Long Non-Coding RNA MAGI2-AS3 is a New Player with a Tumor Suppressive Role in High Grade Serous Ovarian Carcinoma
Abstract
:1. Introduction
2. Results
2.1. Identification of Significantly Dysregulated Non-coding RNAs that Are Physiologically Relevant in HGSC
2.2. Expression and Regulation of MAGI2-AS3 in Epithelial Ovarian Cancer Cell Lines
2.3. Expression of MAGI2-AS3 in EOC Cell Lines Decreases Their Adhesion to Extra Cellular Matrix, Migration, and Viability
2.4. MAGI2-AS3 Acts as A Competing Endogenous LncRNA in HGSC and Controls the Expression of miRNAs and Target mRNAs
2.5. Expression of the Tumor Suppressor mRNAs Abrogated by miRNA in HGSC Can Be Restored by MAGI2-AS3 Introduction
2.6. Identification of Enriched GO Bioprocesses and Construction of MAGI2-AS3 ceRNA Network in HGSC
3. Discussion
4. Materials and Methods
4.1. Differential Analysis of Coding and Long Non-coding RNAs
4.2. Expression of MAGI2-AS3 in Various Cancers
4.3. Venn Diagrams
4.4. Cell Lines and Culture Methods
4.5. Treatment with AZA
4.6. Plasmid Preparation
4.7. RNA, cDNA and qRT-PCR
4.8. Migration Assay
4.9. Adhesion Assay
4.10. Viability Assay
4.11. Differential miRNA Analysis
4.12. miRNA Extraction, RT and qPCR
4.13. Correlation Plots
4.14. miRNA-mRNA Targets
4.15. MAGI2-AS3 ceRNA Network Prediction
4.16. Figure for Graphical Abstract:
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chen, V.W.; Ruiz, B.; Killeen, J.L.; Coté, T.R.; Wu, X.C.; Correa, C.N. Pathology and classification of ovarian tumors. Cancer 2003, 97, 2631–2642. [Google Scholar] [CrossRef] [PubMed]
- Torre, L.A.; Trabert, B.; DeSantis, C.E.; Miller, K.D.; Samimi, G.; Runowicz, C.D.; Gaudet, M.M.; Jemal, A.; Siegel, R.L. Ovarian cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Testa, U.; Petrucci, E.; Pasquini, L.; Castelli, G.; Pelosi, E. Ovarian Cancers: Genetic Abnormalities, Tumor Heterogeneity and Progression, Clonal Evolution and Cancer Stem Cells. Medicines 2018, 5, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holmes, D. Ovarian cancer: Beyond resistance. Nature 2015, 527, S217. [Google Scholar] [CrossRef] [Green Version]
- Seidman, J.D.; Ronnett, B.M.; Shih, I.-M.; Cho, K.R.; Kurman, R.J. Epithelial Tumors of the Ovary. In Blaustein’s Pathology of the Female Genital Tract; Kurman, R.J., Hedrick Ellenson, L., Ronnett, B.M., Eds.; Springer: New York, NY, USA, 2018; pp. 1–128. ISBN 978-1-4614-3165-7. [Google Scholar]
- Kurman, R.J.; Shih, I.M. The dualistic model of ovarian carcinogenesis revisited, revised, and expanded. Am. J. Pathol. 2016, 186, 733–747. [Google Scholar] [CrossRef] [Green Version]
- Prat, J. Ovarian carcinomas: Five distinct diseases with different origins, genetic alterations, and clinicopathological features. Virchows Arch. 2012, 460, 237–249. [Google Scholar] [CrossRef]
- Tworoger, S.S.; Shafrir, A.L.; Hankinson, S.E. Ovarian cancer. Schottenfeld Fraumeni Cancer Epidemiol. 2017, 384, 889–908. [Google Scholar]
- Kindelberger, D.W.; Lee, Y.; Miron, A.; Hirsch, M.S.; Feltmate, C.; Medeiros, F.; Callahan, M.J.; Garner, E.O.; Gordon, R.W.; Birch, C.; et al. Intraepithelial carcinoma of the fimbria and pelvic serous carcinoma: Evidence for a causal relationship. Am. J. Surg. Pathol. 2007, 31, 161–169. [Google Scholar] [CrossRef] [Green Version]
- Palazzo, A.F.; Lee, E.S. Non-coding RNA: What is functional and what is junk? Front. Genet. 2015, 6, 2. [Google Scholar] [CrossRef] [Green Version]
- Morillon, A. Long Non-Coding RNA, 1st ed.; Maurel, M.-C., Ed.; Elsevier Ltd.: London, UK, 2018; ISBN 978-1-78548-265-6. [Google Scholar]
- Rinn, J.L.; Chang, H.Y. Genome regulation by long noncoding RNAs. Annu. Rev. Biochem. 2012, 81, 145–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lorenzi, L.; Cobos, F.A.; Decock, A.; Verboom, K.; Lefever, S.; Vandesompele, J.; Mestdagh, P. Long noncoding RNA expression profiling in cancer: Challenges and opportunities. Genes Chromosom. Cancer 2019, 58, 191–199. [Google Scholar] [CrossRef] [PubMed]
- Salviano-Silva, A.; Lobo-Alves, S.; Almeida, R.; Malheiros, D.; Petzl-Erler, M. Besides Pathology: Long Non-Coding RNA in Cell and Tissue Homeostasis. Non-Coding RNA 2018, 4, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, L.; Bajic, V.B.; Zhang, Z. On the classification of long non-coding RNAs. RNA Biol. 2013, 10, 924–933. [Google Scholar] [CrossRef]
- Liz, J.; Esteller, M. lncRNAs and microRNAs with a role in cancer development. BBA Gene Regul. Mech. 2016, 1859, 169–176. [Google Scholar] [CrossRef] [Green Version]
- Tripathi, M.K.; Doxtater, K.; Keramatnia, F.; Zacheaus, C.; Yallapu, M.M.; Jaggi, M.; Chauhan, S.C. Role of lncRNAs in ovarian cancer: Defining new biomarkers for therapeutic purposes. Drug Discov. Today 2018, 23, 1635–1643. [Google Scholar] [CrossRef]
- Hosseini, E.S.; Meryet-figuiere, M.; Sabzalipoor, H.; Kashani, H.H. Dysregulated expression of long noncoding RNAs in gynecologic cancers. Mol. Cancer 2017, 16, 107. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Lu, Y.; Lu, B. MicroRNA and Long Non-Coding RNA in Ovarian Carcinoma: Translational Insights and Potential Clinical Applications. Cancer Investig. 2016, 34, 465–476. [Google Scholar] [CrossRef]
- De Oliveira, J.C.; Oliveira, L.C.; Mathias, C.; Pedroso, G.A.; Lemos, D.S.; Salviano-Silva, A.; Jucoski, T.S.; Lobo-Alves, S.C.; Zambalde, E.P.; Cipolla, G.A.; et al. Long non-coding RNAs in cancer: Another layer of complexity. J. Gene Med. 2019, 21, e3065. [Google Scholar]
- Nikpayam, E.; Tasharrofi, B.; Sarrafzadeh, S.; Ghafouri-fard, S. The Role of Long Non-Coding RNAs in Ovarian Cancer. Iran. Biomed. J. 2017, 21, 3–15. [Google Scholar] [CrossRef] [Green Version]
- De Cristofaro, T.; Di Palma, T.; Soriano, A.A.; Monticelli, A.; Affinito, O.; Cocozza, S.; Zannini, M. Candidate genes and pathways downstream of PAX8 involved in ovarian high-grade serous carcinoma. Oncotarget 2016, 7, 41929. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verhaak, R.G.W.; Tamayo, P.; Yang, J.; Hubbard, D.; Zhang, H.; Creighton, C.J.; Fereday, S.; Lawrence, M.; Carter, S.L.; Mermel, C.H.; et al. Prognostically relevant gene signatures of high-grade serous ovarian carcinoma. J. Clin. Investig. 2013, 123, 517–525. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kazanets, A.; Shorstova, T.; Hilmi, K.; Marques, M.; Witcher, M. Epigenetic silencing of tumor suppressor genes: Paradigms, puzzles, and potential. Biochim. Biophys. Acta Rev. Cancer 2016, 1865, 275–288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, Y.; Wei, Y.; Gu, Y.; Zhang, S.; Lyu, J.; Zhang, B.; Chen, C.; Zhu, J.; Wang, Y.; Liu, H.; et al. DiseaseMeth version 2.0: A major expansion and update of the human disease methylation database. Nucleic Acids Res. 2017, 45, D888–D895. [Google Scholar] [CrossRef]
- Yang, Y.; Yang, H.; Xu, M.; Zhang, H.; Sun, M.; Mu, P.; Dong, T.; Du, S.; Liu, K. Long non-coding RNA (lncRNA) MAGI2-AS3 inhibits breast cancer cell growth by targeting the Fas/FasL signalling pathway. Hum. Cell 2018, 31, 232–241. [Google Scholar] [CrossRef]
- Li, J.H.; Liu, S.; Zhou, H.; Qu, L.H.; Yang, J.H. StarBase v2.0: Decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2013, 42, D92–D97. [Google Scholar] [CrossRef] [Green Version]
- Hao, X.; Yang, K. LncRNA MAGI2-AS3 suppresses the proliferation and invasion of non-small cell lung carcinoma through miRNA-23a-3p/PTEN axis. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 7399–7407. [Google Scholar]
- Yin, Z.; Ma, T.; Yan, J.; Shi, N.; Zhang, C.; Lu, X.; Hou, B.; Jian, Z. LncRNA MAGI2-AS3 inhibits hepatocellular carcinoma cell proliferation and migration by targeting the miR-374b-5p/SMG1 signaling pathway. J. Cell. Physiol. 2019, 234, 18825–18836. [Google Scholar] [CrossRef]
- Du, S.; Hu, W.; Zhao, Y.; Zhou, H.; Wen, W.; Xu, M.; Zhao, P.; Liu, K. Long non-coding RNA MAGI2-AS3 inhibits breast cancer cell migration and invasion via sponging microRNA-374a. Cancer Biomark. 2019, 24, 269–277. [Google Scholar] [CrossRef]
- Wang, F.; Zu, Y.; Zhu, S.; Yang, Y.; Huang, W.; Xie, H.; Li, G. Long noncoding RNA MAGI2-AS3 regulates CCDC19 expression by sponging miR-15b-5p and suppresses bladder cancer progression. Biochem. Biophys. Res. Commun. 2018, 507, 231–235. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Guo, G.; Wang, G.; Zhao, J.; Wang, B.; Yu, X.; Ding, Y. Profile of differentially expressed miRNAs in high-grade serous carcinoma and clear cell ovarian carcinoma, and the expression of miR-510 in ovarian carcinoma. Mol. Med. Rep. 2015, 12, 8021–8031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patch, A.M.; Christie, E.L.; Etemadmoghadam, D.; Garsed, D.W.; George, J.; Fereday, S.; Nones, K.; Cowin, P.; Alsop, K.; Bailey, P.J.; et al. Whole-genome characterization of chemoresistant ovarian cancer. Nature 2015, 521, 489–494. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.F.; Liu, Z.; Chaurasiya, S.; Dellinger, T.H.; Lu, J.; Wu, X.; Qin, H.; Wang, J.; Fong, Y.; Yuan, Y.-C. Identification of core aberrantly expressed microRNAs in serous ovarian carcinoma. Oncotarget 2018, 9, 20451–20466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, J.; Tan, Z.H.; Tang, X.; Mo, M.S.; Liu, Y.P.; Gan, R.L.; Li, Y.; Zhang, L.; Li, G.Q. miR-374b-5p suppresses RECK expression and promotes gastric cancer cell invasion and metastasis. World J. Gastroenterol. 2014, 20, 17439–17447. [Google Scholar] [CrossRef] [PubMed]
- Kedmi, M.; Ben-Chetrit, N.; Körner, C.; Mancini, M.; Ben-Moshe, N.B.; Lauriola, M.; Lavi, S.; Biagioni, F.; Carvalho, S.; Cohen-Dvashi, H.; et al. EGF induces microRNAs that target suppressors of cell migration: MiR-15b targets MTSS1 in breast cancer. Sci. Signal. 2015, 8, ra29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, F.; Tang, H.; Liu, P.; Shen, J.; Guan, X.; Xie, X.; Gao, J.; Xiong, L.; Jia, L.; Chen, J.; et al. Isoliquiritigenin modulates MIR-374a/PTEN/Akt axis to suppress breast cancer tumorigenesis and metastasis. Sci. Rep. 2017, 7, 9022. [Google Scholar] [CrossRef] [Green Version]
- Long, Z.W.; Wu, J.H.; Hong, C.; Wang, Y.N.; Zhou, Y. MiR-374b promotes proliferation and inhibits apoptosis of human GIST cells by inhibiting PTEN through activation of the PI3K/Akt pathway. Mol. Cells 2018, 41, 532–544. [Google Scholar]
- Chen, R.; Sheng, L.; Zhang, H.J.; Ji, M.; Qian, W.Q. miR-15b-5p facilitates the tumorigenicity by targeting RECK and predicts tumour recurrence in prostate cancer. J. Cell. Mol. Med. 2018, 22, 1855–1863. [Google Scholar] [CrossRef] [Green Version]
- Gendronneau, G.; Boucherat, O.; Aubin, J.; Lemieux, M.; Jeannotte, L. The loss of Hoxa5 function causes estrous acyclicity and ovarian epithelial inclusion cysts. Endocrinology 2012, 153, 1484–1497. [Google Scholar] [CrossRef] [Green Version]
- Alexius-Lindgren, M.; Andersson, E.; Lindstedt, I.; Engström, W. The RECK gene and biological malignancy-its significance in angiogenesis and inhibition of matrix metalloproteinases. Anticancer Res. 2014, 34, 3867–3874. [Google Scholar] [PubMed]
- Saga, Y.; Mizukami, H.; Takei, Y.; Ozawa, K.; Suzuki, M. Suppression of cell migration in ovarian cancer cells mediated by PTEN overexpression. Int. J. Oncol. 2003, 23, 1109–1113. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Martin, T.A.; Jordan, N.J.; Ruge, F.; Ye, L.; Jiang, W.G. Metastasis suppressor 1 expression in human ovarian cancer: The impact on cellular migration and metastasis. Int. J. Oncol. 2015, 47, 1429–1439. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.; Miller, K.; Jemal, A. Cancer statistics, 2015. CA Cancer J. Clin. 2015, 65, 29. [Google Scholar] [CrossRef] [PubMed]
- McKnight, R.; Cohen, C.; Siddiqui, M.T. Utility of paired box gene 8 (PAX8) expression in fluid and fine-needle aspiration cytology: An immunohistochemical study of metastatic ovarian serous carcinoma. Cancer Cytopathol. 2010, 118, 298–302. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhu, M.; Wang, S. Expression of long non-coding RNA MAGI2—AS3 in human gliomas and its prognostic significance. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 3455–3460. [Google Scholar] [PubMed]
- Li, J.; Chen, Y.; Guo, X.; Zhou, L.; Jia, Z.; Tang, Y.; Lin, L.; Liu, W.; Ren, C. Inhibition of miR-15b decreases cell migration and metastasis in colorectal cancer. Tumor Biol. 2016, 37, 8765–8773. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhang, L.; Yao, Q.; Tao, Z. MiR-15b regulates cisplatin resistance and metastasis by targeting PEBP4 in human lung adenocarcinoma cells. Cancer Gene Ther. 2015, 22, 108–114. [Google Scholar] [CrossRef]
- Zhang, W.L.; Zhang, J.H.; Wu, X.Z.; Yan, T.; Lv, W. MiR-15b promotes epithelial-mesenchymal transition by inhibiting SMURF2 in pancreatic cancer. Int. J. Oncol. 2015, 47, 1043–1053. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Chen, J.; Liu, Y.; Li, S.; Huang, P. Plasma miR-15b-5p, miR-338-5p, and miR-764 as biomarkers for hepatocellular carcinoma. Med. Sci. Monit. 2015, 21, 1864–1871. [Google Scholar] [CrossRef] [Green Version]
- Li, N.; Yang, L.; Wang, H.; Yi, T.; Jia, X.; Chen, C.; Xu, P. MiR-130a and MiR-374a function as novel regulators of cisplatin resistance in human ovarian cancer A2780 cells. PLoS ONE 2015, 10, e0128886. [Google Scholar] [CrossRef] [PubMed]
- Yokoi, A.; Yoshioka, Y.; Hirakawa, A.; Yamamoto, Y.; Ishikawa, M.; Ikeda, S.-i.; Kato, T.; Niimi, K.; Kajiyama, H.; Kikkawa, F.; et al. A combination of circulating miRNAs for the early detection of ovarian cancer. Oncotarget 2017, 8, 89811–89823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; Wang, W.; Su, N.; Zhu, X.; Yao, J.; Gao, W.; Hu, Z.; Sun, Y. miR-374a promotes cell proliferation, migration and invasion by targeting SRCIN1 in gastric cancer. FEBS Lett. 2015, 589, 407–413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, F.; Yuan, J.H.; Huang, J.F.; Yang, F.; Wang, T.T.; Ma, J.Z.; Zhang, L.; Zhou, C.C.; Wang, F.; Yu, J.; et al. Long noncoding RNA FTX inhibits hepatocellular carcinoma proliferation and metastasis by binding MCM2 and miR-374a. Oncogene 2016, 35, 5422–5434. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Feng, L.; Xia, D.; Han, N. MIR-374a promotes the proliferation of human osteosarcoma by downregulating FOXO1 expression. Int. J. Clin. Exp. Med. 2015, 8, 3482–3489. [Google Scholar]
- Cai, J.; Wu, J.; Li, M.; Cai, J.; Guan, H.; Fang, L.; Yang, Y.; Zhu, X.; Yuan, J. MicroRNA-374a activates Wnt/b -catenin signaling to promote breast cancer metastasis Find the latest version: MicroRNA-374a activates Wnt/β-catenin signaling to promote breast cancer metastasis. J. Clin. Investig. 2013, 123, 566–579. [Google Scholar]
- MacLean, J.A.; King, M.L.; Okuda, H.; Hayashi, K. WNT7A regulation by miR-15b in ovarian cancer. PLoS ONE 2016, 11, e0156109. [Google Scholar] [CrossRef]
- Schreiber, R.; Mezencev, R.; Matyunina, L.V.; McDonald, J.F. Evidence for the role of microRNA 374b in acquired cisplatin resistance in pancreatic cancer cells. Cancer Gene Ther. 2016, 23, 241–245. [Google Scholar] [CrossRef] [Green Version]
- Xiang, Z.; Song, S.; Zhu, Z.; Sun, W.; Gifts, J.E.; Sun, S.; Li, Q.S.; Yu, Y.; Li, K.K. LncRNAs GIHCG and SPINT1-AS1 Are Crucial Factors for Pan-Cancer Cells Sensitivity to Lapatinib. Front. Genet. 2019, 10, 25. [Google Scholar] [CrossRef]
- Moufarrij, S.; Dandapani, M.; Arthofer, E.; Gomez, S.; Srivastava, A.; Lopez-Acevedo, M.; Villagra, A.; Chiappinelli, K.B. Epigenetic therapy for ovarian cancer: Promise and progress. Clin. Epigenet. 2019, 11, 7. [Google Scholar] [CrossRef]
- Russo, A.; Czarnecki, A.A.; Dean, M.; Modi, D.A.; Lantvit, D.D.; Hardy, L.; Baligod, S.; Davis, D.A.; Wei, J.J.; Burdette, J.E. PTEN loss in the fallopian tube induces hyperplasia and ovarian tumor formation. Oncogene 2018, 37, 1976–1990. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Jiang, K.; Zhao, F. Icariin regulates the proliferation and apoptosis of human ovarian cancer cells through microRNA-21 by targeting PTEN, RECK and Bcl-2. Oncol. Rep. 2015, 33, 2829–2836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collado-Torres, L.; Nellore, A.; Kammers, K.; Ellis, S.E.; Taub, M.A.; Hansen, K.D.; Jaffe, A.E.; Langmead, B.; Leek, J.T. Reproducible RNA-seq analysis using recount2. Nat. Biotechnol. 2017, 35, 319–321. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bardou, P.; Mariette, J.; Escudié, F.; Djemiel, C.; Klopp, C. jvenn: An interactive Venn diagram viewer. BMC Bioinform. Softw. 2014, 15, 293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Francavilla, C.; Lupia, M.; Tsafou, K.; Villa, A.; Kowalczyk, K.; Rakownikow Jersie-Christensen, R.; Bertalot, G.; Confalonieri, S.; Brunak, S.; Jensen, L.J.; et al. Phosphoproteomics of Primary Cells Reveals Druggable Kinase Signatures in Ovarian Cancer. Cell Rep. 2017, 18, 3242–3256. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chou, C.H.; Shrestha, S.; Yang, C.D.; Chang, N.W.; Lin, Y.L.; Liao, K.W.; Huang, W.C.; Sun, T.H.; Tu, S.J.; Lee, W.H.; et al. MiRTarBase update 2018: A resource for experimentally validated microRNA-target interactions. Nucleic Acids Res. 2018, 46, D296–D302. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes Among Gene Clusters. Omics J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Li, R.; Qu, H.; Wang, S.; We, J.; Zhang, L.; Ma, R.; Lu, J.; Zhu, J.; Zhong, W.-D.; Jia, Z. GDCRNATools: An R/Bioconductor package for integrative analysis of lncRNA, miRNA and mRNA data in GDC. Bioinformatics 2018, 34, 2515–2517. [Google Scholar] [CrossRef] [Green Version]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A Software Environment for Integrated Models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
ABL fwd | 5’- TGGAGATAACACTCTAAGCATAACTAAAGG -3′ |
ABL rev | 5′- GATGTAGTTGCTTGGGACCCA-3′ |
MAGI2-AS3 fwd | 5′- TCTTCAAGAGCCAGGGACAG -3′ |
MAGI2-AS3 rev | 5′-TGCAGCTCAAACTCTCCAGA -3′ |
HOXA5 fwd | 5′- CAACCCCAGATCTACCCCTG -3′ |
HOXA5 rev | 5′- TTCAATCCTCCTTCTGCGGG -3′ |
MTSS1 fwd | 5′- CCTCAGTTGGACAGTGCTCT -3′ |
MTSS1 rev | 5′- GCAGTTTGTGAGGGTCCATG -3′ |
PTEN fwd | 5′- AAGCTGGAAAGGGACGAACT -3′ |
PTEN rev | 5′- TACACATAGCGCCTCTGACT -3′ |
RECK fwd | 5′- CAGACTCTTCTCCTGGTCCA -3′ |
RECK rev | 5′- TCAGGATTCTCTTGCAGGCA -3′ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gokulnath, P.; de Cristofaro, T.; Manipur, I.; Di Palma, T.; Soriano, A.A.; Guarracino, M.R.; Zannini, M. Long Non-Coding RNA MAGI2-AS3 is a New Player with a Tumor Suppressive Role in High Grade Serous Ovarian Carcinoma. Cancers 2019, 11, 2008. https://doi.org/10.3390/cancers11122008
Gokulnath P, de Cristofaro T, Manipur I, Di Palma T, Soriano AA, Guarracino MR, Zannini M. Long Non-Coding RNA MAGI2-AS3 is a New Player with a Tumor Suppressive Role in High Grade Serous Ovarian Carcinoma. Cancers. 2019; 11(12):2008. https://doi.org/10.3390/cancers11122008
Chicago/Turabian StyleGokulnath, Priyanka, Tiziana de Cristofaro, Ichcha Manipur, Tina Di Palma, Amata Amy Soriano, Mario Rosario Guarracino, and Mariastella Zannini. 2019. "Long Non-Coding RNA MAGI2-AS3 is a New Player with a Tumor Suppressive Role in High Grade Serous Ovarian Carcinoma" Cancers 11, no. 12: 2008. https://doi.org/10.3390/cancers11122008