Pulsed Radiofrequency Electromagnetic Fields as Modulators of Inflammation and Wound Healing in Primary Dermal Fibroblasts of Ulcers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Tissue Samples
2.2. Cell Culture
2.3. Pulsed Radiofrequency Electromagnetic Field Device
2.4. BrdU Assay
2.5. Wound Healing Assay and Image Acquisition
2.6. Gene Expression Profiling
2.7. ELISA Assay
2.8. Antioxidant Mediators Quantification
2.9. Statistics
3. Results
3.1. Cell Morphology
3.2. BrdU Assay
3.3. Scratch Wound Assay
3.4. Gene Expression
3.5. PGE2 and IL1β Levels
3.6. Antioxidant Activity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nelzén, O. Prevalence of venous leg ulcer: The importance of the data collection method. Phlebolymphology 2008, 15, 143–150. [Google Scholar]
- Mohamady, H.M.; Taha, M.M.; Aneis, Y.M.; Aldhahi, M.I.; Attalla, A.F. Effect of Combined Electromagnetic Field and Plantar Flexion Resistance Exercise on Wound Healing in Patients with Venous Leg Ulcers: A Randomized Controlled Trial. Medicina 2023, 59, 1157. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Sharma, D.; Zhao, F. Updates on Recent Clinical Assessment of Commercial Chronic Wound Care Products. Adv. Healthc. Mater. 2023, 12, e2300556. [Google Scholar] [CrossRef]
- Joaquim, F.L.; Silva, R.M.C.R.A.; Garcia-Caro, M.P.; Cruz-Quintana, F.; Pereira, E.R. Impact of venous ulcers on patients’ quality of life: An integrative review. Rev. Bras. Enferm. 2018, 71, 2021–2029. [Google Scholar] [CrossRef] [PubMed]
- Gualdi, G.; Costantini, E.; Reale, M.; Amerio, P. Wound Repair and Extremely Low Frequency-Electromagnetic Field: Insight from In Vitro Study and Potential Clinical Application. Int. J. Mol. Sci. 2021, 22, 5037. [Google Scholar] [CrossRef] [PubMed]
- Bainbridge, P. Wound healing and the role of fibroblasts. J. Wound Care 2013, 22, 407–412. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, Y.; He, W.; Mu, X.; Wu, X.; Deng, J.; Nie, X. Fibroblasts: Immunomodulatory factors in refractory diabetic wound healing. Front. Immunol. 2022, 13, 918223. [Google Scholar] [CrossRef] [PubMed]
- Raffetto, J.D. Inflammation in chronic venous ulcers. Phlebology 2013, 28 (Suppl. S1), 61–67. [Google Scholar] [CrossRef]
- Zhao, R.; Liang, H.; Clarke, E.; Jackson, C.; Xue, M. Inflammation in Chronic Wounds. Int. J. Mol. Sci. 2016, 17, 2085. [Google Scholar] [CrossRef]
- Hong, W.X.; Hu, M.S.; Esquivel, M.; Liang, G.Y.; Rennert, R.C.; McArdle, A.; Paik, K.J.; Duscher, D.; Gurtner, G.C.; Lorenz, H.P.; et al. The Role of Hypoxia-Inducible Factor in Wound Healing. Adv. Wound Care 2014, 3, 390–399. [Google Scholar] [CrossRef]
- Franks, P.J.; Barker, J.; Collier, M.; Gethin, G.; Haesler, E.; Jawien, A.; Laeuchli, S.; Mosti, G.; Probst, S.; Weller, C. Management of Patients With Venous Leg Ulcers: Challenges and Current Best Practice. J. Wound Care 2016, 25 (Suppl. S6), S1–S67. [Google Scholar] [CrossRef] [PubMed]
- Percival, S.L.; Thomas, J.G.; Williams, D.W. Biofilms and bacterial imbalances in chronic wounds: Anti-Koch. Int. Wound J. 2010, 7, 169–175. [Google Scholar] [CrossRef] [PubMed]
- Aleksandrowicz, H.; Owczarczyk-Saczonek, A.; Placek, W. Venous Leg Ulcers: Advanced Therapies and New Technologies. Biomedicines 2021, 9, 1569. [Google Scholar] [CrossRef] [PubMed]
- Flatscher, J.; Pavez Loriè, E.; Mittermayr, R.; Meznik, P.; Slezak, P.; Redl, H.; Slezak, C. Pulsed Electromagnetic Fields (PEMF)-Physiological Response and Its Potential in Trauma Treatment. Int. J. Mol. Sci. 2023, 24, 11239. [Google Scholar] [CrossRef] [PubMed]
- Lietz-Kijak, D.; Ardan, R. Physiotherapeutic Reduction of Orofacial Pain Using Extremely Low-Frequency Electromagnetic Field and Light-Emitting Diode Therapy-A Pilot Study. Pain. Res. Manag. 2022, 2022, 3115154. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Guarino, M.; Bacci, S.; Pérez González, L.A.; Bermejo-Martínez, M.; Cecilia-Matilla, A.; Hernández-Bule, M.L. The Role of Physical Therapies in Wound Healing and Assisted Scarring. Int. J. Mol. Sci. 2023, 24, 7487. [Google Scholar] [CrossRef] [PubMed]
- Aziz, Z.; Cullum, N. Electromagnetic therapy for treating venous leg ulcers. Cochrane Database Syst. Rev. 2015, 2015, CD002933. [Google Scholar] [CrossRef] [PubMed]
- Asci, H.; Savran, M.; Comlekci, S.; Sofu, M.M.; Erzurumlu, Y.; Ozmen, O.; Kaynak, M.; Sahin, M.E.; Taner, R.; Gecin, M. Combined Pulsed Magnetic Field and Radiofrequency Electromagnetic Field Enhances MMP-9, Collagen-4, VEGF Synthesis to Improve Wound Healing Via Hif-1α/eNOS Pathway. Aesthetic Plast. Surg. 2023, 47, 2841–2852. [Google Scholar] [CrossRef]
- Kubat, N.J.; Moffett, J.; Fray, L.M. Effect of pulsed electromagnetic field treatment on programmed resolution of inflammation pathway markers in human cells in culture. J. Inflamm. Res. 2015, 8, 59–69. [Google Scholar] [CrossRef]
- Costantini, E.; Aielli, L.; Serra, F.; De Dominicis, L.; Falasca, K.; Di Giovanni, P.; Reale, M. Evaluation of Cell Migration and Cytokines Expression Changes under the Radiofrequency Electromagnetic Field on Wound Healing In Vitro Model. Int. J. Mol. Sci. 2022, 23, 2205. [Google Scholar] [CrossRef]
- Peng, L.; Fu, C.; Xiong, F.; Zhang, Q.; Liang, Z.; Chen, L.; He, C.; Wei, Q. Effectiveness of Pulsed Electromagnetic Fields on Bone Healing: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Bioelectromagnetics 2020, 41, 323–337. [Google Scholar] [CrossRef] [PubMed]
- Gualdi, G.; Monari, P.; Farisoglio, C.; Calzavara-Pinton, P. Nested graft in chronic wounds: A new solution for an old problem. Int. Wound J. 2011, 8, 127–131. [Google Scholar] [CrossRef]
- Gualdi, G.; Crotti, S.; Monari, P.; Calzavara-Pinton, P.; Vitali, M.; Baronio, M.; Lougaris, V. The nested graft acts by inducing the process of de-senescence of the fibroblasts in chronic venous ulcers. Int. Wound J. 2016, 13, 1104–1110. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Mendez, M.V.; Stanley, A.; Park, H.Y.; Shon, K.; Phillips, T.; Menzoian, J.O. Fibroblasts cultured from venous ulcers display cellular characteristics of senescence. J. Vasc. Surg. 1998, 28, 876–883. [Google Scholar] [CrossRef]
- Rai, V.; Moellmer, R.; Agrawal, D.K. Role of fibroblast plasticity and heterogeneity in modulating angiogenesis and healing in the diabetic foot ulcer. Mol. Biol. Rep. 2023, 50, 1913–1929. [Google Scholar] [CrossRef]
- Blyakhman, F.A.; Melnikov, G.Y.; Makarova, E.B.; Fadeyev, F.A.; Sedneva-Lugovets, D.V.; Shabadrov, P.A.; Volchkov, S.O.; Mekhdieva, K.R.; Safronov, A.P.; Fernández Armas, S.; et al. Effects of Constant Magnetic Field to the Proliferation Rate of Human Fibroblasts Grown onto Different Substrates: Tissue Culture Polystyrene, Polyacrylamide Hydrogel and Ferrogels γ-Fe2O3 Magnetic Nanoparticles. Nanomaterials 2020, 10, 1697. [Google Scholar] [CrossRef]
- Costantini, E.; Sinjari, B.; D’Angelo, C.; Murmura, G.; Reale, M.; Caputi, S. Human Gingival Fibroblasts Exposed to Extremely Low-Frequency Electromagnetic Fields: In Vitro Model of Wound-Healing Improvement. Int. J. Mol. Sci. 2021, 22, 2108. [Google Scholar] [CrossRef]
- Zafari, J.; Javani Jouni, F.; Abdolmaleki, P.; Jalali, A.; Khodayar, M.J. Investigation on the effect of static magnetic field up to 30 mT on viability percent, proliferation rate and IC50 of HeLa and fibroblast cells. Electromagn. Biol. Med. 2015, 34, 216–220. [Google Scholar] [CrossRef] [PubMed]
- Jonsson, C.E.; Anggård, E. Biosynthesis and metabolism of prostaglandin E 2 in human skin. Scand. J. Clin. Lab. Invest. 1972, 29, 289–296. [Google Scholar] [CrossRef]
- Jouvenaz, G.H.; Nugteren, D.H.; Beerthuis, R.K.; van Dorp, D.A. A sensitive method for the determination of prostaglandins by gas chromatography with electron-capture detection. Biochim. Biophys. Acta 1970, 202, 231–234. [Google Scholar] [CrossRef] [PubMed]
- Pyrillou, K.; Burzynski, L.C.; Clarke, M.C.H. Alternative Pathways of IL-1 Activation, and Its Role in Health and Disease. Front. Immunol. 2020, 11, 613170. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Huang, H.; Guo, Z.; Chang, Y.; Li, Z. Role of prostaglandin E2 in tissue repair and regeneration. Theranostics 2021, 11, 8836–8854. [Google Scholar] [CrossRef] [PubMed]
- Owen, J.B.; Butterfield, D.A. Measurement of oxidized/reduced glutathione ratio. Methods Mol. Biol. 2010, 648, 269–277. [Google Scholar] [CrossRef]
- Wall, I.B.; Moseley, R.; Baird, D.M.; Kipling, D.; Giles, P.; Laffafian, I.; Price, P.E.; Thomas, D.W.; Stephens, P. Fibroblast dysfunction is a key factor in the non-healing of chronic venous leg ulcers. J. Investig. Dermatol. 2008, 128, 2526–2540. [Google Scholar] [CrossRef]
- Maddipati, K.R. Non-inflammatory Physiology of “Inflammatory” Mediators—Unalamation, a New Paradigm. Front. Immunol. 2020, 11, 580117. [Google Scholar] [CrossRef]
- Megha, K.B.; Joseph, X.; Akhil, V.; Mohanan, P.V. Cascade of immune mechanism and consequences of inflammatory disorders. Phytomedicine 2021, 91, 153712. [Google Scholar] [CrossRef]
- Xiao, T.; Yan, Z.; Xiao, S.; Xia, Y. Proinflammatory cytokines regulate epidermal stem cells in wound epithelialization. Stem Cell Res. Ther. 2020, 11, 232. [Google Scholar] [CrossRef]
- Larouche, J.; Sheoran, S.; Maruyama, K.; Martino, M.M. Immune Regulation of Skin Wound Healing: Mechanisms and Novel Therapeutic Targets. Adv. Wound Care 2018, 7, 209–231. [Google Scholar] [CrossRef]
- Gan, M.S.; Yang, B.; Fang, D.L.; Wu, B.L. IL-1B can serve as a healing process and is a critical regulator of diabetic foot ulcer. Ann. Transl. Med. 2022, 10, 179. [Google Scholar] [CrossRef]
- Lee, M.K.S.; Sreejit, G.; Nagareddy, P.R.; Murphy, A.J. Attack of the NETs! NETosis primes IL-1β-mediated inflammation in diabetic foot ulcers. Clin. Sci. 2020, 134, 1399–1401. [Google Scholar] [CrossRef]
- Pentland, A.P.; Needleman, P. Modulation of keratinocyte proliferation in vitro by endogenous prostaglandin synthesis. J. Clin. Investig. 1986, 77, 246–251. [Google Scholar] [CrossRef]
- Uematsu, S.; Matsumoto, M.; Takeda, K.; Akira, S. Lipopolysaccharide-dependent prostaglandin E(2) production is regulated by the glutathione-dependent prostaglandin E(2) synthase gene induced by the Toll-like receptor 4/MyD88/NF-IL6 pathway. J. Immunol. 2002, 168, 5811–5816. [Google Scholar] [CrossRef]
- Ganesh, K.; Das, A.; Dickerson, R.; Khanna, S.; Parinandi, N.L.; Gordillo, G.M.; Sen, C.K.; Roy, S. Prostaglandin E₂ induces oncostatin M expression in human chronic wound macrophages through Axl receptor tyrosine kinase pathway. J. Immunol. 2012, 189, 2563–2573. [Google Scholar] [CrossRef]
- Mudge, B.P.; Harris, C.; Gilmont, R.R.; Adamson, B.S.; Rees, R.S. Role of glutathione redox dysfunction in diabetic wounds. Wound Repair. Regen. 2002, 10, 52–58. [Google Scholar] [CrossRef]
- Latifa, K.; Sondess, S.; Hajer, G.; Manel, B.H.; Souhir, K.; Nadia, B.; Abir, J.; Salima, F.; Abdelhedi, M. Evaluation of physiological risk factors, oxidant-antioxidant imbalance, proteolytic and genetic variations of matrix metalloproteinase-9 in patients with pressure ulcer. Sci. Rep. 2016, 6, 29371. [Google Scholar] [CrossRef]
- Calcabrini, C.; Mancini, U.; De Bellis, R.; Diaz, A.R.; Martinelli, M.; Cucchiarini, L.; Sestili, P.; Stocchi, V.; Potenza, L. Effect of extremely low-frequency electromagnetic fields on antioxidant activity in the human keratinocyte cell line NCTC 2544. Biotechnol. Appl. Biochem. 2017, 64, 415–422. [Google Scholar] [CrossRef]
- Martinelli, I.; Cinato, M.; Keita, S.; Marsal, D.; Antoszewski, V.; Tao, J.; Kunduzova, O. Cardiac Cell Exposure to Electromagnetic Fields: Focus on Oxdative Stress and Apoptosis. Biomedicines 2022, 10, 929. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) | Amplicon Leght |
---|---|---|---|
TNFα | CCTTCCTGATCGTGGCAG | GCTTGAGGGTTTGCTACAAC | 184 bp |
TGFβ | AACAATTCCTGGCGATACCTC | GTAGTGAACCCGTTGATGTCC | 197 bp |
COX2 | GACAGTCCACCAACTTACAATG | GGCAATCATCAGGCACAGG | 105 bp |
IL6 | GTACATCCTCGACGGCATC | ACCTCAAACTCCAAAAGACCAG | 198 bp |
IL1β | TGAGGATGACTTGTTCTTTGAAG | GTGGTGGTCGGAGATTCG | 115 bp |
RPS18 | CTTTGCCATCACTGCCATTAAG | TCCATCCTTTACATCCTTCTGTC | 199 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Costantini, E.; Aielli, L.; Gualdi, G.; Baronio, M.; Monari, P.; Amerio, P.; Reale, M. Pulsed Radiofrequency Electromagnetic Fields as Modulators of Inflammation and Wound Healing in Primary Dermal Fibroblasts of Ulcers. Bioengineering 2024, 11, 357. https://doi.org/10.3390/bioengineering11040357
Costantini E, Aielli L, Gualdi G, Baronio M, Monari P, Amerio P, Reale M. Pulsed Radiofrequency Electromagnetic Fields as Modulators of Inflammation and Wound Healing in Primary Dermal Fibroblasts of Ulcers. Bioengineering. 2024; 11(4):357. https://doi.org/10.3390/bioengineering11040357
Chicago/Turabian StyleCostantini, Erica, Lisa Aielli, Giulio Gualdi, Manuela Baronio, Paola Monari, Paolo Amerio, and Marcella Reale. 2024. "Pulsed Radiofrequency Electromagnetic Fields as Modulators of Inflammation and Wound Healing in Primary Dermal Fibroblasts of Ulcers" Bioengineering 11, no. 4: 357. https://doi.org/10.3390/bioengineering11040357