Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Sequence Analysis
2.3. RNA Extraction, cDNA Synthesis, and Gene Expression
2.4. Processing by Histological Techniques
2.5. Statistical Analysis
3. Results
3.1. Sequence Analysis and Phylogenetics
3.2. Gene Expression Analysis
3.3. Morphological Characterization of Adult Testes and Ovaries
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Márquez-Couturier, G.; Vázquez-Navarrete, C.J. State of the art of biology and breeding of tropical gar (Atractosteus tropicus). AgroProductividad 2015, 8, 44–51. Available online: https://www.revista-agroproductividad.org/index.php/agroproductividad/article/view/660 (accessed on 11 January 2025).
- Márquez-Couturier, G.; Vázquez-Navarrete, C.J.; Contreras-Sánchez, W.M.; Álvarez-González, C.A. Acuicultura Tropical Sustentable: Una Estrategia para la Producción y Conservación del Pejelagarto (Atractosteus Tropicus) en Tabasco, México, 2nd ed.; Universidad Juárez Autónoma de Tabasco: Villahermosa, Tabasco, México, 2015. [Google Scholar] [CrossRef]
- Barrientos-Villalobos, J.; Espinosa, M.A. Genetic variation and recent population history of the tropical gar Atractosteus tropicus Gill (Pisces: Lepisosteidae). J. Fish. Biol. 2008, 73, 1919–1936. [Google Scholar] [CrossRef]
- Brighton, N.C.; Dai-Mingshu, U.; Mustapha, F.; Li, X.; Liu, L.; Huang, H.; Li, G.; Chen, H. Current research and future perspectives of GH and IGFs family genes in somatic growth and reproduction of teleost fish. Aquac. Rep. 2022, 26, 101289. [Google Scholar] [CrossRef]
- Lu, G.; Luo, M. Genomes of major fishes in world fisheries and aquaculture: Status, application and perspective. Aqua Fish. 2020, 5, 163–173. [Google Scholar] [CrossRef]
- Navarro-Martín, L.; Galay-Burgos, M.; Piferrer, F.; Sweeney, G. Characterisation and expression during sex differentiation of Sox19 from the sea bass Dicentrarchus labrax. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2012, 163, 316–323. [Google Scholar] [CrossRef] [PubMed]
- Nagahama, Y.; Chakraborty, T.; Paul-Prasanth, B.; Ohta, K.; Nakamura, M. Sex determination, gonadal sex differentiation, and plasticity in vertebrate species. Physiol. Rev. 2021, 101, 1237–1308. [Google Scholar] [CrossRef]
- Arias-Rodríguez, L.; Páramo-Delgadillo, S.; Contreras-Sánchez, W.M.; Álvarez-González, C.A. Cariotipo del pejelagarto tropical Atractosteus tropicus (Lepisosteiformes: Lepisosteidae) y variación cromosómica en sus larvas y adultos. Rev. Biol. Trop. 2009, 57, 529–539. [Google Scholar] [CrossRef]
- Forconi, M.; Canapa, A.; Barucca, M.; Biscotti, M.A.; Capriglione, T. Characterization of sex determination and sex differentiation genes in Latimeria. PLoS ONE 2013, 8, e56006. [Google Scholar] [CrossRef]
- Rodríguez-Pulido, J.A.; Mira-López, T.M.; Cruz-Casallas, P.E. Determinación, diferenciación sexual y pubertad en peces. Orinoquia 2018, 22, 80–91. [Google Scholar] [CrossRef]
- Sharma, P.; Purohit, S.; Kothiyal, S.; Negi, S.; Bhattacharya, I. Sex specific transcriptional regulation of gonadal steroidogenesis in teleost fishes. Front. Endocrinol. 2022, 13, 820241. [Google Scholar] [CrossRef]
- Shoemaker, C.; Ramsey, M.; Queen, J.; Crews, D. Expression of Sox9, Mis, and Dmrt1 in the gonad of a species with temperature-dependent sex determination. Dev. Dyn. 2007, 236, 1055–1063. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.; Liu, S.; Gao, X.; Jiang, Y.; Perera, D. Male-biased genes in catfish as revealed by RNA-seq analysis of the testis transcriptome. PLoS ONE 2013, 8, 7. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Jiang, S.; Wang, H.; Zhou, Y.; Peng, F.; Zhang, X.; Zhou, Y.; Guo, S.; You, Y. Transcriptome sequencing analysis reveals dynamic changes in major biological functions during the early development of clearhead icefish, Protosalanx chinensis. Fishes 2022, 7, 115. [Google Scholar] [CrossRef]
- Berbejillo, J.; Bengochea-Martinez, A.; Bedo, G.; Brunet, F.; Volff, J.N.; Vizziano-Cantonnet, D. Expression and phylogeny of candidate genes for sex differentiation in a primitive fish species, the Siberian sturgeon, Acipenser baerii. Mol. Reprod. Develop. 2012, 79, 504–516. [Google Scholar] [CrossRef] [PubMed]
- Braasch, I.; Schartl, M.; Volff, J.N. Evolution of pigment synthesis pathways by gene and genome duplication in fish. BMC Evol. Biol. 2007, 7, 74. [Google Scholar] [CrossRef]
- Baron, D.; Cocquet, J.; Xia, X.; Fellous, M.; Guiguen, Y.; Veitia, R.A. An evolutionary and functional analysis of FoxL2 in rainbow trout gonad differentiation. J. Mol. Endocrinol. 2004, 33, 705–715. [Google Scholar] [CrossRef] [PubMed]
- Crespo, B.; Lan-Chow-Wing, O.; Rocha, A.; Zanuy, S.; Gómez, A. Foxl2 and foxl3 are two ancient paralogs that remain fully functional in teleosts. Gen. Comp. Endocrinol. 2013, 194, 81–93. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Zhang, X.; Liu, S.; Zhao, C.; Miao, Y.; Jin, L.; Wang, D.; Zhou, L. Cyp17a1 is required for female sex determination and male fertility by regulating sex steroid biosynthesis in fish. Endocrinology 2021, 162, 12. [Google Scholar] [CrossRef]
- Zhang, W.; Lu, H.; Jiang, H.; Li, M.; Zhang, S.; Liu, Q.; Zhang, L. Isolation and characterization of cyp19a1a and cyp19a1b promoters in the protogynous hermaphrodite orange-spotted grouper (Epinephelus coioides). Gen. Comp. Endocrinol. 2012, 175, 473–487. [Google Scholar] [CrossRef]
- Hagihara, R.; Yamashita, S.; Yamamoto, M.; Ishihara, T.A.; Ljiri, S.; Adachi, S. Identification of genes involved in gonadal sex differentiation and the dimorphic expression pattern in undifferentiated gonads of Russian sturgeon Acipenser gueldenstaedtii Brandt & Ratzeburg 1833. J. Appl. Ichthyol. 2014, 30, 1557–1564. [Google Scholar] [CrossRef]
- Okada, H.; Seishi, H.; Katsumasa, Y.; Shigeho, L.; Shinji, A. Expression pattern of foxl2 and dmrt1 in gonad of Amur sturgeon Acipenser schrenckii in relation to sex differentiation. Aquaculture 2017, 479, 712–720. [Google Scholar] [CrossRef]
- Kobayashi, T.; Kajiura-Kobayashi, H.; Guan, G.; Nagahama, Y. Sexual dimorphic expression of DMRT1 and Sox9a during gonadal differentiation and hormone-induced sex reversal in the teleost fish Nile tilapia (Oreochromis niloticus). Dev. Dyn. 2008, 237, 297–306. [Google Scholar] [CrossRef]
- Bertho, S.; Pasquier, J.; Pan, Q.; Le Trionnaire, G.; Bobe, J.; Postlethwait, J.H.; Pailhoux, E.; Schartl, M.; Herpin, A.; Guiguen, Y. Foxl2 and its relatives are evolutionary conserved players in gonadal sex differentiation. Sex. Dev. 2016, 10, 111–129. [Google Scholar] [CrossRef] [PubMed]
- Méndez-Marín, O.; Hernández-Franyuti, A.A.; Álvarez-González, C.A.; Contreras-Sánchez, W.M.; Uribe, M.C. Histología del ciclo reproductor de hembras del pejelagarto Atractosteus tropicus (Lepisosteiformes: Lepisosteidae) en Tabasco, México. Rev. Biol. Trop. 2012, 60, 1857–1871. [Google Scholar] [CrossRef] [PubMed][Green Version]
- NOM-062-ZOO-1999. Norma Oficial Mexicana: Especificaciones Técnicas Para la Producción, Cuidado y Uso de los Animales de Laboratorio 2001. Available online: https://www.gob.mx/senasica/documentos/nom-062-zoo-1999 (accessed on 21 July 2023).
- Martínez-Burguete, T.; Peña-Marin, E.S.; García-Gasca, A.; Alvarez-González, C.A.; Llera-Herrera, R. Nutrigenomic marker discovery by de novo transcriptomic sequencing during early development of the tropical gar (Atractosteus tropicus). Aquac. Res. 2021, 52, 3829–3842. [Google Scholar] [CrossRef]
- Jiménez-Martínez, L.D.; Morales, G.V.; Frias-Quintana, C.A.; Castillo-Collado, A.C.; Asencio-Alcudia, G.G.; Alvarez-Villagomez, C.S.; Peña-Marín, E.S.; Concha-Frías, B.; Alvarez-Gonzalez, C.A. Quality Evaluation of Reference Gene Expression on Different Tissues in Adults of Tropical Gar Atractosteus tropicus. Pakistan J. Zool. 2021, 1, 10. [Google Scholar] [CrossRef]
- Untergasser, A.; Ruijter, J.M.; Benes, V.; van den Hoff, M.J.B. Web-based LinRegPCR: Application for the visualization and analysis of (RT)-qPCR amplification and melting data. BMC Bioinform. 2021, 22, 398. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)). Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, M.M.E. Manual General de Técnicas Histológicas y Citoquímicas; Las prensas de ciencias, Facultad de Ciencias; The Universidad Nacional Autónoma de México, Ed.; CDMX: Mexico City, Mexico, 1996; p. 130. [Google Scholar]
- Estrada, E.; Peralta, L.; Rivas, P. Manual de Técnicas Histológicas; AGT Editor S.A. CDMX: Mexico City, Mexico, 1996. [Google Scholar]
- Humason, G.L. Animal Tissue Techniques, 3rd ed.; W. H. Freeman and Co.: New York, NY, USA, 1979. [Google Scholar]
- Selman, K.; Wallace, A.R. Cellular aspect of oocyte growth in teleosts. Zool. Sci. 1989, 6, 211–231. Available online: https://api.semanticscholar.org/CorpusID:73663381 (accessed on 9 January 2025).
- Wallace, R.A.; Selman, K. Cellular and dynamic aspects of oocyte growth in teleosts. Amer. Zool. 1981, 21, 325–343. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Yamaguchi, S.; Hirai, T.; Kitano, T. Follicle-stimulating hormone signaling and Foxl2 are involved in transcriptional regulation of aromatase gene during gonadal sex differentiation in Japanese flounder, Paralichthys olivaceus. Biochem. Biophys. Res. Commun. 2007, 359, 935–940. [Google Scholar] [CrossRef] [PubMed]
- Zuber, M.X.; Simpson, E.R.; Waterman, M.R. Expression of bovine 17 alpha-hydroxylase cytochrome P-450 cDNA in nonsteroidogenic (COS 1) cells. Science 1986, 234, 1258–1261. [Google Scholar] [CrossRef]
- Braasch, I.; Gehrke, A.R.; Smith, J.J.; Kawasaki, K.; Manousaki, T.; Pasquier, J.; Amores, A.; Desvignes, T.; Batzel, P.; Catchen, J.; et al. The spotted gar genome illuminates vertebrate evolution and facilitates human-teleost comparisons. Nat. Genet. 2016, 48, 427–437. [Google Scholar] [CrossRef] [PubMed]
- Ríos-Flores, A.J.; López-Flores, S.; Martínez-Moreno, J.A.; Falcón-Romero, K.Y.; Asencio-Alcudia, G.G.; Sepúlveda-Quiroz, C.A.; Martínez-García, R.; Rodríguez-Salazar, E.; Alvarez-González, C.A.; Maldonado, E. Regeneration of the caudal fin of the evolutionary ancient tropical gar Atractosteus tropicus. BMC Zool. 2024, 9, 26. [Google Scholar] [CrossRef] [PubMed]
- Bocka, S.L.; Chowa, I.M.; Forsgrenb, L.K.; Lemaa, C.S. Widespread alterations to hypothalamic-pituitary-gonadal (HPG) axis signaling underlie high temperature reproductive inhibition in the eurythermal sheepshead minnow (Cyprinodon variegatus). Mol. Cell. Endocrinol. 2021, 537, 111447. [Google Scholar] [CrossRef] [PubMed]
- Rauschemberger, M.B.; Polini, N.N.; Sola, M.O.; Bonacorsi, S.M.; Massheimer, V.L. Receptor de estrógenos: Variantes genéticas del ESR1 y parámetros bioquímicos de riesgo cardiovascular. Rev. Argent. Endocrinol. Metab. 2012, 49, 2. [Google Scholar]
- Vissio, G.P.; Di Yorio, P.M.; Pérez-Sirkin, D.; Somoza, M.G.; Tsutsui, K.; Sallemi, E.J. Developmental aspects of the hypothalamic-pituitary network related to reproduction in teleost fish. Front. Neuroendocrinol. 2021, 63, 100948. [Google Scholar] [CrossRef] [PubMed]
- Karube, M.; Fernandino, J.I.; Strobl–Mazzulla, P.; Strüssmann, C.A.; Yoshizaki, G.; Somoza, G.M.; Patiño, R. Characterization and expression profile of the ovarian cytochrome P-450 aromatase (cyp19A1) gene during thermolabile sex determination in pejerrey, Odontesthes bonariensis. J. Exp. Zool. A Ecol. Genet. Physiol. 2007, 307A, 625–636. [Google Scholar] [CrossRef] [PubMed]
- Leet, K.J.; Gallb, E.H.; Sepúlveda, S.M. A review of studies on androgen and estrogen exposure in fish early life stages: Effects on gene and hormonal control of sexual differentiation. J. Appl. Toxicol. 2011, 31, 379–398. [Google Scholar] [CrossRef]
- Sawyer, S.J.; Gerstner, K.A.; Callard, G.V. Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: Gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation. Gen. Comp. Endocrinol. 2006, 147, 108–117. [Google Scholar] [CrossRef]
- Uno, T.; Ishizukab, M.; Itakurac, T. Cytochrome P450 (CYP) in fish. Environ. Toxicol. Pharmacol. 2012, 34, 11–13. [Google Scholar] [CrossRef]
- Chang, X.; Kobayashi, T.; Senthilkumaran, B.; Kobayashi-Kajura, H.; Sudhakumari, C.; Nagahama, Y. Two types of aromatase with different encoding genes, tissue distribution and developmental expression in Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol. 2005, 141, 101–115. [Google Scholar] [CrossRef] [PubMed]
- Guan, G.; Kobayashi, T.; Nagahama, Y. Sexually dimorphic expression of two types of DM (Doublesex/Mab-3)-domain genes in a teleost fish, the tilapia (Oreochromis niloticus). Biochem. Biophys. Res. Commun. 2000, 272, 662–666. [Google Scholar] [CrossRef]
- Guo, Y.; Cheng, H.; Huang, X.; Gao, S.; Yu, H.; Zhou, R. Gene structure, multiple alternative splicing, and expression in gonads of zebrafish Dmrt1. Biochem. Biophys. Res. Commun. 2005, 330, 950–957. [Google Scholar] [CrossRef] [PubMed]
- Lynn, S.G.; Birge, W.J.; Shepherd, B.S. Molecular characterization and sex-specific tissue expression of estrogen receptor alpha (esr1), estrogen receptor beta (esr2a) and ovarian aromatase (cyp19a1a) in yellow perch (Perca flavescens). Comp. Biochem. Physiol B Biochem. Mol. Biol. 2008, 149, 126–147. [Google Scholar] [CrossRef]
- Herpin, A.; Schartl, M. Plasticity of gene-regulatory networks controlling sex determination: Of masters, slaves, usual suspects, newcomers, and usurpators. EMBO Rep. 2015, 16, 10. [Google Scholar] [CrossRef] [PubMed]
- Hett, A.K.; Pitra, C.; Jenneckens, I.; Ludwig, A. Characterization of Sox9 in European Atlantic Sturgeon (Acipenser sturio). J. Hered. 2005, 96, 150–154. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Symonová, R.; Majtánová, Z.; Arias-Rodriguez, L.; Morkovský, L.; Korínková, T.; Cavin, L.; Pokorná, M.J.; Doležálková, M.; Flajšhans, M.; Normandeau, E.; et al. Genome compositional organization in gars shows more similarities to mammals than to other ray-finned fish. J. Exp. Zool (Mol. Dev. Evol) 2017, 328, 607–619. [Google Scholar] [CrossRef]
- Blanco, A.M. Hypothalamic and pituitary derived growth and reproductive hormones T and the control of energy balance in fish. Gen. Comp. Endocrinol. 2020, 287, 113322. [Google Scholar] [CrossRef]
- Matson, C.K.; Zarkower, D. Sex and the singular DM domain: Insights into sexual regulation, evolution and plasticity. Nat. Rev. Genet. 2012, 13, 163–174. [Google Scholar] [CrossRef] [PubMed]
- Ijiri, S.; Kaneko, H.; Kobayashi, T.; Wang, D.-S.; Sakai, F.; Paul-Prasanth, B.; Nakamura, M.; Nagahama, Y. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol. Reprod. 2008, 78, 333–341. [Google Scholar] [CrossRef] [PubMed]
- Barsoum, I.B.; Yao, H.C. Fetal Leydig cells: Progenitor cell maintenance and differentiation. J. Androl. 2010, 31, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Méndez-Marín, O.; Hernández-Franyuti, A.A.; Álvarez-González, C.A.; Uribe, M.C.; Contreras-Sánchez, W.M. Permanent germinal epithelium and reproductive cycle of Atractosteus tropicus (Lepisosteiformes: Lepisosteidae) males, Tabasco, México. Rev. Biol. Trop. 2016, 64, 1597–1609. [Google Scholar] [CrossRef] [PubMed]
- Amores, A.; Catchen, J.; Ferrara, A.; Fontenot, Q.; Postlethwait, J.H. Genome evolution and meiotic maps by massively parallel DNA sequencing: Spotted Gar, an outgroup for the teleost genome duplication. Genetics 2011, 188, 799–808. [Google Scholar] [CrossRef]
- Chena, G.; Zhoua, T.; Caoa, J.; Zoua, G.; Lianga, H. Comparative transcriptome sequencing and weighted coexpression network analysis reveal growth-related hub genes and key pathways in the Chinese soft-shelled turtle (Pelodiscus sinensis). Water Biol. Secur. 2024, 3, 100286. [Google Scholar] [CrossRef]
Sex | TW | TL | SL | Eviscerated Weight | Viscera Weight | LW |
---|---|---|---|---|---|---|
Male | 159.0 | 32.8 | 27.9 | 142.0 | 17.0 | 2.6 |
100.1 | 39.8 | 25.0 | 91.9 | 8.2 | 1.5 | |
154.2 | 31.4 | 26.7 | 129.9 | 24.3 | 1.8 | |
119.8 | 30 | 25.2 | 106.7 | 13.1 | 1.8 | |
162.3 | 32.4 | 27.8 | 140.7 | 21.6 | 2.5 | |
Female | 163.0 | 31.2 | 27.0 | 134.6 | 28.4 | 2.0 |
581.1 | 49.3 | 41.7 | 509.8 | 71.3 | 7.7 | |
583.4 | 40.5 | 44.5 | 528.4 | 55.0 | 8.6 | |
366.8 | 43.7 | 36.7 | 332.3 | 34.5 | 5.6 |
Aim Gene | Primer Sequence (5’-3’) | Amplification Efficiency (%) | Reference |
---|---|---|---|
Foxl2 | FW: AAC CTG AGC CTC AAC GAG TG RV: ACT GCA AGT ACT TCG GTG GG | 90.45 | On record by NCBI |
Cyp17a1 | FW: AGC TAC AAC GAT GGC ACA CA RV: TGT TGT TCT CTG AGC TGC GT | 90.03 | On record by NCBI |
Sox9 | FW: AGT GTC TTT CTG ATG CCC CG RV: ACG GGG AAT TTG TCG TCC TC | 84.66 | On record by NCBI |
Cyp19a1 | FW: GTT ACT CGG CAG CTA CGT GA RV: TGA AGT GCG TTG CCT ACG AT | 92.18 | On record by NCBI |
Dmrt1 | FW: CAG CAG GCC ATT ACCTCA GT RV: TGT CCA AAG AGG GGT TGCAG | 83.58 | On record by NCBI |
β-actin | FW: GAGCTATGAGCTGCCTGAGTGG RV: GTGGTCTCATGAATGCCACAGG | 97.10 | Jiménez-Martínez et al. [28] |
Sex | TGW (g) | RGW (g) | LGW (g) | T (µm) | Oo (µm) |
---|---|---|---|---|---|
Male | 5.2 | 2.7 | 2.5 | 120.7 | |
6.4 | 2.1 | 4.3 | 121.1 | ||
7.0 | 2.7 | 4.2 | 121.1 | ||
11.5 | 5.6 | 5.9 | 129.4 | ||
13.2 | 6.4 | 6.8 | 132.8 | ||
Female | 1.1 | 0.5 | 0.6 | 2.44 | |
4.1 | 1.9 | 2.2 | 1.68 | ||
10.0 | 4.8 | 5.2 | 3.07 | ||
28.8 | 15.8 | 13.0 | 3.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Méndez-Marin, O.; Jiménez-Badillo, M.d.L.; Álvarez-Villagomez, C.S.; Martínez-Burguete, T.; Rodriguez-Estrada, U.; Asencio-Alcudia, G.G.; Pérez-Jiménez, G.M.; Galindo-Cortés, G.; Arenas-Fuentes, V.E.; Martínez-García, R.; et al. Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus). Fishes 2025, 10, 94. https://doi.org/10.3390/fishes10030094
Méndez-Marin O, Jiménez-Badillo MdL, Álvarez-Villagomez CS, Martínez-Burguete T, Rodriguez-Estrada U, Asencio-Alcudia GG, Pérez-Jiménez GM, Galindo-Cortés G, Arenas-Fuentes VE, Martínez-García R, et al. Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus). Fishes. 2025; 10(3):94. https://doi.org/10.3390/fishes10030094
Chicago/Turabian StyleMéndez-Marin, Otilio, María de Lourdes Jiménez-Badillo, Carina Shianya Álvarez-Villagomez, Talhia Martínez-Burguete, Uriel Rodriguez-Estrada, Gloria Gertrudys Asencio-Alcudia, Graciela María Pérez-Jiménez, Gabriela Galindo-Cortés, Virgilio Eugenio Arenas-Fuentes, Rafael Martínez-García, and et al. 2025. "Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus)" Fishes 10, no. 3: 94. https://doi.org/10.3390/fishes10030094
APA StyleMéndez-Marin, O., Jiménez-Badillo, M. d. L., Álvarez-Villagomez, C. S., Martínez-Burguete, T., Rodriguez-Estrada, U., Asencio-Alcudia, G. G., Pérez-Jiménez, G. M., Galindo-Cortés, G., Arenas-Fuentes, V. E., Martínez-García, R., Jiménez-Martínez, L. D., & Alvarez-González, C. A. (2025). Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus). Fishes, 10(3), 94. https://doi.org/10.3390/fishes10030094