Next Article in Journal
Urban Pest or Aussie Hero? Changing Media Representations of the Australian White Ibis
Previous Article in Journal
Metabolomics Reveals the Mechanism by Which Sodium Butyrate Promotes the Liver Pentose Phosphate Pathway and Fatty Acid Synthesis in Lactating Goats
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis

1
Fisheries College, Guangdong Ocean University, Zhanjiang 524025, China
2
Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture & Key Laboratory of Control for Diseases of Aquatic Economic Animals of Guangdong Higher Education Institutes, Zhanjiang 524025, China
3
Chinese Academy of Inspection and Quarantine, Beijing 100176, China
*
Author to whom correspondence should be addressed.
Animals 2024, 14(22), 3250; https://doi.org/10.3390/ani14223250
Submission received: 10 October 2024 / Revised: 7 November 2024 / Accepted: 11 November 2024 / Published: 13 November 2024
(This article belongs to the Section Aquatic Animals)

Simple Summary

Type III secretion system (T3SS) is an essential virulence determinant for Vibrio alginolyticus. In this study, we highlighted the significance of T3SS effector protein VopS in the V. alginolyticus infection. The vopS gene, which can promote the virulence of V. alginolyticus to Epinephelus coioides, is required for extracellular protease secretion. Also, it was demonstrated that VopS was involved not only in V. alginolyticus-mediated apoptosis but also in ferroptosis. Collectively, we identified that the VopS effector is a metabolic disruptor, promoting host cell ferroptosis.

Abstract

Vibrio alginolyticus is a Gram-negative pathogen of both marine animals and humans, resulting in significant losses for the aquaculture industry. Emerging evidence indicates that V. alginolyticus manipulates cell death for its pathogenicity, but the underlying molecular mechanisms remain unclear. Here, a gene designated vopS in V. alginolyticus HY9901 was identified, which was predicted to encode the T3SS effector protein. To determine whether VopS contributes to the pathogenesis of V. alginolyticus, the ΔvopS mutant strain was constructed and phenotypically characterized. The deletion of VopS not only reduced the ability to secrete extracellular proteases and virulence but also affected the expression of the T3SS genes. Furthermore, VopS was cytotoxic and induced apoptosis, as confirmed by elevated LDH and the activation of caspase-3. Metabolomic analysis revealed considerable metabolomic disruptions upon V. alginolyticus infection. The VopS effector induced host cell ferroptosis by promoting the synthesis of adrenic acid, depleting cellular glutathione, and subsequently increasing the accumulation of ferrous (Fe2+). Taken together, our findings provide that the VopS effector is an essential virulence factor of V. alginolyticus, which can lead to ferroptosis.

1. Introduction

Vibrio alginolyticus is a Gram-negative bacterium distributed in estuarine and marine environments [1]. Obviously, V. alginolyticus causes vibriosis in substantial fish and shrimp species, including Sparus aurata L. [2], orange-spotted grouper (Epinephelus coioides) [3], Penaeus vannamei [4], and kuruma prawn (Penaeus japonicus) [5], leading to high mortalities and severe economic losses in aquaculture worldwide. It is also a causative agent of acute gastroenteritis in humans linked to consuming water and raw seafood. Occasionally, V. alginolyticus induces wound infection and sepsis in immunocompromised individuals [6]. Consequently, it is critical to comprehend the pathophysiology of V. alginolyticus and generate a vaccine that effectively prevents vibriosis.
Type III secretion system (T3SS) is an essential virulence determinant for Gram-negative pathogenic bacteria, such as Shigella spp. [7], Salmonella spp. [8], and Yersinia spp. [9]. It is reported that T3SS directly delivers effector proteins into host cells, triggering host-cell death and manipulating the innate and adaptive immune system [10,11]. Although the T3SS machinery is usually conserved among Gram-negative bacteria, the effectors’ functions vary greatly. Although comparative genomic research showed that the T3SS of Vibrio harveyi and V. alginolyticus are comparable, little is known about the effectors of V. alginolyticus. Thus, functional characterization of T3SS effectors is essential.
To date, four T3SS effectors have been identified, including VopQ, VopR, VopS, and VPA0450 [12,13]. In particular, the VopS effector has been extensively studied and found to contribute to pathogenesis as a bacterial AMPylator [14]. After entering the host cell, VopS from V. parahaemolyticus AMPylates a threonine residue in the switch I region of Rho GTPases by Fic (filamentation induced by cAMP) domains. This acylation of Rho GTPases prevents their interaction with downstream effectors, even leading to cell damage and cell death [15]. It is also reported that VopS interferes with the activation of the host NLRC4 (NOD-like receptor CARD domain-containing 4) inflammasome during V. parahaemolyticus infection [16]. Although extensive research has been conducted, the mechanism of VopS in V. alginolyticus is unclear.
Ferroptosis is a recently discovered iron-dependent regulated cell death manifested by intracellular phospholipid peroxidation [17]. It is known that T3SS plays important roles in regulating host cellular physiological processes, but its regulatory roles and mechanisms in host ferroptosis remain elusive. Here, an in-frame deletion of vopS was performed, and then the physiology and pathogenicity of ∆ vopS were determined. Also, we analyzed the metabolic reprogramming of the CIK cells during V. alginolyticus infection and the role of the VopS effector of T3SS in modulating host cell metabolism using the LC–MS/MS system. Collectively, we identified that the VopS effector is a metabolic disruptor, promoting host cell ferroptosis.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

Vibrio alginolyticus HY9901 was stored in our laboratory and used as the wild-type strain throughout this study [1]. The V. alginolyticus HY9901 ΔvopS mutant strain was generated using double-crossover homologous recombination [18]. The strains, vectors, and primer sequences used to generate the strains are listed in Table 1 and Table 2, respectively. Bacterial strains were routinely grown in Tryptic soy broth (TSB) medium (5 g/L Soy peptone, 17 g/L tryptone, and 20 g/L NaCl) at 28 °C with shaking at 160 rpm or on TSA plates. Chloramphenicol (Cm, 30 μg/mL) was added when required for strain selection.

2.2. Experimental Fish

A total of 200 orange-spotted groupers (Epinephelus coioides) obtained from a commercial fish farm in Zhanjiang, China, were used for the animal experiments in this work. The groupers, with a mean body weight of 80.5 ± 6.8 g and a mean body length of 15.5 ± 1.2 cm, were housed in 300-L opaque tanks (20 fish per tank) at 23–25 °C for two weeks. Before the experiment, sera from three fish were randomly extracted and tested against formalin-inactivated V. alginolyticus by slide agglutination. Fish that were negative in the sera agglutination and bacteriological recovery tests were tested as described by Pang et al. [19].

2.3. Cell Culture

The CIK cell line was purchased from the Cell Storage Center of Wuhan University (Wuhan, China) and cultured in L15 medium supplemented with 10% (v/v) FBS (Gibco, New York, NY, USA).

2.4. Cloning and Sequencing of the vopS Gene from V. alginolyticus HY9901

Primers were designed according to the V. alginolyticus gene sequence (GenBank Number: KX245316). PCR was carried out in a Thermocycler (Bio-Rad, Hercules, CA, USA) with the following ideal amplification conditions: 30 cycles of 95 °C for 30 s, 55 °C for 45 s, and 72 °C for 90 s after an initial denaturation at 95 °C for 5 min. The amplification product (5 μL) was examined on 1% agarose gels, stained with ethidium bromide. Additionally, the PCR products were converted into E. coli DH5α by ligating them to the pMD18-T vector (Table 1). DNA sequencing was performed by Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). Similarity analyses of the nucleotide sequences and deduced amino acid sequences were performed according to the method of Zhou [18]. Additionally, ExPASy tools were used to analyze protein sequences (http://expasy.org/tools/), accessed on 21 May 2020.

2.5. Physiological and Pathological Characterization of ∆vopS

The ΔvopS phenotype was characterized by cell morphology, growth ability, extracellular protease (ECPase) activity, biofilm formation, swarming motility, and fifty percent lethal dose (LD50). In summary, the ΔvopS and the wild-type strain HY9901 were cultivated in TSB for 18 h, and scanning electron microscopy was used to observe the cell morphology. For growth ability analysis, bacteria were grown in TSB for 16 h, and then subcultured into fresh TSB (OD600 = 0.05) and cultured at 28 °C with shaking. ECPase activity was carried out using the previously described protocol [20]. Biofilm formation was measured using the previously published crystal violet stain method [21]. Swarming diameter was measured following a 24-h incubation period, and swarming motility was assessed using the methodology outlined by Zhou et al. [18].
The LD50 was determined according to the Tan’s method [22]. Briefly, 180 fish were haphazardly assigned to eighteen 150-L tanks (10 fish per group), each containing 120 L of sea water. The injection concentrations of HY9901, ΔvopS, and C-vopS were 104, 105, 106, 107, 108, and 109 cfu/mL. In the experimental group, 100 μL of bacterial solution was injected intramuscularly into each fish, whereas the control group received 100 μL of PBS. Mortalities of experimental fish were recorded over 14 days until the mortality rate stabilized. The morbidity induced by V. alginolyticus was determined, and the LD50 was calculated with three replicates per group.

2.6. Real-Time Quantitative PCR

The expression of T3SS-related genes was detected by real-time quantitative PCR. In brief, HY9901 and ΔvopS were cultured in DMEM medium for 12 h and were collected by centrifugation.
According to the experimental method of Li et al. [23], total RNA was extracted from all strains using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and was subsequently reverse-transcribed into cDNA with Reverse Transcriptase M-MLV (Takara, Kyoto, Japan). RT-qPCR was carried out on a Roche LightCycler® 96 System (Basel, Switzerland). The 16S rRNA gene was used as the internal control.

2.7. Hoechst 33258 Staining

Hoechst 33258 staining was used to identify apoptosis, following Burdette et al.’s instructions [24]. As controls, cells were either treated with 2 µM staurosporine or left untreated. A fluorescence microscope (Leica, Wetzlar, Germany) was used to detect the fluorescence signal at 450 nm.

2.8. Lactate Dehydrogenase (LDH) Release Assay

As previously mentioned, the V. alginolyticus strain was used to infect CIK cells. As controls, cells were either treated with 2 μM staurosporine or left untreated. As directed by the manufacturer, LDH release was quantified using a Cytotoxicity Detection kit (Jiancheng, Nanjing, China).

2.9. Caspase-3 Activity Assay

Caspase-3 activity in CIK cells was detected using the commercially available caspase-3 assay kits (Jiancheng, Nanjing, China). Briefly, at 1, 2, and 3 h, the infected cells were collected and lysed using the cell lysis buffer for 15 min on ice. To measure caspase-3 activity, 50 µL of the supernatant was combined with 50 µL of 2× reaction buffer and 5 µL of 4 mM AC-DEVD-pNA substrate after centrifugation. The reaction mixtures were incubated at 37 °C for 4 h and were subsequently measured at OD405 in a microplate spectrophotometer.

2.10. Metabolomics Analysis

CIK cells were seeded at 1 × 10 cells/well in 6-well plates and were infected for 2 h with HY9901 (MOI = 50). To remove residual medium components, the cells were subsequently harvested and washed three times with ice-cold PBS. Then, 300 μL of prechilled 80% methanol was added to the samples, which were then vortexed on ice and swirled for 30 s. Following 6 min of sonification, they were centrifuged for one minute at 5000 rpm and 4 °C. After being freeze-dried, the supernatant was dissolved in 10% methanol. The solution was then added to the analysis of the LC–MS/MS system. Three biological duplicates of each sample were examined, and metabolite levels were normalized to total cell counts.
To perform peak alignment, peak selection, and quantification for every metabolite, Compound Discoverer 3.1 (CD3.1, Thermo Fisher, Waltham, MA, USA) was used to process the raw data files produced by UHPLC–MS/MS (Thermo Fisher, USA). The molecular formula was predicted using the normalized data based on fragment ions, additive ions, and molecular ion peaks. Peaks were then compared to the mzCloud (https://www.mzcloud.org/, accessed on 11 January 2023), mz Vault, and Mass List databases in order to acquire exact qualitative and relative quantitative results. The statistical software R (version R-3.4.3), Python (version 2.7.6), and CentOS (version 6.6) were used to conduct the statistical studies.

2.11. Intracellular GSH and GSSG Assay

Cellular GSH and GSSG were measured according to the method of Tao [25]. The cell samples were infected with the V. alginolyticus strain, as described above. After combining the cells with the protein removal reagent solution, the samples were quickly frozen and thawed twice in liquid nitrogen and a water bath at 37 °C. Following centrifugation at 12,000× g for 10 min, the supernatant was collected. GSH and GSSG in samples were detected by the GSH/GSSG assay kit (Beyotime, Shanghai, China).

2.12. Detection of Intracellular Iron Content

CIK cells were seeded in 12-well plates and cultured to approximately 70–80% confluence, followed by incubation with HY9901 (MOI = 50). Following the removal of the supernatant after 2 h, the cells were washed with PBS and digested into a single cell using a 0.25% trypsin solution. As directed by the manufacturer (Elabscience, Wuhan, China), the intracellular ferrous ion content was ascertained.

2.13. Statistical Analysis

To conduct statistical studies, GraphPad Prism (v8.0) was utilized. The Student’s t-test was used to establish the statistical significance of differences between HY9901 and ΔvopS. The data obtained from investigations of bacterial counts, swarming diameter, biofilm formation, cell adherence, and agglutination titers are displayed as X ± SD. Duncan’s test was used to assess group differences. When p < 0.05, the data was deemed statistically significant.

2.14. Biosecurity

The bacteria protocols were approved by the Biosecurity Committee of Guang Dong Ocean University (Zhanjiang, China).

3. Results

3.1. The V. alginolyticus vopS Shows Higher Conservation Within Vibrio spp.

The nucleotide sequence analysis showed that the ORF of vopS was 1164 bp (GenBank: KX245316) (Figure 1A). The relative molecular mass is 41.47 kDa, and the isoelectric point is 5.51, as predicted by ExPASy. A BLAST analysis indicated that the deduced amino acid of vopS exhibits 96–99% identity with some Vibrio spp. In particular, it shared the highest homology to vopS of V. harveyi (Figure 1B).
Using overlap PCR and a double-selection approach, an unmarked vopS deletion mutant was created in order to comprehend the potential functions of vopS in V. alginolyticus. HY9901 was determined by PCR amplification by generating a fragment of 2228 bp, while ΔvopS was determined by PCR by generating a fragment of 1775 bp (Figure 2A). C-vopS was confirmed by PCR amplification by generating a fragment of 1322 bp (Figure 2B).

3.2. ΔvopS Had Weak Extracellular Enzyme Activity and Virulence Compared to HY9901

In our preliminary experiments, we found that there was no discernible morphological difference between HY9901 and ΔvopS in transmission electron microscopy (TEM) (Figure 3A). Additionally, the deletion of vopS in HY9901 did not yield any differences in biofilm formation, growth, and adherence (Figure 3B,C). However, the extracellular protease activity of ΔvopS was significantly lower compared to HY9901(Table 3). To determine whether the vopS gene affected bacterial virulence, the orange-spotted grouper infectious disease model was used to determine the virulence in the three strains. The moribund fish and mortalities exhibited clinical symptoms of vibriosis, characterized by hemorrhaging, swelling, and ulcers on the skin surface. The LD50 value in HY9901 was significantly higher (6.29 × 105 cfu/fish) than in the ΔvopS (3.43 × 107 cfu/fish) (p < 0.01, Table 3), and the virulence of the complementary strain C-vopS was similar to that of HY9901. In conclusion, our results indicate that the vopS gene deletion reduced V. alginolyticus virulence.

3.3. VopS Affects the Transcription of T3SS Genes

VopS is an essential component of T3SS. To analyze the role of VopS in T3SS in depth, qRT-PCR was performed on the ΔvopS. Some T3SS-related genes were detected, including vsck, vscL, vscN, vopN, vscO, and hop. The vscO is a chaperone escort protein. The vscN, hop, and vopN are effector or regulatory, and vscL and vscK are apparatus proteins. The results showed that compared with HY9901, ΔvopS decreased the expression of hop and vscN and significantly increased the expression of vscL, vscK, vopN, and vscO (Figure 3D).

3.4. VopS Facilitates the Disruption of the Cytoskeleton and Induces Host-Cell Death

Our previous results showed that vopS was the essential gene to regulate V. alginolyticus virulence. We then visualized the nuclear morphology using Hoechst staining in order to further describe the process of cell death caused by the T3SS of V. alginolyticus. Nuclear condensation was observed in some HY9901 and C-vopS-infected cells at 30 min post-infection (Figure 4e,m). As the infection time extended, increasing amounts of cells showed apoptotic characteristics, including nucleus fragmentation and formation of apoptotic body, which could be seen by fluorescence microscope (Figure 4f–h,n–p). This phenotype resembled that seen in carbony1 cyanide 3-chlorophenyl 1 hydrazone (CCCP), a strong inducer of apoptosis (Figure 4q–t). Conversely, the nuclear compartments in ΔvopS-infection cells remained intact during infection, which was roughly in line with the uninfected cells’ appearance (Figure 4i–l,a–d). An LDH release assay was conducted to further assess the cytotoxicity of ΔvopS. As early as 30 min after infection with the HY9901 and C-vopS, we noticed a notable release of LDH into the medium. LDH concentrations in the medium rose in tandem with the infection duration, reaching over 80% total LDH release 3 h after infection (Figure 5A). Nevertheless, there was no discernible difference in the levels of LDH between the medium of ΔvopS-infected and uninfected cells (Figure 5A).
It is well established that caspase-3 is highly relevant for apoptotic cell death. We next examined whether the activation of caspase-3 in infected cells results in apoptosis or pyroptosis as a result of V. alginolyticus infection. As shown in Figure 5B, caspase-3 in the HY9901 and C-vopS-infected cells was clearly synthesized after 1 h of infection and peaked at 3 h. There was no significant difference between the HY9901 and C-vopS. In contrast, the level of caspase-3 in ΔvopS mutant was significantly lower compared to HY9901. In conclusion, these results indicate that deletion of vopS reduces bacterial cytotoxicity.

3.5. V. alginolyticus Infection-Induced Distinct Metabolome Alteration in the Infected Host Cell

Bacterial virulence factors can be delivered to host cells to hijack cellular metabolism. To study the metabolomic responses of the CIK cell line to the infection of V. alginolyticus, untargeted metabolomics analysis was used to profile metabolite changes in the HY9901-infected cells, ΔvopS-infected cells, and non-infected cells. In the three group cells, 2250 metabolites were identified (Table S1). Partial least-squares discrimination analysis (PLS-DA) revealed that the metabolites in the three groups of cells clustered separately with no marked differences within groups (Figure 6A,B). Next, we used orthogonal partial least-squares discrimination analysis (OPLS-DA) to further screen for metabolites related to infection. Based on a correlation p ≥ 0.5 as a cutoff and an absolute covariance p ≥ 0.05, two S-plots (Figure 6C,D) were constructed and used to identify key metabolites or biomarkers in the three groups. When HY9901-infected cells and non-infected cells were compared, 157 differential metabolites were identified, with 90 upregulated and 67 downregulated (Figure 6E).
To define the impact of V. alginolyticus infection on host metabolism, further analysis of the metabolic pathways involved in the significantly altered metabolites using Kyoto Encyclopedia of Genes and Genomes, a pathway analysis tool, revealed that the top 25 enriched pathways were mainly enriched in eight categories: biosynthesis of unsaturated fatty acids, aminoacyl-tRNA biosynthesis, protein digestion and absorption, D-Amino acid metabolism, ABC transporters, central carbon metabolism in cancer, biosynthesis of plant secondary metabolites, and biosynthesis of amino acids (Figure 6F and Table S2).
Following KEGG enrichment results, we identified significant accumulations of biosynthesis of unsaturated fatty acids intermediates, including icosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), dihomo-γ-linolenic acid, arachidonic acid, adrenic acid, palmitic acid, and stearic acid (Figure 6G,H). The levels of some tricarboxylic acid (TCA) cycle intermediates, including 2-oxoglutarate and succinate, were significantly decreased (Figure 6G,H). Notably, the levels of the tested ferroptosis intermediate L-glutamic acid were significantly decreased, while arachidonic acid and adrenic acid were significantly increased (Figure 6G,H). The levels of glycine, serine, and threonine metabolism and its downstream metabolites, glycine and glutathione (GSH), were significantly decreased in HY9901-infected cells (Figure 6G,H). Together, the metabolomics data indicate that V. alginolyticus infection enhances the biosynthesis of unsaturated fatty acids and ferroptosis, while reducing glycine, serine, and threonine metabolism and downstream metabolism of serine in infected CIK cells.

3.6. VopS Can Hijack Host Cell Fatty Acid Metabolism

We then investigated the metabolic responses of the ΔvopS-infected cells. When ΔvopS-infected cells and HY9901-infected cells were compared, 33 differential metabolites were identified, including 15 upregulated and 18 downregulated (Figure 6E). KEGG enrichment analyses revealed that the top 25 enriched pathways were mainly enriched in two categories: biosynthesis of plant secondary metabolites and microbial metabolism in diverse environments (Figure 7A and Table S2). Since evidence from the above study indicated that V. alginolyticus is associated with the dysregulation of fatty acid metabolism in the host, we subsequently focused on fatty acid metabolites in ΔvopS-infected cells. The levels of some biosynthesis of unsaturated fatty acids intermediate, including dihomo-γ-linolenic acid and adrenic acid, were significantly decreased (Figure 6G and Figure 7B). However, in glycine, serine, and threonine metabolism, L-threonine and 3-phosphoglyceric acid were significantly increased (Figure 6G and Figure 7B). In conclusion, our results indicated that V. alginolyticus enhances the biosynthesis of unsaturated fatty acids and ferroptosis by secreting VopS into the host.

3.7. VopS Can Induce Ferroptosis of CIK Cells

Our previous studies have demonstrated that VopS promoted the accumulation of unsaturated fatty acids, especially the accumulation of adrenic acid. Adrenic acid was reported as a marker of ferroptotic cell death [26]. To confirm that VopS is involved in the induction of ferroptosis cell death, we detected the level of GSH and ferrous (Fe2+) in the infected cell. As shown in Figure 8A, V. alginolyticus HY9901 infection led to a remarkable depletion of GSH compared with the control group. Deletion of the vopS gene could ameliorate the V. alginolyticus-induced decrease in total GSH. We also found that the Fe2+ iron levels elevated after V. alginolyticus infection, and Fe2+ accumulation of ΔvopS-infected cells was strongly reduced compared to HY9901-infected cells (Figure 8B). Therefore, these results indicated that VopS could induce ferroptosis in CIK cells.

4. Discussion

Vibriosis encodes T3SS to deliver effector proteins directly into the host cell cytoplasm, enabling them to survive in an external environment and destroy various signaling pathways [27]. Thus, it is important to conduct further in-depth studies on T3SS in V. alginolyticus to illustrate its pathogenesis.
VopS is considered a main virulence factor of the Vibrio parahaemolyticus T3SS1 and induces macrophage apoptosis by NF-κB inhibition [28]. In this study, we cloned the vopS gene in V. alginolyticus HY9901. The V. alginolyticus vopS gene was highly conserved in vibriosis, suggesting that VopS was an important effector protein in V. alginolyticus.
Vibrio growth, biofilm formation, extracellular protease secretion, and motility play important roles in adaptability to the environment [29,30], which increases the probability of adhesion, colonization, invasion, infection, and, finally, pathogenic processes in the host. To comprehensively investigate the roles of VopS on the pathogenesis of V. alginolyticus HY9901, the ∆vopS strain was constructed. Compared to HY9901, there was no significant difference in morphology, growth, swarming, and biofilm formation in ∆the vopS strain, which resembled the studies of Zhou et al. and Chen et al. [31,32]. Interestingly, the extracellular protease activity of ∆vopS was decreased compared to HY9901, indicating that vopS may be a positive contributor to extracellular protease activity in V. alginolyticus. Furthermore, the fish infection assay indicated that vopS positively regulates the virulence of V. alginolyticus to Epinephelus coioides. These findings support the pathogenic role of VopS in V. alginolyticus infection.
The V. alginolyticus T3SS is a complex, highly regulated nanomachine, which is regulated by a single regulatory protein or multiple regulatory proteins. For example, the expression of sycD, vopB, and vopD is significantly decreased by T3SS apparatus protein gene vscO depletion compared with the V. alginolyticus wild-type strain [31]. As reported previously, the vscX mRNA level is significantly up-regulated in the late growth stage in ΔvscO [33]. Similar results have previously been reported in the study of Zhou et al. [18]. In this study, ΔvopS showed decreased expression of hop, which encodes T3SS effector protein, indicating that the decrease in virulence of ΔvopS is reasonable. Nevertheless, the expression of vscL, vscK, vopN, and vscO was increased in ΔvopS. These results suggested that V. alginolyticus has complex regulatory networks to control the expression of T3SS genes. The regulatory mechanism network is still unknown, and its role in pathogenesis warrants further exploration.
Apoptosis is a well-known mechanism of programmed cell death and is mechanistically mediated by caspases [34]. The Rho small G protein family members are considered to be involved in cytoskeleton regulation [35]. It was reported that VopS from V. parahaemolyticus induced apoptosis through guanosine triphosphatase inhibition [14]. We further observed the V. alginolyticus-infected cells using Hoechst 33258 and found that the cellular cytoskeletal structure of CIK cells clearly collapsed, confirming that this effect is driven by VopS-mediated apoptosis. CIK cells infected with HY9901 maintained nuclear membrane integrity, although nuclear condensation was observed in those cells. Notably, we observed the cytoskeletons gradually collapsed from 180 min post-infection but not from the initial 120 min post-infection in ΔvopS strain-infected cells, compared to the control results and HY9901 infection. It was previously known that caspase-3 is a critical effector enzyme involved in apoptosis [36]. In this study, we demonstrated that VopS contributes to the activation of caspase-3 and LDH. The vopS gene deficiency delays the onset of apoptosis, but still does not prevent it. There may be other factors involved in CIK apoptosis.
Previously, although several reports showed that vibriosis dramatically altered the tricarboxylic acid cycle (TCA), amino acid metabolisms, and host cell glycolysis [37,38], it was unclear which biochemical pathways of host cells were significantly altered by V. alginolyticus. We found that V. alginolyticus also repressed host cell energy metabolism, including TCA cycle and serine synthesis metabolisms. Importantly, we observed V. alginolyticus modulates CIK cell biosynthesis of unsaturated fatty acids metabolism to promote the accumulation of arachidonic acid and adrenic acid in host cells, which has been linked to ferroptosis. Ferroptosis is a type of iron-dependent cell death driven by an accumulation of lipid peroxides [39]. Ferroptosis and apoptosis share similar characteristics, and apoptosis is stimulated upon induction of ferroptosis [40]. In the last decade, scientists have discovered markers for determining ferroptosis. In addition to monitoring lipid peroxidation, altered GSH and Fe2+ content can serve as indicators of ferroptosis [41]. Herein, we detected the GSH and Fe2+ content in infected cells, and the results corroborated the presence of ferroptosis during V. alginolyticus infection. Among the metabolites determined by the LC–MS/MS system, we also observed that 1- to 2-fold decreased levels of biosynthesis of unsaturated fatty acids intermediate, such as adrenic acid and dihomo-γ-linolenic acid, in CIK cells infected by ΔvopS compared to V. alginolyticus HY9901 strains. Our data proved that deletion of the vopS gene could mitigate V. alginolyticus-induced GSH consumption and Fe2+ deposition of CIK cells, suggesting vopS could promote ferroptosis in host cells. Naturally, there are several limitations to our research. The current validation of ferroptosis has been performed only by GSH and Fe2+ contents determination. Further research is needed to explore the underlying mechanisms of VopS-induced ferroptosis.

5. Conclusions

Our work lighted on the significance of VopS in the V. alginolyticus infection and provided novel targets for therapeutic strategies against vibriosis. The vopS gene, which can promote virulence, is required for extracellular protease secretion. V. alginolyticus is able to reprogram the biosynthesis of unsaturated fatty acids metabolism of CIK cells to initiate sufficient accumulation of arachidonic acid and adrenic acid to induce ferroptosis. Also, it was demonstrated that VopS was involved not only in V. alginolyticus-mediated apoptosis but also in ferroptosis. Here, we reveal that VopS is a critical virulent effector in host-pathogen interaction.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani14223250/s1, Table S1: All metabolites; Table S2: KEGG analysis.

Author Contributions

Conceptualization, W.Z. and H.P.; methodology, D.S.; software, formal analysis, C.H. and Z.C.; investigation, Y.Z. and S.Y.; writing—original draft preparation, W.Z.; writing—review and editing, N.W. and J.J.; funding acquisition, H.P. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32073015), the Innovation Program in Postgraduate Education of Guangdong Ocean University (No. 202337), Undergraduate Innovation Team of Guangdong Ocean University (No. CCTD201802), Innovation and Entrepreneurship Training Program for College Students (No. CXXL2024007), Innovation Program in Postgraduate Education of Guangdong Province.

Institutional Review Board Statement

All animal experiments were conducted strictly based on the recommendations in the ‘Guide for the Care and Use of Laboratory Animals’ set by the National Institutes of Health. The animal protocols were approved by the Animal Ethics Committee of Guangdong Ocean University (Zhanjiang, China). The ethically approved project identification code is 20151123.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets supporting the conclusions of this article are available in MetaboLights with the unique identifier MTBLS10677 (http://www. ebi.ac.uk/metabolights/MTBLS10677, accessed on 23 May 2024) for the metabolomics dataset.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Cai, S.H.; Wu, Z.H.; Jian, J.C.; Lu, Y.S. Cloning and Expression of Gene Encoding the Thermostable Direct Hemolysin from Vibrio alginolyticus Strain HY9901, the Causative Agent of Vibriosis of Crimson Snapper (Lutjanus erythopterus). J. Appl. Microbiol. 2007, 103, 289–296. [Google Scholar] [CrossRef] [PubMed]
  2. Zorrilla, I.; Chabrillón, M.; Arijo, S.; Díaz-Rosales, P.; Martínez-Manzanares, E.; Balebona, M.C.; Moriñigo, M.A. Bacteria recovered from diseased cultured gilthead sea bream (Sparus aurata L.) in southwestern Spain. Aquaculture 2003, 218, 11–20. [Google Scholar] [CrossRef]
  3. Pang, H.; Chen, L.; Hoare, R.; Huang, Y.; Zaohe, W.; Jian, J. Identification of DLD, by Immunoproteomic Analysis and Evaluation as a Potential Vaccine Antigen against Three Vibrio Species in Epinephelus coioides. Vaccine 2016, 34, 1225–1231. [Google Scholar] [CrossRef] [PubMed]
  4. Ozório, R.Á.; Lopes, R.G.; Vieira, F.d.N.; Bolívar-Ramírez, N.C.; Oliveira, C.Y.B.d.; Barracco, M.A.A.M.; Owatari, M.S.; Fracalossi, D.M.; Derner, R.B. Crude Polysaccharide Extract from the Microalga Porphyridium cruentum Improved Nonspecific Immune Responses and Resistance in Penaeus vannamei Exposed to Vibrio alginolyticus. Aquac. J. 2024, 4, 104–113. [Google Scholar] [CrossRef]
  5. Lee, K.K.; Yu, S.R.; Yang, T.I.; Liu, P.C.; Chen, F.R. Isolation and Characterization of Vibrio alginolyticus Isolated from Diseased Kuruma Prawn, Penaeus Japonicus. Lett. Appl. Microbiol. 1996, 22, 111–114. [Google Scholar] [CrossRef]
  6. Wang, J.; Ding, Q.; Yang, Q.; Fan, H.; Yu, G.; Liu, F.; Bello, B.K.; Zhang, X.; Zhang, T.; Dong, J.; et al. Vibrio alginolyticus Triggers Inflammatory Response in Mouse Peritoneal Macrophages via Activation of NLRP3 Inflammasome. Front. Cell. Infect. Microbiol. 2021, 11, 769777. [Google Scholar] [CrossRef]
  7. Roehrich, A.D.; Bordignon, E.; Mode, S.; Shen, D.-K.; Liu, X.; Pain, M.; Murillo, I.; Martinez-Argudo, I.; Sessions, R.B.; Blocker, A.J. Steps for Shigella Gatekeeper Protein MxiC Function in Hierarchical Type III Secretion Regulation. J. Biol. Chem. 2017, 292, 1705–1723. [Google Scholar] [CrossRef]
  8. Sukhan, A.; Kubori, T.; Galán, J.E. Synthesis and Localization of the Salmonella SPI-1 Type III Secretion Needle Complex Proteins PrgI and PrgJ. J. Bacteriol. 2003, 185, 3480–3483. [Google Scholar] [CrossRef]
  9. Pha, K.; Navarro, L. Yersinia Type III Effectors Perturb Host Innate Immune Responses. World J. Biol. Chem. 2016, 7, 1–13. [Google Scholar] [CrossRef]
  10. Coburn, B.; Sekirov, I.; Finlay, B.B. Type III Secretion Systems and Disease. Clin. Microbiol. Rev. 2007, 20, 535–549. [Google Scholar] [CrossRef]
  11. Salgado-Pabón, W.; Konradt, C.; Sansonetti, P.J.; Phalipon, A. New Insights into the Crosstalk between Shigella and T Lymphocytes. Trends Microbiol. 2014, 22, 192–198. [Google Scholar] [CrossRef] [PubMed]
  12. Ono, T.; Park, K.-S.; Ueta, M.; Iida, T.; Honda, T. Identification of Proteins Secreted via Vibrio parahaemolyticus Type III Secretion System 1. Infect. Immun. 2006, 74, 1032–1042. [Google Scholar] [CrossRef] [PubMed]
  13. Letchumanan, V.; Chan, K.-G.; Lee, L.-H. Vibrio parahaemolyticus: A Review on the Pathogenesis, Prevalence, and Advance Molecular Identification Techniques. Front. Microbiol. 2014, 5, 705. [Google Scholar] [CrossRef] [PubMed]
  14. Yarbrough, M.L.; Li, Y.; Kinch, L.N.; Grishin, N.V.; Ball, H.L.; Orth, K. AMPylation of Rho GTPases by Vibrio VopS Disrupts Effector Binding and Downstream Signaling. Science 2009, 323, 269–272. [Google Scholar] [CrossRef]
  15. Lewallen, D.M.; Steckler, C.J.; Knuckley, B.; Chalmers, M.J.; Thompson, P.R. Probing Adenylation: Using a Fluorescently Labelled ATP Probe to Directly Label and Immunoprecipitate VopS Substrates. Mol. Biosyst. 2012, 8, 1701–1706. [Google Scholar] [CrossRef]
  16. De Nisco, N.J.; Kanchwala, M.; Li, P.; Fernandez, J.; Xing, C.; Orth, K. Cytotoxic Vibrio T3SS1 Rewires Host Gene Expression to Subvert Cell Death Signaling and Activate Cell Survival Networks. Sci. Signal 2017, 10, eaal4501. [Google Scholar] [CrossRef]
  17. Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An Iron-Dependent Form of Nonapoptotic Cell Death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
  18. Zhou, S.; Tu, X.; Pang, H.; Hoare, R.; Monaghan, S.J.; Luo, J.; Jian, J. A T3SS Regulator Mutant of Vibrio alginolyticus Affects Antibiotic Susceptibilities and Provides Significant Protection to Danio Rerio as a Live Attenuated Vaccine. Front. Cell. Infect. Microbiol. 2020, 10, 183. [Google Scholar] [CrossRef]
  19. Pang, H.; Qiu, M.; Zhao, J.; Hoare, R.; Monaghan, S.J.; Song, D.; Chang, Y.; Jian, J. Construction of a Vibrio alginolyticus hopPmaJ (Hop) Mutant and Evaluation of Its Potential as a Live Attenuated Vaccine in Orange-Spotted Grouper (Epinephelus coioides). Fish Shellfish. Immunol. 2018, 76, 93–100. [Google Scholar] [CrossRef]
  20. Windle, H.J.; Kelleher, D. Identification and Characterization of a Metalloprotease Activity from Helicobacter Pylori. Infect. Immun. 1997, 65, 3132–3137. [Google Scholar] [CrossRef]
  21. Fletcher, M. The Effects of Culture Concentration and Age, Time, and Temperature on Bacterial Attachment to Polystyrene. Can. J. Microbiol 1977, 23, 1–6. [Google Scholar] [CrossRef]
  22. Tan, H.; Da, F.; Lin, G.; Wan, X.; Cai, S.; Cai, J.; Qin, Q. Construction of a Phosphodiesterase Mutant and Evaluation of Its Potential as an Effective Live Attenuated Vaccine in Pearl Gentian Grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus). Fish. Shellfish. Immunol. 2022, 124, 543–551. [Google Scholar] [CrossRef] [PubMed]
  23. Li, W.; Yao, Z.; Sun, L.; Hu, W.; Cao, J.; Lin, W.; Lin, X. Proteomics Analysis Reveals a Potential Antibiotic Cocktail Therapy Strategy for Aeromonas hydrophila Infection in Biofilm. J. Proteome Res. 2016, 15, 1810–1820. [Google Scholar] [CrossRef] [PubMed]
  24. Burdette, D.L.; Seemann, J.; Orth, K. Vibrio VopQ Induces PI3-Kinase-Independent Autophagy and Antagonizes Phagocytosis. Mol. Microbiol. 2009, 73, 639–649. [Google Scholar] [CrossRef]
  25. Tao, W.; Tuo, Z.; Wu, F.; Mu, K.; Xu, C.; Shi, Y.; Sun, Z.; Wang, Y.; Li, Y.; Zhong, Z.; et al. Albumin-Assembled Copper-Bismuth Bimetallic Sulfide Bioactive Nanosphere as an Amplifier of Oxidative Stress for Enhanced Radio-Chemodynamic Combination Therapy. Regen. Biomater. 2022, 9, rbac045. [Google Scholar] [CrossRef]
  26. Kraft, V.A.N.; Bezjian, C.T.; Pfeiffer, S.; Ringelstetter, L.; Müller, C.; Zandkarimi, F.; Merl-Pham, J.; Bao, X.; Anastasov, N.; Kössl, J.; et al. GTP Cyclohydrolase 1/Tetrahydrobiopterin Counteract Ferroptosis through Lipid Remodeling. ACS Cent. Sci. 2020, 6, 41–53. [Google Scholar] [CrossRef]
  27. Wilharm, G.; Heider, C. Interrelationship between Type Three Secretion System and Metabolism in Pathogenic Bacteria. Front. Cell Infect. Microbiol. 2014, 4, 150. [Google Scholar] [CrossRef]
  28. Bhattacharjee, R.N.; Park, K.-S.; Kumagai, Y.; Okada, K.; Yamamoto, M.; Uematsu, S.; Matsui, K.; Kumar, H.; Kawai, T.; Iida, T.; et al. VP1686, a Vibrio Type III Secretion Protein, Induces Toll-like Receptor-Independent Apoptosis in Macrophage through NF-kappaB Inhibition. J. Biol. Chem. 2006, 281, 36897–36904. [Google Scholar] [CrossRef]
  29. Deng, Y.; Chen, C.; Zhao, Z.; Zhao, J.; Jacq, A.; Huang, X.; Yang, Y. The RNA Chaperone Hfq Is Involved in Colony Morphology, Nutrient Utilization and Oxidative and Envelope Stress Response in Vibrio alginolyticus. PLoS ONE 2016, 11, e0163689. [Google Scholar] [CrossRef]
  30. McCarter, L.L. Dual Flagellar Systems Enable Motility under Different Circumstances. J. Mol. Microbiol. Biotechnol. 2004, 7, 18–29. [Google Scholar] [CrossRef]
  31. Zhou, Z.; Pang, H.; Ding, Y.; Cai, J.; Huang, Y.; Jian, J.; Wu, Z. VscO, a Putative T3SS Chaperone Escort of Vibrio alginolyticus, Contributes to Virulence in Fish and Is a Target for Vaccine Development. Fish Shellfish. Immunol. 2013, 35, 1523–1531. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, Y.; Wu, F.; Pang, H.; Tang, J.; Cai, S.; Jian, J. Superoxide Dismutase B (sodB), an Important Virulence Factor of Vibrio alginolyticus, Contributes to Antioxidative Stress and Its Potential Application for Live Attenuated Vaccine. Fish Shellfish. Immunol. 2019, 89, 354–360. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, X.; Li, J.; Pang, H.; Chang, Y.; Huang, Y. Molecular Cloning, Bioinformatics Analysis and Expression Analysis of Type IH Secretion System (T3SS) Injectisome Gene vscX from Vibrio alginolyticus. Agric. Biotechnol. 2017, 6, 41–45. [Google Scholar]
  34. Lee, K.-S.; Lee, M.-G.; Kwon, Y.-S.; Nam, K.-S. Arctigenin Enhances the Cytotoxic Effect of Doxorubicin in MDA-MB-231 Breast Cancer Cells. Int. J. Mol. Sci. 2020, 21, 2997. [Google Scholar] [CrossRef]
  35. Liu, H.; Cheng, Q.; Xu, D.-S.; Wang, W.; Fang, Z.; Xue, D.-D.; Zheng, Y.; Chang, A.H.; Lei, Y.-J. Overexpression of CXCR7 Accelerates Tumor Growth and Metastasis of Lung Cancer Cells. Respir. Res. 2020, 21, 287. [Google Scholar] [CrossRef] [PubMed]
  36. Mahajna, S.; Kadan, S.; Tietel, Z.; Saad, B.; Khasib, S.; Tumeh, A.; Ginsberg, D.; Zaid, H. In Vitro Evaluation of Chemically Analyzed Hypericum Triquetrifolium Extract Efficacy in Apoptosis Induction and Cell Cycle Arrest of the HCT-116 Colon Cancer Cell Line. Molecules 2019, 24, 4139. [Google Scholar] [CrossRef]
  37. Nguyen, A.Q.; Shimohata, T.; Hatayama, S.; Tentaku, A.; Kido, J.; Bui, T.M.H.; Uebanso, T.; Mawatari, K.; Takahashi, A. Type III Secretion Effector VopQ of Vibrio parahaemolyticus Modulates Central Carbon Metabolism in Epithelial Cells. mSphere 2020, 5, e00960-19. [Google Scholar] [CrossRef]
  38. Wang, Z.; Aweya, J.J.; Yao, D.; Zheng, Z.; Wang, C.; Zhao, Y.; Li, S.; Zhang, Y. Taurine Metabolism Is Modulated in Vibrio-Infected Penaeus Vannamei to Shape Shrimp Antibacterial Response and Survival. Microbiome 2022, 10, 213. [Google Scholar] [CrossRef]
  39. Huang, G.; Ma, L.; Shen, L.; Lei, Y.; Guo, L.; Deng, Y.; Ding, Y. MIF/SCL3A2 Depletion Inhibits the Proliferation and Metastasis of Colorectal Cancer Cells via the AKT/GSK-3β Pathway and Cell Iron Death. J. Cell. Mol. Med. 2022, 26, 3410–3422. [Google Scholar] [CrossRef]
  40. Xue, X.; Ma, L.; Zhang, X.; Xu, X.; Guo, S.; Wang, Y.; Qiu, S.; Cui, J.; Guo, W.; Yu, Y.; et al. Tumour Cells Are Sensitised to Ferroptosis via RB1CC1-Mediated Transcriptional Reprogramming. Clin. Transl. Med. 2022, 12, e747. [Google Scholar] [CrossRef]
  41. Zhang, Y.; Zhang, J.; Feng, D.; Zhou, H.; Gui, Z.; Zheng, M.; Hang, Z.; Wang, Z.; Wang, Z.; Gu, M.; et al. IRF1/ZNF350/GPX4-Mediated Ferroptosis of Renal Tubular Epithelial Cells Promote Chronic Renal Allograft Interstitial Fibrosis. Free Radic. Biol. Med. 2022, 193, 579–594. [Google Scholar] [CrossRef] [PubMed]
Figure 1. (A) Cloning of vopS gene. Lane 1: DL2000 marker. Lane 2–4: The 1164 bp fragment was amplified from genomic DNA of the wild-type strain HY9901 using primer pairs of vopS1/vopS2. (B) Homology comparison of the amino acid sequence of vibrio vopS with other bacteria Vibrio alginolyticus Accession No. WP_017821339.1; Vibrio harveyi group Accession No. WP_025768118.1; Vibrio antiquarius Accession No. WP_074191275.1; Vibrio diabolicus Accession No. WP_048626460.1; Vibrio parahaemolyticus Accession No. WP_053807485.1.
Figure 1. (A) Cloning of vopS gene. Lane 1: DL2000 marker. Lane 2–4: The 1164 bp fragment was amplified from genomic DNA of the wild-type strain HY9901 using primer pairs of vopS1/vopS2. (B) Homology comparison of the amino acid sequence of vibrio vopS with other bacteria Vibrio alginolyticus Accession No. WP_017821339.1; Vibrio harveyi group Accession No. WP_025768118.1; Vibrio antiquarius Accession No. WP_074191275.1; Vibrio diabolicus Accession No. WP_048626460.1; Vibrio parahaemolyticus Accession No. WP_053807485.1.
Animals 14 03250 g001
Figure 2. Construction and confirmation of the knockout mutant strain ΔvopS and C-vopS. (A) PCR identification of ΔvopS (Primers: vopS-TF/vopS-TR). Lane 1: DL2000 marker; Lane 2: HY9901; Lane 3: β2163 (pLP12-vopS); Lane 4–7: ΔvopS. (B) PCR identification of C-vopS (Primers: pBAD-mcf-TF/pNAD-mcf-TR). Lane 1: DL2000 marker; Lane 2: β2163 (vopS-pBAD33cm-rp4); Lane 3: ΔvopS; Lane 4–7: C-vopS.
Figure 2. Construction and confirmation of the knockout mutant strain ΔvopS and C-vopS. (A) PCR identification of ΔvopS (Primers: vopS-TF/vopS-TR). Lane 1: DL2000 marker; Lane 2: HY9901; Lane 3: β2163 (pLP12-vopS); Lane 4–7: ΔvopS. (B) PCR identification of C-vopS (Primers: pBAD-mcf-TF/pNAD-mcf-TR). Lane 1: DL2000 marker; Lane 2: β2163 (vopS-pBAD33cm-rp4); Lane 3: ΔvopS; Lane 4–7: C-vopS.
Animals 14 03250 g002
Figure 3. (A) Observation of the morphological feature of (a) HY9901 and (b) ∆vopS by SEM; (B) Growth curve of different strains; (C) Biofilm of different strains; (D) Expression of HY9901 and ΔvopS T3SS-related genes induced by DMEM. * indicates significant difference compared with the control group (p < 0.05). ** indicates extremely significant difference compared with the control group (p < 0.01).
Figure 3. (A) Observation of the morphological feature of (a) HY9901 and (b) ∆vopS by SEM; (B) Growth curve of different strains; (C) Biofilm of different strains; (D) Expression of HY9901 and ΔvopS T3SS-related genes induced by DMEM. * indicates significant difference compared with the control group (p < 0.05). ** indicates extremely significant difference compared with the control group (p < 0.01).
Animals 14 03250 g003aAnimals 14 03250 g003b
Figure 4. Laser scanning confocal microscopy infection observation (100 µm). V. alginolyticus infection of CIK cells induces nuclear condensation and fragmentation in a T3SS-dependent manner. CIK cells were infected with strain HY9901 (eh), ΔvopS (il), or C-vopS (mp) as described. Cells were treated with 2 μM STS as a positive control (qt) or left uninfected(ad) for the negative control. Nuclear condensation and fragmentation were visualized using Hoechst 33258 to stain nuclei at indicated time points after infection.
Figure 4. Laser scanning confocal microscopy infection observation (100 µm). V. alginolyticus infection of CIK cells induces nuclear condensation and fragmentation in a T3SS-dependent manner. CIK cells were infected with strain HY9901 (eh), ΔvopS (il), or C-vopS (mp) as described. Cells were treated with 2 μM STS as a positive control (qt) or left uninfected(ad) for the negative control. Nuclear condensation and fragmentation were visualized using Hoechst 33258 to stain nuclei at indicated time points after infection.
Animals 14 03250 g004
Figure 5. (A) LDH release caused by V. alginolyticus infection in CIK cells. (B) Measurement of caspase-3 activity. ** indicates extremely significant difference compared with the control group (p < 0.01).
Figure 5. (A) LDH release caused by V. alginolyticus infection in CIK cells. (B) Measurement of caspase-3 activity. ** indicates extremely significant difference compared with the control group (p < 0.01).
Animals 14 03250 g005
Figure 6. (A) Principal component analysis (PCA) of HY9901-infected group and non-infected group based on Bray–Curtis distance. (B) Principal component analysis (PCA) of HY9901-infected group and VopS-infected group based on Bray–Curtis distance. (C) S-plot generated from OPLS-DA for HY9901-infected group vs. non-infected group. (D) S-plot generated from OPLS-DA for HY9901-infected group vs. VopS-infected group. (E) Differential metabolites in PBS vs. HY9901 and HY9901 vs. VopS (p < 0.05, VIP ≥ 1). (F) KEGG showed 30 significantly (p < 0.05) enriched biological pathways associated with V. alginolyticus infection. (G) Significantly expressed metabolite categories related to V. alginolyticus infection and analyzed by heatmap. (H) Fold changes in biosynthesis of unsaturated fatty acids, TCA cycle, ferroptosis, glycine, serine, threonine, glycine, and glutathione metabolism for V. alginolyticus infection.
Figure 6. (A) Principal component analysis (PCA) of HY9901-infected group and non-infected group based on Bray–Curtis distance. (B) Principal component analysis (PCA) of HY9901-infected group and VopS-infected group based on Bray–Curtis distance. (C) S-plot generated from OPLS-DA for HY9901-infected group vs. non-infected group. (D) S-plot generated from OPLS-DA for HY9901-infected group vs. VopS-infected group. (E) Differential metabolites in PBS vs. HY9901 and HY9901 vs. VopS (p < 0.05, VIP ≥ 1). (F) KEGG showed 30 significantly (p < 0.05) enriched biological pathways associated with V. alginolyticus infection. (G) Significantly expressed metabolite categories related to V. alginolyticus infection and analyzed by heatmap. (H) Fold changes in biosynthesis of unsaturated fatty acids, TCA cycle, ferroptosis, glycine, serine, threonine, glycine, and glutathione metabolism for V. alginolyticus infection.
Animals 14 03250 g006aAnimals 14 03250 g006bAnimals 14 03250 g006cAnimals 14 03250 g006dAnimals 14 03250 g006e
Figure 7. (A) KEGG showed 30 significantly (p < 0.05) enriched biological pathways associated with ΔvopS infection. (B) Fold changes in biosynthesis of unsaturated fatty acids and glycine, serine, and threonine metabolism for ΔvopS infection.
Figure 7. (A) KEGG showed 30 significantly (p < 0.05) enriched biological pathways associated with ΔvopS infection. (B) Fold changes in biosynthesis of unsaturated fatty acids and glycine, serine, and threonine metabolism for ΔvopS infection.
Animals 14 03250 g007aAnimals 14 03250 g007b
Figure 8. (A) Cellular glutathione concentrations of CIK cells infected with different V. alginolyticus mutants for 2 h. (B) Cellular Fe2+ accumulation of CIK cells infected with different V. alginolyticus mutants for 2 h. * indicates significant difference compared with the control group (p < 0.05). ** indicates extremely significant difference compared with the control group (p < 0.01). **** indicates significant difference compared with the control group (p < 0.0001).
Figure 8. (A) Cellular glutathione concentrations of CIK cells infected with different V. alginolyticus mutants for 2 h. (B) Cellular Fe2+ accumulation of CIK cells infected with different V. alginolyticus mutants for 2 h. * indicates significant difference compared with the control group (p < 0.05). ** indicates extremely significant difference compared with the control group (p < 0.01). **** indicates significant difference compared with the control group (p < 0.0001).
Animals 14 03250 g008
Table 1. Bacterial strains, plasmids, and cell lines used in this study.
Table 1. Bacterial strains, plasmids, and cell lines used in this study.
Strains, Plasmids, Cell LineRelevant CharacteristicsSource or References
V. alginolyticus HY9901Wild type, isolated from diseased Lutjanus sanguineus off the Southern China coastThis study
ΔvopSHY9901 carrying an in-frame deletion of vopSThis study
E. coli DH5αsupE44 ΔlacU169 (φ80 lacZDM15) hsdR17 recA1 gyrA96 thi-1 relA1Sangon, China
pBAD33-CMaraBAD promoter, CmrThis study
pLP12E. coli-suicide vectorThis study
E. coli β2163Competent cellsThis study
β2163-pLP12-ΔvopSβ2163 containing plasmid of pLP12-ΔvopS, CmrThis study
β2163-pBAD33-CM-ΔvopSβ2163containing plasmid of pBAD33-CM-ΔvopS, CmrThis study
pMD18-TCloning vector, AmprTakara,J
pLP12-ΔvopSpLP12 containing vopS gene in-frame deletion, CmrThis study
CIKGrass carp cells in the kidneyThis study
Table 2. Sequences of primers used in this study.
Table 2. Sequences of primers used in this study.
Primer NamePrimer Sequence (5′-3′)
Cloning primers
vopS1ATGATCAGTTTTGGAAGTGTT
vopS2 mutant constructionTCACTTAATACCGTGAAGGCTA
vopS-MF1GGAATCTAGACCTTGAGTCGACTTCTTTACTGACAGATTTTGCCA
vopS-MR1TTACGAAGTTCTGCTATCGCGTATAGCGCGCTAACACTTCCAAAACT
vopS-MF2AGTTTTGGAAGTGTTAGCGCGCTATACGCGATAGCAGAACTTCGTAA
vopS-MR2ACAGCTAGCGACGATATGTCCTCTACGAGCAGAACATCGACAC
vopS-TFCCATTTCTAAAATATTCACTGCCATAA
vopS-TRGCACACCACCTGTTTCTCGAT
pLP-UFGACACAGTTGTAACTGGTCCA
pLP-URCAGGAACACTTAACGGCTGAC
Complement construction
pBAD30-ZFCTAGAGTCGACCTGCAGGCA
pBAD30-ZRAGCTCGAATTCGCTAGCCCA
vopS-RFTGGGCTAGCGAATTCGAGCTAGGAGGAATTCACCATGATCAGTTTTGGA
vopS-RRTGCCTGCAGGTCGACTCTAGTCACTTAATACCGTG
RP4-F2CGAATTGGGTACCAGCGCTT
RP4-R2TACCGTCGACGCCGGCCAGC
PBAD30-mcf-TFCCATAAGATTAGCGGATCCTACCT
qPCR primersCTTCTCTCATCCGCCAAAACAG
vscL-FTACCACGGTGAGTGTAGTTC
vscL-RCGTAACCGACTTCAGGGA
hop-FCTTCGCTTTCGGTTTGCT
hop-RAATACCATCCCACCCTGT
vscO-FGAGCTGGAAACATTAAGACA
vscO-RTTGCTGCAACTGAACGAA
vscK-FGGCGTTATCTCCCGTTCC
vscK-RCTCCGCCCACCATCAATA
vopN-FTGAACTCGTTTCGGACTA
vopN-RACTTTCTGGACTCGCACT
vscN-FTAGGCGAAGAAGGAATGG
vscN-RGCGATAGAAGTGGCAACAA
YSCK-FGGCGTTATCTCCCGTTCC
YSCK-RCTCCGCCCACCATCAATA
16S-FTTGCGAGAGTGAGCGAATCC
16S-RATGGTGTGACGGGCGGTGTG
Table 3. Characteristics of different strains.
Table 3. Characteristics of different strains.
CharacteristicsHY9901ΔvopSC-vopS
Acitivity of ECP a0.47 ± 0.010.32 ± 0.010.47 ± 0.02
Swarming (mm) b44.7 ± 0.1344.1 ± 0.1744.6 ± 0.16
LD50 c6.29 × 1053.43 × 107 **6.35 × 105
**: p < 0.01. Values are mean ± standard deviation for three trials. a Bacteria were incubated in TSB for 18 h at 28 °C. b Swarming diameters were measured after 24 h incubation on TSA containing 0.3% agar plates. c LD50 were evaluated in E. coioides with an average weight of 20.0 ± 2 g.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, W.; Huang, C.; Chen, Z.; Song, D.; Zhang, Y.; Yang, S.; Wang, N.; Jian, J.; Pang, H. Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals 2024, 14, 3250. https://doi.org/10.3390/ani14223250

AMA Style

Zhang W, Huang C, Chen Z, Song D, Zhang Y, Yang S, Wang N, Jian J, Pang H. Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals. 2024; 14(22):3250. https://doi.org/10.3390/ani14223250

Chicago/Turabian Style

Zhang, Weijie, Chao Huang, Zhihang Chen, Dawei Song, Yujia Zhang, Shuai Yang, Na Wang, Jichang Jian, and Huanying Pang. 2024. "Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis" Animals 14, no. 22: 3250. https://doi.org/10.3390/ani14223250

APA Style

Zhang, W., Huang, C., Chen, Z., Song, D., Zhang, Y., Yang, S., Wang, N., Jian, J., & Pang, H. (2024). Vibrio alginolyticus Reprograms CIK Cell Metabolism via T3SS Effector VopS to Promote Host Cell Ferroptosis. Animals, 14(22), 3250. https://doi.org/10.3390/ani14223250

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop