; Jia, Y.; Caicedo, A.L. Molecular evolution of shattering loci in U.S. weedy rice. Mol. Ecol. 2010, 19, 3271–3284. [Google Scholar] [CrossRef] [Green Version]
Plants 08 00475 g001 550
Figure 1. (A) The seed shattering rate of Yundao 1 (left), F1 hybrid (middle) and near-isogenic line (NIL-hs1) (right). Scale bars = 0.5 cm. (B–D) Fluorescence images of a longitudinal section of the spikelet and pedicel junction in Yundao 1, F1 hybrid and NIL-hs1, respectively. (B) Yundao 1 showed an incomplete in abscission zone. (C) F1 hybrid with a complete abscission layer. (D) NIL-hs1 exhibited a deficiency in abscission layer on the palea side and partial abscission layer on the lemma side. AL: Abscission layer, V: Vascular bundle. White arrow indicates a deficiency in abscission zone. Scale bars = 10 µm.
Figure 1. (A) The seed shattering rate of Yundao 1 (left), F1 hybrid (middle) and near-isogenic line (NIL-hs1) (right). Scale bars = 0.5 cm. (B–D) Fluorescence images of a longitudinal section of the spikelet and pedicel junction in Yundao 1, F1 hybrid and NIL-hs1, respectively. (B) Yundao 1 showed an incomplete in abscission zone. (C) F1 hybrid with a complete abscission layer. (D) NIL-hs1 exhibited a deficiency in abscission layer on the palea side and partial abscission layer on the lemma side. AL: Abscission layer, V: Vascular bundle. White arrow indicates a deficiency in abscission zone. Scale bars = 10 µm.
Plants 08 00475 g001
Plants 08 00475 g002 550
Figure 2. (A) Graphical genotypes show that an O. barthii chromosomal segment was introgressed into the NIL-hs1 genome on chromosome 4. (B) Genetic mapping of hybrid shattering 1 (HS1) on Chromosome 4, white bar: homozygous Yundao 1; grey bar: heterozygous; black bar: homozygous NIL-hs1. “R” means the number of recombinants.
Figure 2. (A) Graphical genotypes show that an O. barthii chromosomal segment was introgressed into the NIL-hs1 genome on chromosome 4. (B) Genetic mapping of hybrid shattering 1 (HS1) on Chromosome 4, white bar: homozygous Yundao 1; grey bar: heterozygous; black bar: homozygous NIL-hs1. “R” means the number of recombinants.
Plants 08 00475 g002
Plants 08 00475 g003 550
Figure 3. The difference in the coding sequence and amino acid of HS1 between Yundao 1 and NIL-hs1. Synonymous mutations and functional mutations were shown in green and red, respectively. The asterisk indicates the stop codon.
Figure 3. The difference in the coding sequence and amino acid of HS1 between Yundao 1 and NIL-hs1. Synonymous mutations and functional mutations were shown in green and red, respectively. The asterisk indicates the stop codon.
Plants 08 00475 g003
Table
Table 1. The haplotypes of the SH4 at G237T and C760T sites in the AA genome species of genus Oryza.
Table 1. The haplotypes of the SH4 at G237T and C760T sites in the AA genome species of genus Oryza.
SpeciesG237TC760TNo. of Accessions (Varieties)Phenotype
O. longistaminataGC2Shattering
O. barthiiGC22Shattering
GT6Non-shattering
O. glaberrimaGC8Shattering
GT111Non-shattering
O. glumaepatulaGC2Shattering
O. meridionalisGC2Shattering
O. nivaraGC20Shattering
TC5Non-shattering
O. rufipogonGC30Shattering
TC6Non-shattering
O. sativa, temperate japonicaTC30Non-shattering
O. sativa, tropical japonicaTC5Non-shattering
O. sativa, indicaTC25Non-shattering
O. sativa, ausTC5Non-shattering

Share and Cite

MDPI and ACS Style

Zhang, Y.; Zhou, J.; Yang, Y.; Elgamal, W.H.; Xu, P.; Li, J.; El-Refaee, Y.Z.; Hao, S.; Tao, D. Two SNP Mutations Turned off Seed Shattering in Rice. Plants 2019, 8, 475. https://doi.org/10.3390/plants8110475

AMA Style

Zhang Y, Zhou J, Yang Y, Elgamal WH, Xu P, Li J, El-Refaee YZ, Hao S, Tao D. Two SNP Mutations Turned off Seed Shattering in Rice. Plants. 2019; 8(11):475. https://doi.org/10.3390/plants8110475

Chicago/Turabian Style

Zhang, Yu, Jiawu Zhou, Ying Yang, Walid Hassan Elgamal, Peng Xu, Jing Li, Yasser Z. El-Refaee, Suding Hao, and Dayun Tao. 2019. "Two SNP Mutations Turned off Seed Shattering in Rice" Plants 8, no. 11: 475. https://doi.org/10.3390/plants8110475

APA Style

Zhang, Y., Zhou, J., Yang, Y., Elgamal, W. H., Xu, P., Li, J., El-Refaee, Y. Z., Hao, S., & Tao, D. (2019). Two SNP Mutations Turned off Seed Shattering in Rice. Plants, 8(11), 475. https://doi.org/10.3390/plants8110475

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop