DNA Barcoding Unveils Novel Discoveries in Authenticating High-Value Snow Lotus Seed Food Products
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples
2.2. DNA Extraction
2.3. Primer and PCR Amplification
2.4. Sanger Sequencing
2.5. Phylogenetic Analysis
3. Results and Discussion
3.1. DNA Barcoding Primers for SLS
3.2. The Authenticity of Commercial SLS Products
3.3. New Discovery for Authenticity Identification of SLS
3.3.1. Adulteration of Closely Related Species of the Same Genus
3.3.2. Caesalpinia Spinosa: A Newly Identified Non-Gleditsia Species Involved in Adulterating SLS
3.3.3. Artificially Manufactured Weighted SLS with Added Sucrose
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- DBS52/061-2022; Local Standard for Food Safety-Zaojiaomi. Guizhou health and Health Committee: Guiyang, China, 2022.
- Liu, Y.; Shi, Z.J.; Peng, X.W.; Xu, J.Y.; Deng, J.; Zhao, P.; Zhang, X.; Kan, H. A polysaccharide from the seed of Gleditsia japonica var. delavayi: Extraction, purification, characterization and functional properties. LWT Food Sci. Technol. 2024, 191, 115660. [Google Scholar] [CrossRef]
- Zhijin County, Guizhou: The Development of Zaojiaomi Industry to Help Rural Revitalization. Available online: https://www.gzzhijin.gov.cn/xwzx/jrzj/202111/t20211105_75135171.html (accessed on 21 June 2024).
- Maochang, Zijin County: The Road to Industrial Breakthrough in the Largest Zaojiaomi Processing and Distribution Center of China. Available online: http://www.gzzhijin.gov.cn/xwzx/xzdt/202312/t20231220_83376396.html (accessed on 21 June 2024).
- Kendall, H.; Clark, B.; Rhymer, C.; Kuznesof, S.; Hajslova, J.; Tomaniova, M.; Brereton, P.; Frewer, L. A systematic review of consumer perceptions of food fraud and authenticity: A European perspective. Trends Food Sci. Technol. 2019, 94, 79–90. [Google Scholar] [CrossRef]
- Liang, Y.L.; Ding, Y.J.; Liu, X.; Zhou, P.F.; Ding, M.X.; Yin, J.J.; Song, Q.H. A duplex PCR–RFLP–CE for simultaneous detection of mandarin and grapefruit in orange juice. Eur. Food Res. Technol. 2021, 247, 1–7. [Google Scholar] [CrossRef]
- Uncu, A.T.; Uncu, A.O. Plastid trnH-psbA intergenic spacer serves as a PCR-based marker to detect common grain adulterants of coffee (Coffea arabica L.). Food Control 2018, 91, 32–39. [Google Scholar] [CrossRef]
- Shamustakimova, A.O.; Mavlyutov, Y.M.; Klimenko, I.A. Application of SRAP Markers for DNA Identification of Russian Alfalfa Cultivars. Russ. J. Genet. 2021, 57, 540–547. [Google Scholar] [CrossRef]
- Li, J.J.; Ye, C.L. Genome-wide analysis of microsatellite and sex-linked marker identification in Gleditsia sinensis. BMC Plant Biol. 2020, 20, 338. [Google Scholar] [CrossRef] [PubMed]
- Tan, W.; Gao, H.; Jiang, W.L.; Zhang, H.Y.; Yu, X.L.; Liu, E.W.; Tian, X.X. The complete chloroplast genome of Gleditsia sinensis and Gleditsia japonica: Genome organization, comparative analysis, and development of taxon specific DNA mini-barcodes. Sci. Rep. 2020, 10, 16309. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, R.; Staton, M.; Schlarbaum, S.E.; Coggeshall, M.V.; Severson, J.R.; Carlson, J.E.; Zembower, N.; Liang, H.; Xu, Y.; et al. Development of genic and genomic microsatellites in Gleditsia triacanthos L. (Fabaceae) using illumine sequencing. Ann. For. Res. 2017, 60, 343–350. [Google Scholar]
- Kang, T.S. Basic principles for developing real-time PCR methods used in food analysis: A review. Trends Food Sci. Technol. 2019, 91, 574–585. [Google Scholar] [CrossRef]
- Mishra, P.; Kumar, A.; Nagireddy, A.; Mani, D.N.; Shukla, A.K.; Tiwari, R.; Sundaresan, V. DNA barcoding: An efficient tool to overcome authentication challenges in the herbal market. Plant Biotechnol. J. 2016, 14, 8–21. [Google Scholar] [CrossRef]
- Al-Qurainy, F.; Khan, S.; Tarroum, M.; Al-Hemaid, F.M.; Ali, M.A. Molecular authentication of the medicinal herb Ruta graveolens (Rutaceae) and an adulterant using nuclear and chloroplast DNA markers. Genet. Mol. Res. 2011, 10, 2806–2816. [Google Scholar] [CrossRef] [PubMed]
- Letsiou, S.; Madesis, P.; Vasdekis, E.; Montemurro, C.; Grigoriou, M.E.; Skavdis, G.; Moussis, V.; Koutelidakis, A.E.; Tzakos, A.G. DNA barcoding as a plant identification method. Appl. Sci. 2024, 14, 1415. [Google Scholar] [CrossRef]
- Thongkhao, K.; Tungphatthong, C.; Phadungcharoen, T.; Sukrong, S. The use of plant DNA barcoding coupled with HRM analysis to differentiate edible vegetables from poisonous plants for food safety. Food Control 2020, 109, 106896. [Google Scholar] [CrossRef]
- Wang, J.L.; Yan, Z.F.; Zhong, P.; Shen, Z.B.; Yang, G.F.; Ma, L.C. Screening of universal DNA barcodes for identifying grass species of Gramineae. Front. Plant Sci. 2022, 13, 998863. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Yu, X.L.; Zhang, X.Y.; Guo, H.; Xing, Z.M.; Xu, L.W.; Wang, J.; Shen, Y.Y.; Yu, J.; Lv, P.F.; et al. Development of Mini-Barcode Based on Chloroplast Genome and Its Application in Metabarcoding Molecular Identification of Chinese Medicinal Material Radix Paeoniae Rubra (Chishao). Front. Plant Sci. 2022, 13, 819822. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.Q.; Jiang, B. Species identification in complex groups of medicinal plants based on DNA barcoding: A case study on Astragalus spp. (Fabaceae) from southwest China. Conserv. Genet. Resour. 2020, 12, 469–478. [Google Scholar] [CrossRef]
- Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; Fazekas, A.J.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar]
- Jamdade, R.; Upadhyay, M.; Shaer, K.A.; Harthi, E.A.; Sallani, M.A.; Jasmi, M.A.; Ketbi, A.A. Evaluation of Arabian Vascular Plant Barcodes (rbcL and matK): Precision of Unsupervised and Supervised Learning Methods towards Accurate Identification. Plants 2021, 10, 2741. [Google Scholar] [CrossRef] [PubMed]
- Li, W.T.; Yang, S.H.; Ni, L.H.; Zhao, Z.L.; Xu, H.X. Determination of the Genomic DNA Degradation Rate of the Chinese Herb Gentianae crassicaulis Radix During Processing and Storage. Pharmacogn. Mag. 2023, 19, 520–529. [Google Scholar] [CrossRef]
- T/GZSX 064-2020; Technical Regulations for Production and Processing of Zaojiaomi. Guizhou Food Industry Association: Guiyang, China, 2020.
- Chen, S.L.; Yao, H.; Han, J.P.; Liu, C.; Song, J.Y.; Shi, L.C.; Zhu, Y.J.; Ma, X.Y.; Gao, T.; Pang, X.H.; et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef]
- Gu, W.; Song, J.Y.; Cao, Y.; Sun, Q.W.; Yao, H.; Wu, Q.N.; Chao, J.G.; Zhou, J.J.; Xue, W.D.; Duan, J.A. Application of the ITS2 Region for Barcoding Medicinal Plants of Selaginellaceae in Pteridophyta. PLoS ONE 2013, 8, e67818. [Google Scholar] [CrossRef] [PubMed]
- Qian, Z.H.; Munywoki, J.M.; Wang, Q.F.; Malombe, I.; Li, Z.Z.; Chen, J.M. Molecular Identification of African Nymphaea Species (Water Lily) Based on ITS, trnT-trnF and rpl16. Plants 2022, 11, 2431. [Google Scholar] [CrossRef] [PubMed]
- Basic Local Alignment Search Tool. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 8 August 2024).
- Saitou, N.; Nei, M. The Neighbor-joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [PubMed]
- Barcode of Life Data System. Available online: http://www.boldsystems.org/index.php/ (accessed on 8 August 2024).
- Healey, A.; Furtado, A.; Cooper, T.; Henry, R.J. Protocol: A simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 2014, 10, 21. [Google Scholar] [CrossRef]
- He, S.L. Key Technologies for High-Yield and Efficient Cultivation of Gleditsia sinensis for Obtaining the Thorn. Available online: http://www.lczmcn.com/sf_B3AEB904EC204D76A19FFF2918415309_264_luoyanglinzhan.html (accessed on 21 June 2024).
- Fierro, O.; Siano, F.; Bianco, M.; Vasca, E.; Picariello, G. Comprehensive molecular level characterization of protein- and polyphenol-rich tara (Caesalpinia spinosa) seed germ flour suggests novel hypothesis about possible accidental hazards. Food Res. Int. 2024, 181, 114119. [Google Scholar] [CrossRef] [PubMed]
- Raj, V.; Chun, K.; Lee, S. State-of-the-art advancement in tara gum polysaccharide (Caesalpinia spinosa) modifications and their potential applications for drug delivery and the food industry. Carbohydr. Polym. 2024, 323, 121440. [Google Scholar] [CrossRef] [PubMed]
Primer | Oligonucleotide (5′-3′) | Amplicon (bp) | Reference |
---|---|---|---|
G-F | GCGGAAGGATCATTGTCGA | 550 | This study. |
G-R | GGTCTCGAGGTTTCGCTCTT | ||
ITS-F | GGAAGTAAAAGTCGTAACAAGC | 731 | [25] |
ITS-R | TCCTCCGCTTATTGATATGC | ||
ITS2-F | ATGCGATACTTGGTGTGAAT | 450~550 | [24] |
ITS2-R | GACGCTTCTCCAGACTACAAT |
Sample No. | GenBank | BOLD | Species Judgment a | |||||
---|---|---|---|---|---|---|---|---|
Species | Accession | Total Score | Similarity (%) | Species | Score | Similarity (%) | ||
1 | Gleditsia sinensis | AF510020.1 | 1020 | 100 | Gleditsia sinensis | 548 | 99.64 | R |
2 | Gleditsia sinensis | AF510020.1 | 1011 | 99.82 | Gleditsia sinensis | 543 | 99.63 | R |
3 | Tara spinosa | OQ411711.1 OQ411709.1 | 872 | 100 | Caesalpinia spinosa | 472 | 100 | F |
4 | Gleditsia microphylla | AF510027.1 | 667 | 100 | Gleditsia microphylla | 359 | 99.72 | F |
5 | Gleditsia microphylla | AF510027.1 | 985 | 99.63 | Gleditsia microphylla | 533 | 98.9 | F |
6 | Gleditsia microphylla | AF510027.1 | 662 | 100 | Gleditsia microphylla | 356 | 99.72 | F |
7 | Gleditsia sinensis | AF510020.1 | 937 | 99.61 | Gleditsia sinensis | 504 | 99.41 | R |
8 | Gleditsia japonica | MH710914.1 | 1002 | 99.82 | Gleditsia japonica | 539 | 100 | F |
9 | Gleditsia japonica | MH710914.1 | 996 | 99.82 | Gleditsia japonica | 540 | 99.82 | F |
10 | Gleditsia microphylla | AF510027.1 | 667 | 100 | Gleditsia microphylla | 359 | 99.72 | F |
11 | Gleditsia japonica | MH710914.1 | 675 | 100 | Gleditsia japonica | 365 | 100 | F |
12 | Gleditsia japonica | MH710914.1 | 680 | 100 | Gleditsia japonica | 368 | 100 | F |
13 | Gleditsia microphylla | AF510027.1 | 665 | 99.73 | Gleditsia microphylla | 357 | 99.72 | F |
14 | Tara spinosa | OQ411710.1 | 713 | 100 | Caesalpinia spinosa | 475 | 99.38 | F |
15 | Gleditsia japonica | MH710914.1 | 1000 | 100 | Gleditsia japonica | 541 | 100 | F |
16 | Gleditsia japonica | MH710914.1 | 1013 | 100 | Gleditsia japonica | 548 | 100 | F |
17 | Gleditsia japonica | MH710914.1 | 1005 | 100 | Gleditsia japonica | 544 | 100 | F |
18 | Gleditsia microphylla | AF510027.1 | 1005 | 99.64 | Gleditsia microphylla | 543 | 99.27 | F |
19 | Gleditsia sinensis | AF510020.1 | 1024 | 100 | Gleditsia sinensis | 550 | 99.64 | R |
20 | Gleditsia sinensis | AF510020.1 | 1013 | 100 | Gleditsia sinensis | 544 | 99.64 | R |
21 | Gleditsia microphylla | AF510027.1 | 1000 | 99.82 | Gleditsia microphylla | 539 | 99.45 | F |
22 | Gleditsia japonica | MH710914.1 | 1005 | 99.64 | Gleditsia japonica | 545 | 99.82 | F |
23 | Gleditsia microphylla | AF510027.1 | 1005 | 99.82 | Gleditsia microphylla | 542 | 99.45 | F |
24 | Gleditsia sinensi | AF510020.1 | 833 | 99.56 | Gleditsia sinensis | 449 | 99.12 | R |
25 | Gleditsia sinensis | AF510020.1 | 992 | 100 | Gleditsia sinensis | 533 | 99.63 | R |
26 | / | / | / | / | / | / | / | N |
27 | Gleditsia japonica | MH710914.1 | 1014 | 100 | Gleditsia japonica | 549 | 100 | F |
28 | Gleditsia sinensis | AF510020.1 | 1003 | 100 | Gleditsia sinensis | 539 | 99.63 | R |
29 | / | / | / | / | / | / | / | N |
30 | Gleditsia microphylla | AF510027.1 | 990 | 99.63 | Gleditsia microphylla | 535 | 99.26 | F |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, G.; Li, L.; Shen, X.; Zhong, R.; Zhong, Q.; Lei, H. DNA Barcoding Unveils Novel Discoveries in Authenticating High-Value Snow Lotus Seed Food Products. Foods 2024, 13, 2580. https://doi.org/10.3390/foods13162580
Zhao G, Li L, Shen X, Zhong R, Zhong Q, Lei H. DNA Barcoding Unveils Novel Discoveries in Authenticating High-Value Snow Lotus Seed Food Products. Foods. 2024; 13(16):2580. https://doi.org/10.3390/foods13162580
Chicago/Turabian StyleZhao, Gang, Lingyu Li, Xing Shen, Ruimin Zhong, Qingping Zhong, and Hongtao Lei. 2024. "DNA Barcoding Unveils Novel Discoveries in Authenticating High-Value Snow Lotus Seed Food Products" Foods 13, no. 16: 2580. https://doi.org/10.3390/foods13162580